ID: 1030050574

View in Genome Browser
Species Human (GRCh38)
Location 7:105533397-105533419
Sequence TGACATATACTCCCGTACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 22}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030050574_1030050582 30 Left 1030050574 7:105533397-105533419 CCCTAGTACGGGAGTATATGTCA 0: 1
1: 0
2: 0
3: 0
4: 22
Right 1030050582 7:105533450-105533472 TGGCAGGTTATTGCAAATCAAGG No data
1030050574_1030050580 14 Left 1030050574 7:105533397-105533419 CCCTAGTACGGGAGTATATGTCA 0: 1
1: 0
2: 0
3: 0
4: 22
Right 1030050580 7:105533434-105533456 TGCCATTTTACTTTGATGGCAGG 0: 1
1: 1
2: 0
3: 11
4: 160
1030050574_1030050579 10 Left 1030050574 7:105533397-105533419 CCCTAGTACGGGAGTATATGTCA 0: 1
1: 0
2: 0
3: 0
4: 22
Right 1030050579 7:105533430-105533452 CTTTTGCCATTTTACTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030050574 Original CRISPR TGACATATACTCCCGTACTA GGG (reversed) Intronic
1067507880 10:46871985-46872007 TGACCTATCCTCCCTTACTCAGG + Intergenic
1068306797 10:55221725-55221747 TGACATATACTACACTTCTATGG - Intronic
1072127414 10:92459331-92459353 TCACATTTTCTCCTGTACTAGGG - Intronic
1072169012 10:92842414-92842436 TGACATTTACTCCCTGGCTAGGG - Intronic
1115423415 14:33224479-33224501 TGACATTTACTAACATACTATGG - Intronic
1118795301 14:69138340-69138362 TGAGCTATACTTCCGTACTTTGG - Intronic
1146935761 17:36811718-36811740 TGACATTTTCTCCCACACTAGGG - Intergenic
949383688 3:3474929-3474951 TGATATATACTTCCATAATAAGG - Intergenic
952546511 3:34425813-34425835 TAACATATACTCAGGTTCTAGGG - Intergenic
952648203 3:35688313-35688335 TGACATATACATCTGTACTTTGG - Intronic
984742697 4:183181821-183181843 TGACATCTACTCCAATACTTTGG - Intronic
992901909 5:81305348-81305370 TGGCATATATTCCCATATTATGG + Intronic
1013263533 6:108470938-108470960 GGACAGATACTCCTGTGCTAAGG + Intronic
1027775475 7:82459287-82459309 TGACACATTCACCGGTACTAAGG - Intergenic
1030050574 7:105533397-105533419 TGACATATACTCCCGTACTAGGG - Intronic
1030352184 7:108501998-108502020 TGACATATACTTCAGTTCTTTGG - Intronic
1036741882 8:11370464-11370486 TCACATATACTCCCAAAATAAGG - Intergenic
1038984814 8:32797022-32797044 TGACACATACTCCCACAGTAGGG - Intergenic
1044006158 8:86939416-86939438 TGACATATATAACTGTACTATGG + Intronic
1045921904 8:107540162-107540184 TGACATAGACTTTGGTACTATGG + Intergenic
1047598772 8:126405897-126405919 TGACATATAGCCCAGTACAAGGG + Intergenic
1192533506 X:71909912-71909934 GGACATATGCTCACGTACTCTGG + Intergenic
1193838110 X:86372022-86372044 TGACATATACTGCCATATTTTGG - Intronic