ID: 1030050026

View in Genome Browser
Species Human (GRCh38)
Location 7:105529713-105529735
Sequence GGCTGTAATCCTAGCACTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 725147
Summary {0: 139, 1: 18607, 2: 254738, 3: 280632, 4: 171031}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030050020_1030050026 14 Left 1030050020 7:105529676-105529698 CCAAAAATACAGTTAGGGGCCAG No data
Right 1030050026 7:105529713-105529735 GGCTGTAATCCTAGCACTTTGGG 0: 139
1: 18607
2: 254738
3: 280632
4: 171031
1030050024_1030050026 -5 Left 1030050024 7:105529695-105529717 CCAGGTGCAGTGGCTCATGGCTG 0: 63
1: 7030
2: 28131
3: 74214
4: 131829
Right 1030050026 7:105529713-105529735 GGCTGTAATCCTAGCACTTTGGG 0: 139
1: 18607
2: 254738
3: 280632
4: 171031

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030050026 Original CRISPR GGCTGTAATCCTAGCACTTT GGG Intergenic
Too many off-targets to display for this crispr