ID: 1030050581

View in Genome Browser
Species Human (GRCh38)
Location 7:105533436-105533458
Sequence AACCTGCCATCAAAGTAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 767
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 742}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030050581_1030050582 -9 Left 1030050581 7:105533436-105533458 CCATTTTACTTTGATGGCAGGTT 0: 1
1: 0
2: 0
3: 24
4: 742
Right 1030050582 7:105533450-105533472 TGGCAGGTTATTGCAAATCAAGG No data
1030050581_1030050586 25 Left 1030050581 7:105533436-105533458 CCATTTTACTTTGATGGCAGGTT 0: 1
1: 0
2: 0
3: 24
4: 742
Right 1030050586 7:105533484-105533506 ACCTTTGAAGTGACATTTTTTGG No data
1030050581_1030050584 1 Left 1030050581 7:105533436-105533458 CCATTTTACTTTGATGGCAGGTT 0: 1
1: 0
2: 0
3: 24
4: 742
Right 1030050584 7:105533460-105533482 TTGCAAATCAAGGGCTCTTTAGG 0: 1
1: 0
2: 1
3: 15
4: 150
1030050581_1030050588 26 Left 1030050581 7:105533436-105533458 CCATTTTACTTTGATGGCAGGTT 0: 1
1: 0
2: 0
3: 24
4: 742
Right 1030050588 7:105533485-105533507 CCTTTGAAGTGACATTTTTTGGG 0: 1
1: 0
2: 0
3: 21
4: 306
1030050581_1030050585 2 Left 1030050581 7:105533436-105533458 CCATTTTACTTTGATGGCAGGTT 0: 1
1: 0
2: 0
3: 24
4: 742
Right 1030050585 7:105533461-105533483 TGCAAATCAAGGGCTCTTTAGGG 0: 1
1: 0
2: 0
3: 16
4: 129
1030050581_1030050583 -8 Left 1030050581 7:105533436-105533458 CCATTTTACTTTGATGGCAGGTT 0: 1
1: 0
2: 0
3: 24
4: 742
Right 1030050583 7:105533451-105533473 GGCAGGTTATTGCAAATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030050581 Original CRISPR AACCTGCCATCAAAGTAAAA TGG (reversed) Intronic
901474744 1:9481745-9481767 AACCTGCCCCCAAAGTCCAAGGG + Intergenic
902849094 1:19139353-19139375 ATCCTGTCGTCAAAGAAAAAAGG + Intronic
903521678 1:23955443-23955465 AACCTGCCAGAAGAGTGAAATGG - Intergenic
903902213 1:26655875-26655897 ACACTGTCAACAAAGTAAAAAGG + Intergenic
905332183 1:37212591-37212613 AAACTACCATCAAAGTGAACAGG + Intergenic
906605868 1:47171094-47171116 AAACTACCATCAGAGTGAAAAGG + Intergenic
906752904 1:48282373-48282395 AAACTACCATCAGAGTAAACAGG + Intergenic
906768592 1:48461290-48461312 AAACTACCATCAGAGTAAACAGG - Intronic
906908411 1:49920278-49920300 AAACTACCATCAGAGTAAACAGG + Intronic
907005171 1:50905830-50905852 AAACTGCCATCAGAGTGAACAGG - Intronic
908417328 1:63925966-63925988 AAACTGCCATCAGAGTGAACAGG - Intronic
910274121 1:85429957-85429979 AAACTACCATCAAAGTGAACAGG - Intronic
910628173 1:89330625-89330647 AAACTGCCATCAGAGTGAAAAGG + Intergenic
910805267 1:91183642-91183664 AACCTACCATCAGAGTGAACAGG - Intergenic
911021135 1:93388969-93388991 AAGCTGCCATCAGAGTGAATGGG - Intergenic
911384343 1:97156305-97156327 AAACTACCATCAGAGTAAACAGG + Intronic
911384939 1:97163170-97163192 AAACTACCATCAGAGTAAACAGG + Intronic
911891243 1:103375021-103375043 AAACTGCAATCAAAGTGAAAGGG + Intergenic
911946391 1:104114716-104114738 AAACTACCATCAACGTAAACAGG + Intergenic
911966260 1:104375718-104375740 AAACTACCATCACAGTGAAAAGG + Intergenic
911991150 1:104698314-104698336 AAACTACCATCAGAGTAAACAGG + Intergenic
912224610 1:107719246-107719268 AAACTGCCATCAGAGTGAACAGG + Intronic
912226236 1:107737394-107737416 AAACTGCCATCAGAGTGAACAGG + Intronic
913108185 1:115634425-115634447 AAACTACCATCAGAGTGAAAAGG - Intergenic
913421910 1:118679406-118679428 AAACTACCATCAGAGTGAAAAGG - Intergenic
913647406 1:120871812-120871834 AAACTGCCATCAGAGTGAACAGG - Intergenic
913710890 1:121482302-121482324 AAACTGCCATCAGAGTGAACAGG + Intergenic
913940586 1:125100722-125100744 AAACTACCATCAGAGTGAAAAGG - Intergenic
914389414 1:147205955-147205977 AAACTACCATCAAAGTGAACAGG + Intronic
915711822 1:157907018-157907040 AAACTGCCATCAGAGTGAACAGG + Intergenic
915765883 1:158361932-158361954 AAACTACCATCAAAGTGAACAGG - Intergenic
916638216 1:166696996-166697018 AAACTACCATCAAAGTGAACAGG + Intergenic
916697485 1:167253784-167253806 AACCTGGCACCAAATTAAAATGG - Intronic
916846913 1:168660516-168660538 AAACTACCATCAGAGTAAACAGG - Intergenic
916994569 1:170282724-170282746 AAACTACCATCAAAGTGAACAGG + Intergenic
917316466 1:173730909-173730931 AAACTACCATCAGAGTAAACAGG + Intronic
918324944 1:183401103-183401125 AAACTGCCATCAGAGTTAACAGG + Intronic
919164584 1:193876043-193876065 AAGCTGCCATCAGAGTGAACAGG + Intergenic
919321513 1:196046822-196046844 AAACTGCCATCAGAGTGAACAGG + Intergenic
921287991 1:213626378-213626400 AAACTACCATCAAAGTGAACAGG - Intergenic
921717051 1:218428286-218428308 AAACTACCATCAAAGTGAACAGG - Intronic
921910010 1:220538029-220538051 AAACTACCATCAGAGTAAACAGG - Intronic
922091164 1:222396546-222396568 AAACTACCATCAGAGTAAACAGG + Intergenic
922376757 1:224976526-224976548 AAACTACCATCAAAGTGAACAGG + Intronic
922551874 1:226500200-226500222 AAACTGCCATCAGAGTGAACCGG - Intergenic
923224723 1:231928631-231928653 ACCCTAACATCAAAATAAAAAGG - Intronic
923780640 1:237020418-237020440 AAACTACCATCAGAGTAAACAGG - Intergenic
924311612 1:242749517-242749539 AAACTACCATCAAAGTGAACAGG - Intergenic
924487514 1:244500296-244500318 AAACTACCATCAGAGTGAAAAGG - Intronic
924500385 1:244632453-244632475 AACATGTAATAAAAGTAAAATGG + Intronic
1062781086 10:208331-208353 AAACTGCCATCAGAGTGAACAGG + Intronic
1063785063 10:9372815-9372837 AAACTACCATCAGAGTAAACAGG + Intergenic
1064008355 10:11715428-11715450 ACCCTGCCATCTCTGTAAAAAGG + Intergenic
1064641737 10:17421908-17421930 ACGCAGCCATCAAAGTATAAAGG + Intronic
1064919089 10:20496582-20496604 AAACTGCCATCAGAGTGAACAGG - Intergenic
1065080080 10:22120397-22120419 AAACTGTCATCAGAGTAAACAGG - Intergenic
1065526929 10:26632180-26632202 AAACTGCCATCAGAGTGAACAGG + Intergenic
1066132743 10:32409892-32409914 TACCTGCCTCCAAAGTACAATGG - Intergenic
1066176936 10:32917381-32917403 AAACTGCCATCAGAGTGAACAGG + Intronic
1066483118 10:35816659-35816681 AACCTACCATCAGAGTGAACAGG + Intergenic
