ID: 1030050027

View in Genome Browser
Species Human (GRCh38)
Location 7:105529716-105529738
Sequence TGTAATCCTAGCACTTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 867302
Summary {0: 22138, 1: 313177, 2: 258607, 3: 141974, 4: 131406}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030050024_1030050027 -2 Left 1030050024 7:105529695-105529717 CCAGGTGCAGTGGCTCATGGCTG 0: 63
1: 7030
2: 28131
3: 74214
4: 131829
Right 1030050027 7:105529716-105529738 TGTAATCCTAGCACTTTGGGAGG 0: 22138
1: 313177
2: 258607
3: 141974
4: 131406
1030050020_1030050027 17 Left 1030050020 7:105529676-105529698 CCAAAAATACAGTTAGGGGCCAG No data
Right 1030050027 7:105529716-105529738 TGTAATCCTAGCACTTTGGGAGG 0: 22138
1: 313177
2: 258607
3: 141974
4: 131406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030050027 Original CRISPR TGTAATCCTAGCACTTTGGG AGG Intergenic
Too many off-targets to display for this crispr