ID: 1030050575

View in Genome Browser
Species Human (GRCh38)
Location 7:105533398-105533420
Sequence CTGACATATACTCCCGTACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 33}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030050575_1030050579 9 Left 1030050575 7:105533398-105533420 CCTAGTACGGGAGTATATGTCAG 0: 1
1: 0
2: 1
3: 3
4: 33
Right 1030050579 7:105533430-105533452 CTTTTGCCATTTTACTTTGATGG No data
1030050575_1030050580 13 Left 1030050575 7:105533398-105533420 CCTAGTACGGGAGTATATGTCAG 0: 1
1: 0
2: 1
3: 3
4: 33
Right 1030050580 7:105533434-105533456 TGCCATTTTACTTTGATGGCAGG 0: 1
1: 1
2: 0
3: 11
4: 160
1030050575_1030050583 30 Left 1030050575 7:105533398-105533420 CCTAGTACGGGAGTATATGTCAG 0: 1
1: 0
2: 1
3: 3
4: 33
Right 1030050583 7:105533451-105533473 GGCAGGTTATTGCAAATCAAGGG No data
1030050575_1030050582 29 Left 1030050575 7:105533398-105533420 CCTAGTACGGGAGTATATGTCAG 0: 1
1: 0
2: 1
3: 3
4: 33
Right 1030050582 7:105533450-105533472 TGGCAGGTTATTGCAAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030050575 Original CRISPR CTGACATATACTCCCGTACT AGG (reversed) Intronic