1066806807 10:39264458-39264480 AAACTACCATCAAAGTGAACAGG + Intergenic
1067193816 10:44096094-44096116 AAACTGCTATCAGAGTAAACAGG + Intergenic
1067357186 10:45540607-45540629 AAACTACCATCAAAGTGAACAGG + Intronic
1067491941 10:46716452-46716474 CACCTGACTTAAAAGTAAAAAGG - Intergenic
1067602717 10:47623931-47623953 CACCTGACTTAAAAGTAAAAAGG + Intergenic
1068228092 10:54133156-54133178 AAACTACCACCAAAGTATAATGG + Intronic
1068413644 10:56688995-56689017 AAACTACCATCAGAGTAAACAGG + Intergenic
1068516545 10:58032222-58032244 AAACTGTCATCAGAGTGAAAAGG - Intergenic
1068525983 10:58130244-58130266 AAACTGTCATCAGAGTAAATAGG + Intergenic
1068932259 10:62603709-62603731 AAACTGCCATCAGAGTGAACAGG - Intronic
1069050671 10:63789208-63789230 AAACTGCCATCAGAGTGAACAGG + Intergenic
1069643462 10:69972645-69972667 AACATGCTTTGAAAGTAAAAAGG + Intergenic
1069905293 10:71728672-71728694 AACTTGCCAGCAAAGTAGAGAGG - Intronic
1071099435 10:82017891-82017913 AAACTGCCATCAGAGTGAACAGG - Intronic
1071258730 10:83899261-83899283 AAACTGCCATCAGAGTGAACGGG - Intergenic
1071654076 10:87429346-87429368 CACCTGACTTAAAAGTAAAAAGG + Intergenic
1071663149 10:87526497-87526519 AACCTACCATCAGAGTGAACAGG - Intronic
1071900331 10:90114027-90114049 AAACTACCATCAGAGTGAAAAGG - Intergenic
1071922455 10:90366755-90366777 AAACTGCCATCAGAGTGAACAGG - Intergenic
1072561005 10:96574112-96574134 AAACTACCATCAAAGTGAACAGG + Intronic
1073694703 10:105851676-105851698 AAACTACCATCAGAGTGAAAAGG + Intergenic
1075156974 10:119986057-119986079 AAACTACCATCAAAGTGAACAGG - Intergenic
1075832498 10:125423453-125423475 AAACTGCCGTCAAACTTAAAGGG + Intergenic
1076041388 10:127252338-127252360 AAACTACCATCAGAGTGAAAAGG - Intronic
1077814884 11:5677142-5677164 AAACTACCATCAAAGTGAACAGG + Intronic
1078032809 11:7770391-7770413 AAACTACCATCAGAGTAAACAGG + Intergenic
1078419293 11:11195426-11195448 AAACTACCATCAGAGTAAACAGG - Intergenic
1078484832 11:11712243-11712265 AAACTACCATCAGAGTAAACAGG - Intergenic
1078523153 11:12079700-12079722 AAACTACCATCAAGGTGAAAAGG + Intergenic
1078713879 11:13820962-13820984 AAACTACCATCAGAGTAAACAGG - Intergenic
1079275526 11:19032620-19032642 AAACTACCATCAGAGTAAACAGG - Intergenic
1079346209 11:19654930-19654952 AAACTGCCATCAGAGTGAACAGG + Intronic
1079683413 11:23326149-23326171 AAACTGCCATCAGAGTGAACAGG + Intergenic
1079804846 11:24917285-24917307 AAACTACCATCAAAGTGAACAGG - Intronic
1079821232 11:25132259-25132281 AAGATACCAACAAAGTAAAAAGG - Intergenic
1080179045 11:29400755-29400777 AAACTACCATCAGAGTGAAAAGG + Intergenic
1080200480 11:29663743-29663765 AAACTACCATCAGAGTGAAAAGG + Intergenic
1080365130 11:31565325-31565347 AAACTGCCATCAGAGTGAACAGG - Intronic
1080366384 11:31578978-31579000 AAACTGCCATCAGAGTGAACAGG + Intronic
1081453226 11:43193668-43193690 AAACTACCATCAGAGTGAAAAGG + Intergenic
1081553640 11:44137451-44137473 AAACTGGCATCACAGTAAAACGG - Intronic
1081768724 11:45632762-45632784 AAACTGCCATCAGAGTGAACAGG + Intergenic
1082317143 11:50743944-50743966 AAACTACCATCAGAGTAAACAGG - Intergenic
1082723737 11:56710359-56710381 AAACTACCATCAGAGTGAAAAGG - Intergenic
1082865232 11:57894152-57894174 AACCTTGTCTCAAAGTAAAAAGG - Intergenic
1085884895 11:80510277-80510299 AAACTACCATCAGAGTGAAAAGG + Intergenic
1086523575 11:87699052-87699074 AACCTACCATCAGAGTGAACAGG - Intergenic
1086586506 11:88458804-88458826 AAACTACCATCAAAGTGAACAGG - Intergenic
1086602245 11:88647692-88647714 AAACTACCATCAAAGTGAACAGG + Intronic
1086779750 11:90888208-90888230 CACCTGAAATCCAAGTAAAAAGG - Intergenic
1086919209 11:92567076-92567098 AAACTGCCATCAGAGTGAACAGG + Intronic
1087498404 11:98919249-98919271 AAACTACCATCAGAGTAAACAGG + Intergenic
1087710468 11:101543922-101543944 AAACTGTCATCAAAGTGAACAGG + Intronic
1088004193 11:104921143-104921165 AAACTACCATCAGAGTAAACAGG - Intergenic
1088118095 11:106335407-106335429 AAACTGCCATCAGAGTGAACAGG - Intergenic
1088122664 11:106388300-106388322 AAACTGCCATCAGAGTGAACAGG - Intergenic
1088163702 11:106906132-106906154 AAACTGTCATCAGAGTAAACAGG + Intronic
1090933175 11:131317704-131317726 AAGCTGCCATCAGAGTGAACAGG + Intergenic
1091298948 11:134493233-134493255 AAACTACCATCAGAGTAAAGAGG - Intergenic
1092031085 12:5285894-5285916 AAACTACCATCAGAGTAAACAGG - Intergenic
1092778980 12:11967880-11967902 ACTCTGCCAGCAAAGGAAAAAGG + Intergenic
1093009517 12:14090963-14090985 AAACTGCCATCAGAGTGAACAGG - Intergenic
1093330115 12:17825811-17825833 AAACTGCCATCAGAGTGAACAGG + Intergenic
1093522968 12:20071945-20071967 AAGCTGCCATCAGAGTGAACAGG + Intergenic
1093673424 12:21904467-21904489 AAACTACCATCAAAGCAAACAGG + Intronic
1094356671 12:29585392-29585414 AAACTACCATCAGAGTAAACAGG - Intronic
1094442587 12:30495092-30495114 AATCTCCCATTAAAGTGAAATGG - Intergenic
1094791066 12:33915863-33915885 AAACTACCATCAGAGTGAAAGGG - Intergenic
1095032973 12:37318828-37318850 AAACTACCATCAGAGTAAACAGG - Intergenic
1095067191 12:37792099-37792121 AAACTGCCATCAGAGTGAACAGG + Intergenic
1095152139 12:38807791-38807813 AAACTGCCATCAGAGTGAACAGG + Intronic
1095371473 12:41472636-41472658 AACATGCAATCATGGTAAAAAGG - Intronic
1095565977 12:43623403-43623425 AAACTGCCATCAGAGTGAACAGG - Intergenic
1095803053 12:46288684-46288706 AAACTGCCATCAGAGTGAACAGG + Intergenic
1095863063 12:46940425-46940447 AAACTGCCATCAGAGTAAACAGG + Intergenic
1095869463 12:47010339-47010361 AAACTACCATCAAAGTGAATAGG + Intergenic
1096957459 12:55541079-55541101 AAACTGCCATCAGAGTGAACAGG - Intergenic
1097150317 12:56973478-56973500 AAACTACCATCAGAGTAAACAGG + Intergenic
1097404617 12:59175193-59175215 AAGATGCCATCATTGTAAAATGG + Intergenic
1098151285 12:67549660-67549682 AACCTGCTATAAAAATATAATGG - Intergenic
1098410972 12:70183301-70183323 AAACTACCATCAAAGTGAACAGG - Intergenic
