ID: 1030050576 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:105533399-105533421 |
| Sequence | CTAGTACGGGAGTATATGTC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 19 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 0, 4: 18} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1030050569_1030050576 | -9 | Left | 1030050569 | 7:105533385-105533407 | CCACCATTTCCTCCCTAGTACGG | No data | ||
| Right | 1030050576 | 7:105533399-105533421 | CTAGTACGGGAGTATATGTCAGG | 0: 1 1: 0 2: 0 3: 0 4: 18 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1030050576 | Original CRISPR | CTAGTACGGGAGTATATGTC AGG | Intronic | ||