ID: 1030050023

View in Genome Browser
Species Human (GRCh38)
Location 7:105529692-105529714
Sequence GGGCCAGGTGCAGTGGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2767
Summary {0: 19, 1: 111, 2: 358, 3: 778, 4: 1501}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030050020_1030050023 -7 Left 1030050020 7:105529676-105529698 CCAAAAATACAGTTAGGGGCCAG No data
Right 1030050023 7:105529692-105529714 GGGCCAGGTGCAGTGGCTCATGG 0: 19
1: 111
2: 358
3: 778
4: 1501

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030050023 Original CRISPR GGGCCAGGTGCAGTGGCTCA TGG Intergenic
Too many off-targets to display for this crispr