1098415932 12:70235346-70235368 AAACTACCATCAGAGTGAAAAGG - Intergenic
1098668410 12:73194583-73194605 AAACTACCATCAGAGTAAACAGG - Intergenic
1098785459 12:74748570-74748592 AAACTACCATCAAAGTGAACAGG - Intergenic
1099060651 12:77903683-77903705 AAACTACCATCAGAGTGAAAAGG + Intronic
1099306585 12:80964266-80964288 AACCTGCTAGAAAAGTCAAATGG + Intronic
1099431371 12:82590359-82590381 AAACTATCATCAAAGTAAACAGG + Intergenic
1099492528 12:83304913-83304935 AAACTGTCATCAGAGTAAACAGG + Intergenic
1099817237 12:87665744-87665766 AAACTACCATCAGAGTGAAAAGG + Intergenic
1101174781 12:102138457-102138479 AAACTACCATCAGAGTAAACAGG - Intronic
1101714215 12:107296293-107296315 AACATGGAATCAAAGTGAAAAGG - Intergenic
1103154208 12:118669524-118669546 AAACTGCCATCAGAGTGAACAGG - Intergenic
1104370395 12:128219071-128219093 ACCCTCCCGTCAAAGTAAAGAGG - Intergenic
1104480612 12:129104581-129104603 AAACTACCATCAGAGTAAACAGG + Intronic
1105986438 13:25571997-25572019 AACCTGCCCTCAAAGACAAGTGG - Intronic
1106219343 13:27732684-27732706 AAACTACCATCAGAGTGAAAAGG - Intergenic
1106244481 13:27936771-27936793 AAACTACCATCAGAGTGAAAAGG + Intergenic
1106552249 13:30782241-30782263 AAACTACCATCAGAGTGAAAAGG - Intergenic
1106989709 13:35403794-35403816 AAACTACCATCAGAGTGAAAAGG + Intronic
1108798850 13:54067707-54067729 AACATGTGATCAAAGTGAAAAGG - Intergenic
1108806639 13:54164856-54164878 AACTTCCCCTCAAAATAAAATGG - Intergenic
1109643442 13:65221782-65221804 AAACTACCATCAAAGTGAACAGG + Intergenic
1109919051 13:69031667-69031689 AAACTACCATCAGAGTAAACAGG + Intergenic
1109972533 13:69787699-69787721 AAACTACCATCAGAGTGAAAAGG + Intronic
1109981650 13:69915782-69915804 AAACTACCATCAGAGTGAAAAGG + Intronic
1109998734 13:70166708-70166730 AAACTACCATCAGAGTGAAAAGG + Intergenic
1110419478 13:75289108-75289130 AACCTGCCATGAAAGTATCATGG + Exonic
1110464197 13:75782079-75782101 AAACTACCATCAGAGTAAACAGG - Intronic
1110504411 13:76268794-76268816 AAACTGCCATCAGAGTGAACAGG - Intergenic
1110652986 13:77963809-77963831 AAACTACCATCAGAGTAAACAGG + Intergenic
1111228052 13:85302368-85302390 AAACTACCATCAGAGTAAACAGG + Intergenic
1111279370 13:85999039-85999061 AAACTGCCATCAGAGTGAACAGG - Intergenic
1111646531 13:91038609-91038631 AAACTGCCATCAGAGTGAACAGG + Intergenic
1111704580 13:91732474-91732496 AAACTATCATCAAAGTGAAAAGG - Intronic
1111747250 13:92285931-92285953 AACCTACCATCAGAGTGAACAGG + Intronic
1111919049 13:94391545-94391567 AACTTTCCATCCAAGAAAAATGG + Intronic
1112503699 13:99960755-99960777 AACTTGGCATGAAAGTAAAAAGG + Intergenic
1112600327 13:100848826-100848848 AGCTTGCCATCAAATGAAAATGG - Intergenic
1112745944 13:102527205-102527227 AAACTACCATCAGAGTGAAAAGG + Intergenic
1115624412 14:35175692-35175714 AACCTACCATCAGAGTGAACAGG - Intronic
1115940705 14:38606066-38606088 ATTCTGCAAGCAAAGTAAAAGGG + Intergenic
1115990942 14:39149127-39149149 ACCCTTCCATGAAAGGAAAATGG + Exonic
1116156264 14:41210290-41210312 AAACTACCATCAAAGTGAACAGG - Intergenic
1116162832 14:41291161-41291183 AAACTGCCATCAGAGTGAACAGG - Intergenic
1116235492 14:42274162-42274184 AAGCTGGCATCATAGCAAAAGGG - Intergenic
1116494660 14:45546679-45546701 AAACTACCATCAAAGTGAACAGG - Intergenic
1116524095 14:45884179-45884201 AAACTACCATCAGAGTAAACAGG - Intergenic
1117217765 14:53569278-53569300 ATCCTGACAGCAAAGCAAAATGG - Intergenic
1117505311 14:56396611-56396633 AAACTACCATCAGAGTAAACAGG + Intergenic
1117851259 14:59972267-59972289 AACCTGCAAACTAGGTAAAAGGG - Intronic
1119353460 14:73985693-73985715 AAACTACCATCAGAGTAAACAGG - Intronic
1119417021 14:74478034-74478056 ACCCTTCCATCAGAGCAAAAGGG - Intronic
1120478462 14:85019343-85019365 AAACTACCATCAAAGTGAACAGG - Intergenic
1123127335 14:105957069-105957091 AAACTACCATCAGAGTAAACAGG - Intergenic
1123407803 15:20032883-20032905 AAACTACCATCAGAGTAAACAGG - Intergenic
1123517129 15:21039537-21039559 AAACTACCATCAGAGTAAACAGG - Intergenic
1124094713 15:26638335-26638357 AGCCAGCCAGTAAAGTAAAAAGG - Intronic
1126026776 15:44454378-44454400 AAACTACCATCAGAGTAAACAGG - Intronic
1126235314 15:46376959-46376981 AAACTACCATCAAAGTGAACAGG - Intergenic
1127194180 15:56566606-56566628 AAACTGCCATCAGAGTGAACAGG + Intergenic
1127538289 15:59912017-59912039 AAACTGCCATCAGAGTGAACAGG + Intergenic
1128182512 15:65616677-65616699 AAACTACCATCAGAGTGAAAAGG - Intronic
1129012097 15:72429313-72429335 AAACTGCCATCAGAGTGAACAGG - Intergenic
1129548333 15:76421573-76421595 AAACTACCATCAGAGTAAACAGG - Intronic
1129571358 15:76688387-76688409 AAACTACCATCAGAGTAAACAGG - Intronic
1129573114 15:76711889-76711911 AAACTGCCATCAGAGTGAACAGG - Intronic
1130858828 15:87867409-87867431 AAACTGCCATAAAACAAAAATGG + Intronic
1130873682 15:87993532-87993554 ATGCTTCCATCAAATTAAAAAGG - Intronic
1131298854 15:91176843-91176865 AAACTACCATCAGAGTGAAAAGG - Intronic
1131402635 15:92137926-92137948 AAACTACCATCAGAGTGAAAAGG - Intronic
1131788957 15:95943363-95943385 AACCTGACTTCAAGGAAAAATGG + Intergenic
1133484549 16:6206781-6206803 CACCCACCATTAAAGTAAAAGGG - Intronic
1135235991 16:20756586-20756608 AAACTACCATCAGAGTGAAAAGG - Intronic
1135238735 16:20783641-20783663 CACCTGCCATAAAATTCAAAAGG + Intronic
1137000562 16:35226377-35226399 AAACTACCATCAGAGTAAACAGG - Intergenic
1137514935 16:49135050-49135072 AAACTGCCATCAGAGTGAACAGG - Intergenic
1138078022 16:54062032-54062054 AACCTTCCTTCCAAGTAACATGG + Intronic
1138092516 16:54187801-54187823 TAACTGCCTTCAAAGAAAAATGG + Intergenic
1140610548 16:76593295-76593317 AAACAGCCAACAAAGCAAAATGG + Intronic
1140763414 16:78132659-78132681 AATCTGCCCACAAAATAAAATGG - Intronic
1142180836 16:88669000-88669022 ACTCTGCCTTCAAAGTCAAAGGG + Intergenic
1143422269 17:6803411-6803433 AAACTACCATCAGAGTAAACAGG - Intronic
1143430992 17:6884318-6884340 AAACTACCATCAGAGTAAACAGG - Intronic
