ID: 1030050575

View in Genome Browser
Species Human (GRCh38)
Location 7:105533398-105533420
Sequence CTGACATATACTCCCGTACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 33}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030050575_1030050579 9 Left 1030050575 7:105533398-105533420 CCTAGTACGGGAGTATATGTCAG 0: 1
1: 0
2: 1
3: 3
4: 33
Right 1030050579 7:105533430-105533452 CTTTTGCCATTTTACTTTGATGG No data
1030050575_1030050582 29 Left 1030050575 7:105533398-105533420 CCTAGTACGGGAGTATATGTCAG 0: 1
1: 0
2: 1
3: 3
4: 33
Right 1030050582 7:105533450-105533472 TGGCAGGTTATTGCAAATCAAGG No data
1030050575_1030050583 30 Left 1030050575 7:105533398-105533420 CCTAGTACGGGAGTATATGTCAG 0: 1
1: 0
2: 1
3: 3
4: 33
Right 1030050583 7:105533451-105533473 GGCAGGTTATTGCAAATCAAGGG No data
1030050575_1030050580 13 Left 1030050575 7:105533398-105533420 CCTAGTACGGGAGTATATGTCAG 0: 1
1: 0
2: 1
3: 3
4: 33
Right 1030050580 7:105533434-105533456 TGCCATTTTACTTTGATGGCAGG 0: 1
1: 1
2: 0
3: 11
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030050575 Original CRISPR CTGACATATACTCCCGTACT AGG (reversed) Intronic
904008967 1:27379326-27379348 CTGACATCTCCTCCTGTCCTGGG - Exonic
904925198 1:34042135-34042157 CTTACATTTACTCCAGTAATGGG - Intronic
910802849 1:91162723-91162745 CTGACATTTTCTCACATACTTGG + Intergenic
1063079015 10:2747189-2747211 CTGACATTTCCTCCCGTACTGGG + Intergenic
1066430562 10:35347154-35347176 CAGACACATTGTCCCGTACTGGG + Intronic
1069871909 10:71538289-71538311 CTGACATATTTTCCCTCACTGGG - Intronic
1072169013 10:92842415-92842437 CTGACATTTACTCCCTGGCTAGG - Intronic
1074444160 10:113504735-113504757 CTGACACATACACACGTAGTAGG - Intergenic
1075363913 10:121865611-121865633 CTGATATGTACTCCCCTGCTAGG - Intronic
1082006741 11:47423464-47423486 CTGCCATATACTCCCGTTCCTGG - Intronic
1094368388 12:29708083-29708105 CTGACATATCCCACAGTACTGGG - Intronic
1097752361 12:63370070-63370092 ATAATATATACTCCTGTACTGGG + Intergenic
1104516582 12:129432492-129432514 CTTACTTATACACCCGTATTTGG - Intronic
1119538020 14:75418994-75419016 CTGAAATATACTCTCGTACACGG + Intergenic
1131344210 15:91631094-91631116 CTGACAGATATTCCCAGACTGGG - Intergenic
1133815438 16:9194023-9194045 CTGACATATACACAGGTTCTGGG + Intergenic
1141535106 16:84673688-84673710 CTGACTTATAGCCCCGTGCTTGG - Intergenic
1146935762 17:36811719-36811741 CTGACATTTTCTCCCACACTAGG - Intergenic
1149004345 17:51789647-51789669 CTAACATATCCTCCCTTCCTTGG + Intronic
928919221 2:36509024-36509046 CTGACAAATACCCCTGTATTTGG - Intronic
930424178 2:51192839-51192861 CTGAAATATATTTTCGTACTTGG + Intergenic
934983579 2:98868365-98868387 CTGACAGAGACTGCCCTACTGGG + Intronic
935159840 2:100520522-100520544 ATGAAATATTCTCCCATACTAGG - Intergenic
936725726 2:115312822-115312844 CTGACATAGATTCCTCTACTTGG - Intronic
946808687 2:223498843-223498865 CTGGCATACCCTCCTGTACTGGG - Intergenic
1171181667 20:23095328-23095350 CTGCCATATTGTCCCGCACTGGG - Intergenic
953370251 3:42381496-42381518 CTGACATATGATCCTGAACTCGG + Intergenic
955691534 3:61595464-61595486 CTGACATCTAGTCCCTTTCTTGG - Intronic
965092104 3:164177787-164177809 TAGACATACACTCCAGTACTGGG + Intergenic
970922985 4:21416785-21416807 CTGACATATAGTCCCATGATAGG - Intronic
1007537632 6:42608078-42608100 GTGACAAATACTCCCGTTATGGG + Intronic
1020068332 7:5207487-5207509 CTGTCATATATTCACATACTGGG - Intronic
1021743982 7:23719721-23719743 CTGAAATATCCTCACTTACTTGG + Intronic
1030050575 7:105533398-105533420 CTGACATATACTCCCGTACTAGG - Intronic
1038984815 8:32797023-32797045 CTGACACATACTCCCACAGTAGG - Intergenic
1058580414 9:106450297-106450319 TTGACATATAGTCCCATAATTGG - Intergenic
1190832586 X:54072724-54072746 CTGACAGCTACTGCCTTACTAGG + Exonic
1199432216 X:147774380-147774402 CTGACATAAACTCCAGAACTTGG - Intergenic