ID: 1030050574 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:105533397-105533419 |
| Sequence | TGACATATACTCCCGTACTA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1030050574_1030050580 | 14 | Left | 1030050574 | 7:105533397-105533419 | CCCTAGTACGGGAGTATATGTCA | No data | ||
| Right | 1030050580 | 7:105533434-105533456 | TGCCATTTTACTTTGATGGCAGG | 0: 1 1: 1 2: 0 3: 11 4: 160 |
||||
| 1030050574_1030050582 | 30 | Left | 1030050574 | 7:105533397-105533419 | CCCTAGTACGGGAGTATATGTCA | No data | ||
| Right | 1030050582 | 7:105533450-105533472 | TGGCAGGTTATTGCAAATCAAGG | No data | ||||
| 1030050574_1030050579 | 10 | Left | 1030050574 | 7:105533397-105533419 | CCCTAGTACGGGAGTATATGTCA | No data | ||
| Right | 1030050579 | 7:105533430-105533452 | CTTTTGCCATTTTACTTTGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1030050574 | Original CRISPR | TGACATATACTCCCGTACTA GGG (reversed) | Intronic | ||