1145125433 17:20295972-20295994 AAACTGCCATCAGAGTGAACAGG - Intronic
1146103647 17:30010757-30010779 AAACTACCATCAAAGTGAACAGG - Intronic
1146513177 17:33468245-33468267 AATCAGCCATCAAAGCACAATGG + Intronic
1147279552 17:39347642-39347664 AAACTGCCATCAGAGTAAACAGG - Intronic
1148927541 17:51100618-51100640 ACCCTGCCTTCAAAAAAAAATGG + Intronic
1148949245 17:51295151-51295173 AAACTACCATCAGAGTAAACAGG - Intronic
1150089044 17:62304626-62304648 ATACTGCCATGTAAGTAAAAGGG + Intergenic
1153593978 18:6704981-6705003 AAACTACCATCAGAGTGAAAAGG + Intergenic
1153815547 18:8786959-8786981 AACCAGCCATCAAAGGGAAGGGG - Intronic
1154125890 18:11691412-11691434 AAACTACCATCAGAGTAAACAGG - Intronic
1154520986 18:15230055-15230077 AAACTGCCATCAGAGTGAACAGG - Intergenic
1155121142 18:22820268-22820290 AAACTGCCATCAGAGTGAACAGG - Intronic
1155190688 18:23427207-23427229 AACCTACCATCAGAGTGAACAGG + Intronic
1155658748 18:28222922-28222944 AAACTACCATCAGAGTGAAAAGG - Intergenic
1155985771 18:32229029-32229051 AAACTGCCATCAAAGTGAACAGG - Intronic
1156296415 18:35795778-35795800 AAACTGCCATCAGAGTGAACAGG + Intergenic
1156380360 18:36553674-36553696 AAACTACCATCAGAGTAAACAGG + Intronic
1156922688 18:42542001-42542023 AAACTACCATCAGAGTAAACAGG - Intergenic
1157919666 18:51701557-51701579 AAACTACCATCAGAGTGAAAAGG - Intergenic
1158040525 18:53087554-53087576 AAACTACCATCAGAGTAAACAGG - Intronic
1158099107 18:53809359-53809381 AAACTGTCATCAGAGTAAACAGG + Intergenic
1159102753 18:63973443-63973465 AAACTACCATCAGAGTAAACAGG - Intronic
1159129692 18:64267009-64267031 AAACTACCATCAAAGTGAACAGG - Intergenic
1159191844 18:65055431-65055453 AAACTACCATCAAAGTGAATAGG + Intergenic
1159773193 18:72573329-72573351 AATCTGACATCCAATTAAAAGGG + Intronic
1160543221 18:79637059-79637081 AAACTGCCATCAGAGTGAACAGG + Intergenic
1162123873 19:8488914-8488936 ATCCAGCCAACAAATTAAAATGG - Exonic
1162254802 19:9481461-9481483 AAACTGCCATCAGAGTGAACAGG + Intronic
1162632126 19:11936640-11936662 AAACTACCATCAAAGTGAACAGG - Intronic
1164195554 19:22954702-22954724 AAACTGTCATCAGAGTGAAAAGG + Intergenic
1165677037 19:37735212-37735234 ATCCTGCCTTCAAAAAAAAAAGG + Intergenic
1166573991 19:43819669-43819691 TACCTCCCCTCAAACTAAAAAGG - Intronic
1167011540 19:46811845-46811867 ATCCAGCCAACAAATTAAAATGG - Intergenic
1202653822 1_KI270707v1_random:30866-30888 AAACTGCCATCAGAGTGAACAGG + Intergenic
925220688 2:2137878-2137900 AAACTACCATCAGAGTAAACAGG + Intronic
926424272 2:12727095-12727117 AAACTCAAATCAAAGTAAAATGG - Intronic
927127521 2:20026134-20026156 AAACTACCATCAGAGTGAAAAGG + Intergenic
927610305 2:24532404-24532426 AAACTACCATCAGAGTAAACAGG - Intronic
928426574 2:31183375-31183397 AAACTGCCATCAGAGTGAACAGG + Intronic
929338453 2:40782138-40782160 AAACTGCCATCAGAGTGAACAGG + Intergenic
929374936 2:41274339-41274361 AAACTGCCATCAGAGTGAACAGG + Intergenic
930239870 2:48925064-48925086 AAACTACCATCAAAGTGAACAGG + Intergenic
930275425 2:49305265-49305287 AAACTACCATCAGAGTGAAAAGG + Intergenic
930437512 2:51363957-51363979 AAACTACCATCAGAGTGAAAAGG + Intergenic
930441882 2:51419132-51419154 AAACTACGATCAGAGTAAAAAGG + Intergenic
930673229 2:54173494-54173516 AAACTACCATCAGAGTGAAAAGG - Intronic
931074856 2:58699276-58699298 CATCTGCCATGAAAGGAAAAGGG + Intergenic
931138466 2:59430994-59431016 AAACTGTCATCAGAGTAAACAGG - Intergenic
931215268 2:60236281-60236303 AAACTACCATCAGAGTGAAAAGG - Intergenic
931511170 2:62996870-62996892 AAACTGCCTTGAAAATAAAAAGG + Intronic
932111390 2:69004619-69004641 AAACTACCATCAAAGTGAACAGG + Intergenic
932966500 2:76481351-76481373 AAACTACCATCAGAGTAAACAGG - Intergenic
933202275 2:79464935-79464957 AAACTGCCATCAGAGTGAACAGG - Intronic
934116002 2:88794215-88794237 AAACTACCATCAGAGTAAACAGG + Intergenic
934836771 2:97596983-97597005 AAACTGCCATCAGAGTCAACAGG - Intergenic
936143108 2:109958136-109958158 AAAATGCCATCAGAGTGAAAAGG + Intergenic
936179796 2:110256102-110256124 AAAATGCCATCAGAGTGAAAAGG + Intergenic
936201580 2:110413331-110413353 AAAATGCCATCAGAGTGAAAAGG - Intronic
936224530 2:110635834-110635856 AAACTACCATCAGAGTAAACAGG + Intergenic
936858136 2:116984538-116984560 AAACTACCATCAGAGTGAAAAGG + Intergenic
936911637 2:117599921-117599943 AAACTACCATCAAAGTGAACAGG + Intergenic
937645385 2:124260556-124260578 AAACTGCCATCAGAGTGAATAGG + Intronic
938718959 2:134047930-134047952 AAACTGCCATCAGAGTGAACAGG + Intergenic
940054808 2:149502181-149502203 AAACTGCCATCAGAGTGAACAGG - Intergenic
940317964 2:152344752-152344774 AACCAGAGATCAAAGCAAAAGGG - Intronic
940456417 2:153907198-153907220 AAACTACCATCAGAGTGAAAAGG - Intronic
941473030 2:165913445-165913467 ATCCAGCCATCACAGTAAAAGGG - Intronic
943011469 2:182454945-182454967 AAACTACCATCAGAGTAAACAGG + Intronic
943095337 2:183421614-183421636 AAACTGCCATCACAGTGAACAGG + Intergenic
943255307 2:185586839-185586861 AAACTGCCATCAGAGTGAACAGG - Intergenic
943499590 2:188670381-188670403 AAACTACCATCAAAGTGAAAAGG + Intergenic
943500419 2:188681756-188681778 AAACTACCATCAAAGTGAAAAGG + Intergenic
943681524 2:190773203-190773225 AAACTGCCATCAGAGTGAACAGG - Intergenic
944267231 2:197741851-197741873 AAACTACCATCAGAGTGAAAAGG + Intronic
944269883 2:197770535-197770557 AAACTGCCATCAGAGTGAACAGG + Intronic
944308169 2:198201448-198201470 AAACTGCCATCAGAGTGAACAGG + Intronic
944438909 2:199722078-199722100 AAACTGTCATCAAAGTGAACAGG - Intergenic
944602639 2:201319550-201319572 AACCCGTCAACAAAGTAAACAGG + Intronic
944612737 2:201428120-201428142 AACCTACCATCAGAGTGAACAGG - Intronic
944740375 2:202606440-202606462 AACCTACCATCAGAGTGAACAGG - Intergenic
944970879 2:204992029-204992051 AAACTACCATCAGAGTAAACAGG - Intronic
945283310 2:208057980-208058002 AAACTACCATCAGAGTAAACAGG + Intergenic
945627844 2:212233729-212233751 AACCTGCTATAAAATTAAAAGGG - Intronic
