ID: 1030050574

View in Genome Browser
Species Human (GRCh38)
Location 7:105533397-105533419
Sequence TGACATATACTCCCGTACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030050574_1030050582 30 Left 1030050574 7:105533397-105533419 CCCTAGTACGGGAGTATATGTCA No data
Right 1030050582 7:105533450-105533472 TGGCAGGTTATTGCAAATCAAGG No data
1030050574_1030050580 14 Left 1030050574 7:105533397-105533419 CCCTAGTACGGGAGTATATGTCA No data
Right 1030050580 7:105533434-105533456 TGCCATTTTACTTTGATGGCAGG 0: 1
1: 1
2: 0
3: 11
4: 160
1030050574_1030050579 10 Left 1030050574 7:105533397-105533419 CCCTAGTACGGGAGTATATGTCA No data
Right 1030050579 7:105533430-105533452 CTTTTGCCATTTTACTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030050574 Original CRISPR TGACATATACTCCCGTACTA GGG (reversed) Intronic