ID: 1030050025

View in Genome Browser
Species Human (GRCh38)
Location 7:105529712-105529734
Sequence TGGCTGTAATCCTAGCACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 621516
Summary {0: 88, 1: 9401, 2: 115478, 3: 250982, 4: 245567}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030050020_1030050025 13 Left 1030050020 7:105529676-105529698 CCAAAAATACAGTTAGGGGCCAG No data
Right 1030050025 7:105529712-105529734 TGGCTGTAATCCTAGCACTTTGG 0: 88
1: 9401
2: 115478
3: 250982
4: 245567
1030050024_1030050025 -6 Left 1030050024 7:105529695-105529717 CCAGGTGCAGTGGCTCATGGCTG 0: 63
1: 7030
2: 28131
3: 74214
4: 131829
Right 1030050025 7:105529712-105529734 TGGCTGTAATCCTAGCACTTTGG 0: 88
1: 9401
2: 115478
3: 250982
4: 245567

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030050025 Original CRISPR TGGCTGTAATCCTAGCACTT TGG Intergenic
Too many off-targets to display for this crispr