945718636 2:213389442-213389464 AGACTGTCATCAGAGTAAAAAGG + Intronic
946661252 2:222002443-222002465 AAACTGCCATCAGAGTGAACAGG + Intergenic
948821340 2:240549553-240549575 AAACTACCATCAGAGTAAACAGG + Intronic
948976731 2:241468055-241468077 CACCTGCCATCAAGGAAAACAGG + Intronic
1168791479 20:579760-579782 AAACTACCATCAGAGTAAACAGG - Intergenic
1169671685 20:8109819-8109841 AACCTACCATCAGAGTGAACAGG - Intergenic
1169671687 20:8109843-8109865 AAACTGCCATCAGAGTGAACAGG - Intergenic
1170327648 20:15174957-15174979 AAACTACCATCAGAGTAAACAGG - Intronic
1170385443 20:15811126-15811148 AAACTGCCATCAGAGTGAACAGG + Intronic
1170457843 20:16550036-16550058 AAACTACCATCAGAGTAAACAGG + Intronic
1170660857 20:18338114-18338136 AAACTACCATCAGAGTAAACAGG + Intergenic
1170794768 20:19537065-19537087 AAACTGCCATCAGAGTGAACAGG + Intronic
1170950967 20:20935718-20935740 CACCTACCATAAAAGCAAAAGGG - Intergenic
1171054890 20:21896819-21896841 AACCCACCATGCAAGTAAAAAGG - Intergenic
1171408075 20:24926932-24926954 AAACTACCATCAGAGTGAAAAGG + Intergenic
1171505677 20:25631407-25631429 AAACTACCATCATAGTAAACAGG - Intergenic
1171738314 20:28826667-28826689 AAACTACCATCAAAGTGAACAGG - Intergenic
1171748672 20:29025839-29025861 AAACTACCATCAAAGTGAACAGG + Intergenic
1172866877 20:38106939-38106961 AAACTACCATCAGAGTAAACAGG + Intronic
1173068812 20:39741260-39741282 AAACTACCATCAGAGTAAACAGG - Intergenic
1175083821 20:56442991-56443013 AGTCAGCCATCAAAATAAAATGG + Intronic
1176209379 20:63910638-63910660 AACCTGCTCTCCAAGTAATAGGG + Intronic
1176598314 21:8768398-8768420 AAACTGCCATCAGAGTGAACAGG - Intergenic
1176744144 21:10636249-10636271 AAACTACCATCAGAGTAAACAGG + Intergenic
1176777216 21:13148820-13148842 AAACTGCCATCAGAGTGAACAGG + Intergenic
1176917932 21:14648458-14648480 AAACTACCATCAGAGTAAACAGG + Intronic
1177064331 21:16410940-16410962 AAACTACCATCAGAGTAAAGAGG - Intergenic
1177309964 21:19377201-19377223 AAACTGCCATCAGAGTGAACAGG + Intergenic
1177352303 21:19959630-19959652 AAACTACCATCAGAGTAAACAGG - Intergenic
1177361433 21:20077374-20077396 AAACTGCCATCAGAGTGAACAGG - Intergenic
1178616372 21:34136493-34136515 AAAGTGCCATAAAATTAAAAAGG - Intronic
1180076382 21:45465433-45465455 ATCTTGGCATCAAAGAAAAACGG - Intronic
1180420134 22:12806500-12806522 AAACTGCCATCAGAGTGAACAGG + Intergenic
1181353338 22:22277748-22277770 AAACTGCCATCAGAGTGAACAGG - Intergenic
1183515514 22:38263388-38263410 GAGCTGCCATCAGTGTAAAAGGG - Intronic
949239304 3:1850919-1850941 AACCTACCATCAGAGTGAATAGG - Intergenic
949406969 3:3724417-3724439 AAACTACCATCAGAGTAAACAGG + Intronic
949425742 3:3913977-3913999 AAACTACCATCAGAGTAAACAGG + Intronic
949434818 3:4017580-4017602 AAACTACCATCAGAGTAAACAGG + Intronic
949966971 3:9364887-9364909 AAACAGTCACCAAAGTAAAAAGG - Intronic
950209674 3:11113209-11113231 AAACTACCATCAGAGTGAAAAGG + Intergenic
950594621 3:13968460-13968482 AAACTACCATCAGAGTAAACAGG - Intronic
950862274 3:16159825-16159847 AAACTACCATCAAAGTGAACAGG - Intergenic
951127865 3:19005138-19005160 AAACTGTAATCAAAGTAAACGGG + Intergenic
951198665 3:19853668-19853690 AAACTACCATCAGAGTGAAAAGG + Intergenic
951391506 3:22109817-22109839 AAACTGCCATCAGAGTGAACAGG + Intronic
951471146 3:23057589-23057611 AAACTGCCATCAGAGTGAACAGG - Intergenic
952747882 3:36798890-36798912 AAACTGCCATCAGAGTGAACAGG - Intergenic
953071472 3:39525067-39525089 AAAATGACAACAAAGTAAAAGGG + Intronic
953112712 3:39958718-39958740 AAACTGCCATCAGAGTGAACAGG + Intronic
953208859 3:40856685-40856707 TACCTGCCCTCAAAACAAAATGG + Intergenic
953287122 3:41621802-41621824 AAACTACCATCAGAGTGAAAAGG + Intronic
953506244 3:43488358-43488380 AACCTACCATCAGAGTGAACAGG + Intronic
953642548 3:44722789-44722811 AACCTGCCAGCCAACGAAAATGG - Exonic
954513370 3:51148294-51148316 AAACTGCCATCAGAGTGAACAGG - Intronic
954836829 3:53477197-53477219 AAACTGTCATCAGAGTAAACAGG - Intergenic
955172161 3:56577374-56577396 AAACTACCATCAGAGTAAACAGG - Intronic
955361200 3:58276566-58276588 AAACTGCCATCAGAGTGAACAGG - Intronic
956222451 3:66918957-66918979 AAACTACCATCAGAGTGAAAAGG + Intergenic
957116214 3:76030318-76030340 AAACTGCCATCAGAGTGAACAGG - Intronic
957486135 3:80865755-80865777 AAACTACCATCAGAGTGAAAAGG - Intergenic
957534773 3:81487493-81487515 AAACTGCCATCAGAGTGAACAGG - Intergenic
957774208 3:84734997-84735019 AAACTACCATCAAAGTGAACAGG + Intergenic
958092119 3:88890254-88890276 AACATGCTAACAAAGGAAAATGG + Intergenic
958198731 3:90279568-90279590 AAACTGCCATCAGAGTCAACAGG - Intergenic
958569909 3:95865564-95865586 AAACTGCCATCAGAGTGAACAGG + Intergenic
958661820 3:97078346-97078368 AAACTACCATCAAAGTGAACAGG - Intronic
958751690 3:98199689-98199711 AACCTGCCATCAGAGTGAACAGG + Intergenic
958752556 3:98209880-98209902 AACCTACCATCAGAGTGAACAGG + Intergenic
959145341 3:102537800-102537822 AAACAGCCCTCAAAATAAAATGG - Intergenic
959804712 3:110537490-110537512 ATCCTGCCAACAAAAAAAAATGG + Intergenic
960768243 3:121162609-121162631 AAACTGCCATCAGAGTGAATAGG + Intronic
960770552 3:121189173-121189195 AAACTGCCATCACAGTGAATAGG - Intronic
960771086 3:121193011-121193033 AAACTGCCATCACAGTGAATAGG + Intronic
961064479 3:123862965-123862987 AACCTGTCATCCACGTAAGAAGG + Intronic
961311059 3:126001706-126001728 AAACTGGCATCAAAGTGAACAGG + Intergenic
961341169 3:126221087-126221109 AAACTACCATCAGAGTAAACAGG - Intergenic
961850074 3:129807747-129807769 AAACTACCATTAAAGTATAAAGG + Intronic
961979125 3:131057840-131057862 AAACTGCCATCAGAGTGAACAGG - Intronic
961982745 3:131098344-131098366 AAACTGCCATCAAAGTGAACAGG + Intronic
962361487 3:134746878-134746900 AAACTGCCATCAGAGTGAACAGG - Intronic
962818901 3:139027570-139027592 AAACTACCATCAAAGCAAACAGG - Intronic
963147616 3:142010628-142010650 AACCTACCATCAGAGTGAACAGG + Intronic
963159505 3:142136373-142136395 AAACTGCCATCAGAGTGAACAGG - Intronic
