ID: 1030050029

View in Genome Browser
Species Human (GRCh38)
Location 7:105529726-105529748
Sequence GCACTTTGGGAGGTCAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 505300
Summary {0: 103, 1: 5382, 2: 74204, 3: 192477, 4: 233134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030050020_1030050029 27 Left 1030050020 7:105529676-105529698 CCAAAAATACAGTTAGGGGCCAG No data
Right 1030050029 7:105529726-105529748 GCACTTTGGGAGGTCAAGACAGG 0: 103
1: 5382
2: 74204
3: 192477
4: 233134
1030050024_1030050029 8 Left 1030050024 7:105529695-105529717 CCAGGTGCAGTGGCTCATGGCTG 0: 63
1: 7030
2: 28131
3: 74214
4: 131829
Right 1030050029 7:105529726-105529748 GCACTTTGGGAGGTCAAGACAGG 0: 103
1: 5382
2: 74204
3: 192477
4: 233134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030050029 Original CRISPR GCACTTTGGGAGGTCAAGAC AGG Intergenic
Too many off-targets to display for this crispr