ID: 1030050579

View in Genome Browser
Species Human (GRCh38)
Location 7:105533430-105533452
Sequence CTTTTGCCATTTTACTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030050575_1030050579 9 Left 1030050575 7:105533398-105533420 CCTAGTACGGGAGTATATGTCAG 0: 1
1: 0
2: 1
3: 3
4: 33
Right 1030050579 7:105533430-105533452 CTTTTGCCATTTTACTTTGATGG No data
1030050573_1030050579 13 Left 1030050573 7:105533394-105533416 CCTCCCTAGTACGGGAGTATATG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1030050579 7:105533430-105533452 CTTTTGCCATTTTACTTTGATGG No data
1030050572_1030050579 19 Left 1030050572 7:105533388-105533410 CCATTTCCTCCCTAGTACGGGAG No data
Right 1030050579 7:105533430-105533452 CTTTTGCCATTTTACTTTGATGG No data
1030050569_1030050579 22 Left 1030050569 7:105533385-105533407 CCACCATTTCCTCCCTAGTACGG No data
Right 1030050579 7:105533430-105533452 CTTTTGCCATTTTACTTTGATGG No data
1030050574_1030050579 10 Left 1030050574 7:105533397-105533419 CCCTAGTACGGGAGTATATGTCA No data
Right 1030050579 7:105533430-105533452 CTTTTGCCATTTTACTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030050579 Original CRISPR CTTTTGCCATTTTACTTTGA TGG Intronic