963210049 3:142679225-142679247 AAACTACCATCAGAGTGAAAAGG - Intronic
963340471 3:144026514-144026536 AAACTACCATCAAAGTGAACAGG + Intronic
963514241 3:146288851-146288873 AAACTACCATCAAAGTGAACAGG - Intergenic
963566912 3:146941624-146941646 AAACTACCATCAGAGTGAAAAGG - Intergenic
963691185 3:148504820-148504842 AAACTGTCATCAGAGTAAACAGG - Intergenic
963775145 3:149431436-149431458 AACCTGCTGTCAGTGTAAAATGG - Intergenic
963914008 3:150841208-150841230 CACCTGCCAGCAAAGTAATGTGG + Intergenic
963983972 3:151570686-151570708 AAACTGCCATCAGAGTGAACAGG - Intergenic
964416827 3:156456624-156456646 AGCCTGCCATCAAAACATAATGG + Intronic
964503831 3:157376964-157376986 AACCTGCCCCCAAAGCAGAAAGG - Intronic
964701947 3:159577702-159577724 TAGCTGCCTTCAAGGTAAAATGG - Intronic
964860013 3:161191265-161191287 AAACTACCATCAGAGTGAAAAGG - Intronic
965271868 3:166627691-166627713 AACCTACCATCAGAGTGAACAGG - Intergenic
965645750 3:170879510-170879532 AAACTACCATCAGAGTAAACAGG - Intergenic
965818468 3:172660924-172660946 AAACTACCATCAAAGTGAACAGG - Intronic
966698906 3:182823066-182823088 AAACTGCCATCAGAGTGAACAGG - Intronic
968380925 4:95135-95157 AACCTCCCAGCAAAGTGAGAAGG - Intergenic
968634339 4:1670155-1670177 CACCTGCCAGTAAAGTAAAAGGG + Intronic
969747551 4:9085712-9085734 AAACTACCATCAGAGTGAAAAGG + Intergenic
970983458 4:22128329-22128351 AAACTGCCATCAGAGTGAACAGG + Intergenic
971620852 4:28852453-28852475 AAACTACCATCAGAGTAAACAGG - Intergenic
971648146 4:29234827-29234849 AAACTGCCATCAGAGTGAAGAGG + Intergenic
972038082 4:34552366-34552388 AACCTAGCATTAAAGTTAAACGG - Intergenic
972173077 4:36370836-36370858 AACCTGCCAAAAATGTCAAAAGG + Intergenic
972208196 4:36803454-36803476 AAACTACCATCAGAGTAAACAGG - Intergenic
972317356 4:37939474-37939496 AAACTACCATCAGAGTAAACAGG - Intronic
972984289 4:44744942-44744964 AAACTACCATCAAAGTGAACAGG - Intergenic
972984902 4:44751379-44751401 AAACTGTCATCAGAGTAAACAGG - Intergenic
973361640 4:49170767-49170789 AAACTGCCATCAGAGTGAACAGG - Intergenic
973399449 4:49626093-49626115 AAACTGCCATCAGAGTGAACAGG + Intergenic
973625603 4:52769123-52769145 AAACTACCATCAGAGTGAAAAGG - Intergenic
973726347 4:53780723-53780745 AAAGTTCCATCAAAGCAAAAAGG - Intronic
973758322 4:54095923-54095945 AAGCTGCCAACAAAGCAAAATGG - Intronic
973929372 4:55774786-55774808 AACCAGACAGCAAATTAAAATGG + Intergenic
974181514 4:58389526-58389548 AAACTGCCATCAGAGTGAACAGG - Intergenic
974357512 4:60832226-60832248 AAACTGCCATCAGAGTGAACAGG - Intergenic
974418499 4:61642239-61642261 AAACTGCCATCAGAGTGAACAGG - Intronic
974670758 4:65026921-65026943 AAACTGCCATCAGAGTGAACAGG - Intergenic
974672706 4:65053114-65053136 AAACTACCATCAAAGTGAACAGG - Intergenic
974731855 4:65877328-65877350 AAACTGCCATCAAAGTGAACAGG + Intergenic
974983559 4:68991509-68991531 AAACTACCATCAGAGTAAACAGG - Intergenic
975049986 4:69851163-69851185 AAACTACCATCAGAGTGAAAAGG + Intronic
975304396 4:72832504-72832526 AAACTACCATCAGAGTGAAAAGG + Intergenic
975304730 4:72836452-72836474 AAACTACCATCAGAGTGAAAAGG - Intergenic
975398501 4:73905830-73905852 AAACTGCCATCAGAGTGAACAGG - Intergenic
975410994 4:74049701-74049723 AAACTGCCATCAGAGTGAATAGG + Intergenic
975501915 4:75095955-75095977 AAACTGTCATCAGAGTAAACAGG - Intergenic
975503631 4:75115075-75115097 AAACTACCATCAGAGTGAAAAGG + Intergenic
976083889 4:81387639-81387661 AAACTACCATCAGAGTAAACAGG + Intergenic
976466935 4:85380934-85380956 AAACTGCCATCAGAGTGAACAGG + Intergenic
976490260 4:85662469-85662491 AAACTACCATCAGAGTGAAAAGG - Intronic
977003977 4:91542180-91542202 AAACTGCCATCAGAGTGAACAGG - Intronic
977390986 4:96410148-96410170 AAACTGCCATCAGAGTGAACAGG - Intergenic
977456811 4:97271897-97271919 AAACTACCATCAGAGTGAAAAGG - Intronic
977640211 4:99349079-99349101 AAACTACCATCAGAGTGAAAAGG - Intronic
977725558 4:100293006-100293028 AAGCTGCCATCAAATGAAATGGG - Intergenic
977866966 4:102040538-102040560 AACATGCTATCAAAGTAATTAGG - Intronic
978098983 4:104813824-104813846 AACCTAACATCAGAGTAAACAGG + Intergenic
979522373 4:121683355-121683377 AACATGCCTTGAAGGTAAAAAGG - Exonic
979775949 4:124588640-124588662 AACTTATCATCAGAGTAAAAAGG + Intergenic
980551744 4:134345345-134345367 AGCCTGCTATTAAACTAAAAAGG + Intergenic
980588352 4:134849973-134849995 AAACTACCATCAGAGTGAAAAGG + Intergenic
980591961 4:134902021-134902043 AAACTACCATCAGAGTGAAAAGG - Intergenic
980621293 4:135307882-135307904 AAACTACCATCAGAGTGAAAAGG - Intergenic
980804013 4:137788833-137788855 AAACTACCATCAGAGTGAAAAGG + Intergenic
981299570 4:143171619-143171641 AAACTACCATCAGAGTAAACAGG + Intergenic
981460622 4:145009861-145009883 AAACTACCATCAGAGTGAAAAGG + Intronic
981587800 4:146323168-146323190 AAACTACCATCAGAGTAAACAGG - Intronic
981632079 4:146831425-146831447 TACTTGGCATAAAAGTAAAATGG + Intronic
982181220 4:152750201-152750223 AAACTGCCATCAGAGTGAACAGG + Intronic
982323390 4:154104111-154104133 AAACTACCATCAGAGTAAATAGG - Intergenic
982330021 4:154170965-154170987 AAACTGCCATCAGAGTGAACAGG - Intergenic
982437516 4:155395870-155395892 AAACTACCATCAAAGTGAACAGG - Intergenic
982541144 4:156673267-156673289 AACCTGCCAGGAAAGTGGAATGG - Intergenic
982752998 4:159184694-159184716 AAACTACCATCAGAGTAAATAGG - Intronic
982819700 4:159930020-159930042 AAACTGCCATCAGAGTCAACAGG - Intergenic
982880231 4:160704930-160704952 AAACTACCATCAGAGTAAACAGG - Intergenic
983136808 4:164094157-164094179 GACGTGCCAGCAAAATAAAAAGG + Intronic
983181490 4:164654256-164654278 AAACTGCCATCAGAGTGAATAGG + Intergenic
983485653 4:168328976-168328998 AAACTGTCATCAGAGTAAACAGG - Intergenic
983753506 4:171304823-171304845 AAACTACCATCAGAGTAAACAGG - Intergenic
983879530 4:172917437-172917459 AACCTACCATCAAAGTGAACAGG + Intronic
983978298 4:173963892-173963914 AAACTGCCATCAGAGTGAACAGG - Intergenic
