ID: 1030050573

View in Genome Browser
Species Human (GRCh38)
Location 7:105533394-105533416
Sequence CATATACTCCCGTACTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 27}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030050573_1030050579 13 Left 1030050573 7:105533394-105533416 CCTCCCTAGTACGGGAGTATATG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1030050579 7:105533430-105533452 CTTTTGCCATTTTACTTTGATGG No data
1030050573_1030050580 17 Left 1030050573 7:105533394-105533416 CCTCCCTAGTACGGGAGTATATG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1030050580 7:105533434-105533456 TGCCATTTTACTTTGATGGCAGG 0: 1
1: 1
2: 0
3: 11
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030050573 Original CRISPR CATATACTCCCGTACTAGGG AGG (reversed) Intronic