ID: 1030050581

View in Genome Browser
Species Human (GRCh38)
Location 7:105533436-105533458
Sequence AACCTGCCATCAAAGTAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 767
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 742}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030050581_1030050588 26 Left 1030050581 7:105533436-105533458 CCATTTTACTTTGATGGCAGGTT 0: 1
1: 0
2: 0
3: 24
4: 742
Right 1030050588 7:105533485-105533507 CCTTTGAAGTGACATTTTTTGGG 0: 1
1: 0
2: 0
3: 21
4: 306
1030050581_1030050582 -9 Left 1030050581 7:105533436-105533458 CCATTTTACTTTGATGGCAGGTT 0: 1
1: 0
2: 0
3: 24
4: 742
Right 1030050582 7:105533450-105533472 TGGCAGGTTATTGCAAATCAAGG No data
1030050581_1030050585 2 Left 1030050581 7:105533436-105533458 CCATTTTACTTTGATGGCAGGTT 0: 1
1: 0
2: 0
3: 24
4: 742
Right 1030050585 7:105533461-105533483 TGCAAATCAAGGGCTCTTTAGGG 0: 1
1: 0
2: 0
3: 16
4: 129
1030050581_1030050586 25 Left 1030050581 7:105533436-105533458 CCATTTTACTTTGATGGCAGGTT 0: 1
1: 0
2: 0
3: 24
4: 742
Right 1030050586 7:105533484-105533506 ACCTTTGAAGTGACATTTTTTGG No data
1030050581_1030050583 -8 Left 1030050581 7:105533436-105533458 CCATTTTACTTTGATGGCAGGTT 0: 1
1: 0
2: 0
3: 24
4: 742
Right 1030050583 7:105533451-105533473 GGCAGGTTATTGCAAATCAAGGG No data
1030050581_1030050584 1 Left 1030050581 7:105533436-105533458 CCATTTTACTTTGATGGCAGGTT 0: 1
1: 0
2: 0
3: 24
4: 742
Right 1030050584 7:105533460-105533482 TTGCAAATCAAGGGCTCTTTAGG 0: 1
1: 0
2: 1
3: 15
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030050581 Original CRISPR AACCTGCCATCAAAGTAAAA TGG (reversed) Intronic