984077966 4:175206881-175206903 AAACTACCATCAGAGTGAAAAGG - Intergenic
984109990 4:175600969-175600991 AAACTACCATCAAAGTGAACAGG - Intergenic
984290048 4:177783136-177783158 AAACTACCATCAGAGTAAACAGG + Intronic
984345012 4:178511875-178511897 AAACTGCCATCAGAGTGAACAGG - Intergenic
985207774 4:187558858-187558880 AGGCTGGCATCACAGTAAAAAGG + Intergenic
985380885 4:189393441-189393463 AAACTACCATCAAAGTGAACAGG - Intergenic
986433286 5:7703181-7703203 AAACTGCCATCAGAGTGAACAGG - Intronic
986792510 5:11176518-11176540 AACCTCCAAACACAGTAAAATGG - Intronic
986940259 5:12939789-12939811 AAACTACCATCAAAGTGAACAGG + Intergenic
986954786 5:13137396-13137418 AAACTACCATCAGAGTGAAAAGG + Intergenic
987307606 5:16652339-16652361 AAACTACCATCACAGTGAAAAGG - Intergenic
987454352 5:18124532-18124554 AAACTATCATCAAAGTAAATAGG + Intergenic
987606226 5:20139506-20139528 AAACTGCCATCAGAGTGAACAGG + Intronic
987903029 5:24038154-24038176 AAACTACCATCAGAGTAAACAGG - Intronic
988044818 5:25937321-25937343 AAACTACCATCAGAGTGAAAAGG - Intergenic
988079341 5:26396784-26396806 AAACTACCATCAGAGTAAACAGG + Intergenic
988187388 5:27884847-27884869 AAACTACCATCAGAGTAAACAGG - Intergenic
988283915 5:29187542-29187564 AAACTGCCATCAGAGTGAACAGG - Intergenic
988309280 5:29537113-29537135 AAACTGCCATCAGAGTGAACAGG - Intergenic
988382903 5:30522043-30522065 AACTTTCTAGCAAAGTAAAATGG + Intergenic
988430163 5:31110085-31110107 AAACTACCATCAGAGTAAACAGG + Intergenic
988628914 5:32908108-32908130 AAACTGCCATCAGAGTGAACAGG - Intergenic
988906594 5:35797015-35797037 AATCTGCCATCAACATAAACAGG + Intronic
989044333 5:37259743-37259765 AAACTACCATCAGAGTGAAAAGG - Intergenic
989248104 5:39276689-39276711 AAACTGCCATCAGAGTGAACAGG - Intergenic
989725691 5:44583979-44584001 AAACTACCATCAGAGTAAACAGG + Intergenic
989763396 5:45048582-45048604 AAACTGCCATCAGAGTGAACAGG + Intergenic
989803969 5:45581472-45581494 AAACTGCCATCAGAGTGAACAGG - Intronic
990062612 5:51670617-51670639 AAACTACCATCAGAGTAAACAGG - Intergenic
990611434 5:57460852-57460874 AAACTACCATCAAAGTGAACAGG - Intergenic
990691805 5:58372531-58372553 AAACTACCATCAACGTAAACAGG - Intergenic
991011808 5:61890808-61890830 AAACTGCCATCACAGTGAACAGG - Intergenic
991102436 5:62807753-62807775 AAACTATCATCAAAGTAAACAGG - Intergenic
991213086 5:64130045-64130067 AAACTACCATCAGAGTAAACAGG - Intergenic
991309038 5:65214316-65214338 CTCCTGCCATCAAAGTTAAGGGG - Intronic
992005914 5:72477161-72477183 AACCATCAATCAAAGTACAAGGG - Intronic
992274158 5:75097609-75097631 AAACTGCCATCAGAGTGAAGAGG - Intronic
992346390 5:75882879-75882901 AAACTACCATCAGAGTAAAGAGG + Intergenic
992357103 5:75997379-75997401 AACCTACCATCAGAGTGAACAGG + Intergenic
992390095 5:76323075-76323097 AAACTGTCATCAGAGTAAACAGG + Intronic
992512058 5:77446962-77446984 AAACTACCATCAGAGTGAAAAGG + Intronic
992649898 5:78849017-78849039 AAACTACCATCAAAGTGAACAGG - Intronic
992651232 5:78862794-78862816 AAACTACCATCAAAGTGAACAGG + Intronic
992935326 5:81697249-81697271 AACCAGCCAGAAAAATAAAATGG + Intronic
993191967 5:84695036-84695058 AAACTGCCATCAGAGTGAACAGG - Intergenic
993198030 5:84775490-84775512 AACATGCCATTTAAGTGAAAAGG - Intergenic
993218868 5:85063989-85064011 AAACTACCATCAAAGTGAACAGG - Intergenic
993304956 5:86265467-86265489 AAACTGCCATCAGAGTGAACAGG - Intergenic
994534201 5:101007306-101007328 AAACTGCCATCAGAGTGAACAGG + Intergenic
994538018 5:101056711-101056733 AAACTACCATCAGAGTAAACAGG - Intergenic
994835690 5:104849441-104849463 AAACTACCATCAGAGTAAACAGG - Intergenic
994860850 5:105191438-105191460 AGACTGCCATCAAGTTAAAATGG + Intergenic
995210704 5:109534693-109534715 AAACTGCCATCAGAGTGAACAGG - Intergenic
995365598 5:111356455-111356477 AAACTACCATCAAAGTGAACAGG - Intronic
995489378 5:112674445-112674467 AAACTGCCATCAGAGTGAACAGG - Intergenic
995529642 5:113079846-113079868 AAACTGCCATCAGAGTGAACAGG + Intronic
995567126 5:113442450-113442472 AAACTGCCATCAGAGTGAACAGG - Intronic
995644095 5:114292143-114292165 AAACTGCCATCAGAGTGAACAGG - Intergenic
995666616 5:114549627-114549649 AAACTACCATCAGAGTAAACAGG + Intergenic
995671054 5:114603359-114603381 AAACTACCATCAGAGTGAAAAGG + Intergenic
995745658 5:115400166-115400188 AAACTGCCATCAGAGTGAACAGG - Intergenic
995923259 5:117339205-117339227 AAACTACCATCAGAGTAAACAGG - Intergenic
996257938 5:121427977-121427999 AAACTACCATCAGAGTAAAGAGG - Intergenic
996923443 5:128795598-128795620 AAACTGCCATCAGAGTGAACAGG - Intronic
996937882 5:128968715-128968737 AAACTGCCATCAGAGTGAACAGG - Intronic
997106774 5:131029669-131029691 AAACTGCCATCAGAGTGAACAGG - Intergenic
997108829 5:131051437-131051459 AAACCGCCATCAGAGTAAACAGG + Intergenic
998434887 5:142099403-142099425 AACTTGGCATCCAATTAAAATGG - Intergenic
998807018 5:145927941-145927963 AAACTACCATCAGAGTAAACAGG + Intergenic
1000214756 5:159144713-159144735 AAACTACCATCAGAGTAAACAGG + Intergenic
1000423969 5:161069128-161069150 AAACTACCATCAGAGTAAACAGG - Intergenic
1000495453 5:161978012-161978034 AAACTACCATCAGAGTGAAAAGG + Intergenic
1000516390 5:162240826-162240848 ATACTGCCATGAAAGTGAAATGG + Intergenic
1000534468 5:162462851-162462873 AAACTACCATCAGAGTGAAAAGG - Intergenic
1000746566 5:165041338-165041360 AAACTACCATCAGAGTGAAAAGG - Intergenic
1002440665 5:179262723-179262745 ATCCTGTGAACAAAGTAAAACGG - Intronic
1003794765 6:9588866-9588888 AAACTACCATCAGAGTGAAAAGG + Intergenic
1004094861 6:12543133-12543155 AAACTGTCATCAGAGTAAACAGG - Intergenic
1004191456 6:13467550-13467572 AACCTGCCTGCAAAGAAAAGGGG + Intronic
1005318051 6:24623412-24623434 AACCAGTCTTCAAATTAAAAGGG + Intronic
1005681575 6:28214233-28214255 ACCCTCCCAACAAAGTGAAAAGG + Intergenic
1005890492 6:30133826-30133848 CAACTGCCATCAAAATCAAAGGG - Intergenic
1006041063 6:31255429-31255451 AAACTACCATCAGAGTGAAAAGG - Intergenic
