ID: 1030050580

View in Genome Browser
Species Human (GRCh38)
Location 7:105533434-105533456
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 160}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030050573_1030050580 17 Left 1030050573 7:105533394-105533416 CCTCCCTAGTACGGGAGTATATG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1030050580 7:105533434-105533456 TGCCATTTTACTTTGATGGCAGG 0: 1
1: 1
2: 0
3: 11
4: 160
1030050572_1030050580 23 Left 1030050572 7:105533388-105533410 CCATTTCCTCCCTAGTACGGGAG No data
Right 1030050580 7:105533434-105533456 TGCCATTTTACTTTGATGGCAGG 0: 1
1: 1
2: 0
3: 11
4: 160
1030050575_1030050580 13 Left 1030050575 7:105533398-105533420 CCTAGTACGGGAGTATATGTCAG 0: 1
1: 0
2: 1
3: 3
4: 33
Right 1030050580 7:105533434-105533456 TGCCATTTTACTTTGATGGCAGG 0: 1
1: 1
2: 0
3: 11
4: 160
1030050574_1030050580 14 Left 1030050574 7:105533397-105533419 CCCTAGTACGGGAGTATATGTCA No data
Right 1030050580 7:105533434-105533456 TGCCATTTTACTTTGATGGCAGG 0: 1
1: 1
2: 0
3: 11
4: 160
1030050569_1030050580 26 Left 1030050569 7:105533385-105533407 CCACCATTTCCTCCCTAGTACGG No data
Right 1030050580 7:105533434-105533456 TGCCATTTTACTTTGATGGCAGG 0: 1
1: 1
2: 0
3: 11
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type