1007266294 6:40598831-40598853 ATCGTGCCATCAAATTAAATGGG + Intergenic
1007859620 6:44894174-44894196 AAACTGCCATCAGAGTGAACAGG - Intronic
1008095216 6:47333024-47333046 AAACTACCATCAAAGTGAACAGG + Intergenic
1008240215 6:49101066-49101088 AAACTGCCATCAGAGTGAACAGG + Intergenic
1008406753 6:51126613-51126635 AAACTGCCATCAGAGTGAACAGG + Intergenic
1008475015 6:51927245-51927267 AACCTGCTATGTATGTAAAAAGG - Intronic
1008698374 6:54068520-54068542 ACCCTGCCATCAAAGGAGGATGG + Intronic
1008915167 6:56779336-56779358 AAACTACCATCAAAGTGAACAGG - Intronic
1009874250 6:69485379-69485401 AAACTACCATCAGAGTGAAAAGG + Intergenic
1009921360 6:70065647-70065669 AAACTGCCATCAGAGTGAACAGG + Intronic
1009944078 6:70322746-70322768 AAACTGCCATCAGAGTGAACAGG + Intergenic
1009947841 6:70360473-70360495 AAACTGCCATCAGAGTGAACAGG + Intergenic
1009956020 6:70454359-70454381 AAACTGCCATCAGAGTGAACAGG - Intronic
1010728597 6:79363842-79363864 AAACTACCATCAGAGTAAACAGG - Intergenic
1010789528 6:80049037-80049059 AAACTACCATCAGAGTAAATGGG - Intergenic
1010997344 6:82549004-82549026 AAACTACCATCAAAGTGAACAGG + Intergenic
1011185059 6:84665435-84665457 AACCTGGGCTGAAAGTAAAAGGG - Intergenic
1011222625 6:85071387-85071409 AAACTGCCATCAGAGTGAACAGG + Intergenic
1011773507 6:90701731-90701753 AACCGCCCAACAAAGGAAAAGGG - Intergenic
1011953815 6:93000348-93000370 AAACTACCATCAGAGTAAACAGG + Intergenic
1012284953 6:97377492-97377514 AAACTACCATCAGAGTAAACAGG - Intergenic
1012411150 6:98958656-98958678 CACCTGCCTTTACAGTAAAATGG - Intergenic
1012781000 6:103557525-103557547 AAACTACCATCAGAGTAAACAGG - Intergenic
1012882760 6:104811308-104811330 TACCTGCAAGCAAAGTACAATGG + Exonic
1012970227 6:105721308-105721330 AAACTACCATCAAAGTGAACAGG + Intergenic
1013881965 6:114915586-114915608 AAACTGCCATCAGAGTGAACAGG - Intergenic
1013882652 6:114924150-114924172 AAACTACCATCAAAGTGAACAGG - Intergenic
1013967024 6:115967055-115967077 TACTTGCCATCACAGGAAAAAGG + Intronic
1014185719 6:118431981-118432003 AAACTACCATCAGAGTAAACAGG + Intergenic
1014332589 6:120088150-120088172 AAACTACCATCAAAGTGAACAGG + Intergenic
1014349113 6:120316887-120316909 AAACTACCATCAGAGTAAACAGG - Intergenic
1014996875 6:128157888-128157910 AAACTACCATCAAAGTGAACAGG - Intronic
1015150231 6:130029495-130029517 TAACTGCCAACAAAATAAAAAGG - Intronic
1015289905 6:131527123-131527145 AAACTACCATCAGAGTAAACAGG - Intergenic
1015551144 6:134413632-134413654 AACATGCCACAAAAGCAAAAGGG + Intergenic
1015677478 6:135766414-135766436 AAACTGCCATCAGAGTGAACAGG - Intergenic
1015967248 6:138706872-138706894 AAACTGCCATCAGAGTGAACGGG - Intergenic
1016242339 6:141945317-141945339 AAACTACCATCAGAGTAAACAGG + Intergenic
1016759532 6:147721651-147721673 AAACTACCATCAGAGTAAACAGG - Intronic
1017347142 6:153397277-153397299 AAACTACCATCAGAGTGAAAAGG - Intergenic
1017356659 6:153517788-153517810 AAACTACCATCAGAGTGAAAAGG - Intergenic
1017997785 6:159548166-159548188 AAACTGCCATCAGAGTGAACAGG - Intergenic
1018503784 6:164442320-164442342 AACCTGCCAAAATATTAAAATGG - Intergenic
1020443548 7:8244597-8244619 AAACTGCCATCAGAGTAAACAGG + Intronic
1020554433 7:9652651-9652673 AAACTGTCATCAAAGTGAACAGG + Intergenic
1020561943 7:9739321-9739343 AAACTACCATCAGAGTAAACAGG - Intergenic
1020923845 7:14298731-14298753 AAACTACCATCAGAGTAAACAGG + Intronic
1021354713 7:19639842-19639864 AAACTACCATCAGAGTGAAAAGG - Intergenic
1023367612 7:39479362-39479384 AAACTACCATCAAAGTGAACAGG + Intronic
1023725536 7:43139305-43139327 ATCCTGTAATCAGAGTAAAATGG + Intronic
1024146704 7:46523950-46523972 AACCTGGCATGCAGGTAAAAGGG + Intergenic
1024938390 7:54736551-54736573 AAACTACCATCAAAGTGAACAGG + Intergenic
1025925685 7:65958160-65958182 ACCCTTCCATCAAACAAAAAGGG + Intronic
1026273122 7:68853482-68853504 AACCTGCTATGAAAGCAAAAAGG + Intergenic
1027200515 7:76061216-76061238 AATCTGCCATCAGAACAAAAAGG - Intronic
1027514773 7:79127751-79127773 AAACTACCATCAAAGTGAACAGG - Intronic
1027696307 7:81415286-81415308 AAAATGCCATGAGAGTAAAAAGG - Intergenic
1028031267 7:85917062-85917084 AAACTACCATCAGAGTGAAAAGG - Intergenic
1028355140 7:89897851-89897873 AAACTGCCATCAGAGTGAACAGG - Intergenic
1028398155 7:90395111-90395133 AGCCTGCCATCCAAGTATACTGG + Intronic
1028422614 7:90650410-90650432 AAACTACCATCAGAGTGAAAAGG - Intronic
1028544588 7:91984083-91984105 AAACTACCATCAGAGTGAAAAGG - Intronic
1028643314 7:93068446-93068468 AAACTGCCATCAGAGTGAACAGG - Intergenic
1028685306 7:93585011-93585033 AAACTGCCATCAGAGTGAACAGG - Intergenic
1029057877 7:97765586-97765608 AAACTACCATCAAAGTGAACAGG + Intergenic
1029801951 7:102957573-102957595 AAACTGCCATCAGAGTGAATAGG + Intronic
1029906589 7:104099444-104099466 AAATGGCCATGAAAGTAAAAAGG - Intergenic
1029957014 7:104650806-104650828 AACAGGCCATTAAAGCAAAATGG + Intronic
1030050581 7:105533436-105533458 AACCTGCCATCAAAGTAAAATGG - Intronic
1030452056 7:109724295-109724317 AAACTTCCATCAGAGTGAAAAGG + Intergenic
1030974868 7:116109262-116109284 AAACTACCATCAGAGTAAACAGG + Intronic
1031276184 7:119726542-119726564 AACCTGCCTTATAAGTAACATGG + Intergenic
1031511669 7:122657928-122657950 AAGCTGCCATCAGAGTGAACAGG + Intronic
1031569812 7:123345066-123345088 AAACTGCCATCAGAGTGAACAGG - Intergenic
1031737399 7:125383784-125383806 AAACTGCCATCAGAGTGAACAGG - Intergenic
1032236769 7:130131339-130131361 AACCTTCCTTCAAAGCCAAAGGG - Exonic
1033292999 7:140104263-140104285 AAACTACCATCAAAGTGAACAGG - Intronic
1035711538 8:1720022-1720044 AAACTACCATCAGAGTAAACAGG + Intergenic
1037033756 8:14141356-14141378 AAACTACCATCAGAGTGAAAAGG + Intronic
1037051389 8:14378468-14378490 AAACTACCATCAGAGTAAACAGG + Intronic
1037121836 8:15298151-15298173 AACTTACCATCATAGGAAAAAGG + Intergenic
1038048985 8:23791392-23791414 AGCCCGCCATCCAAGCAAAACGG + Intergenic
1038206747 8:25474554-25474576 AACCTGACACCAAAATACAAAGG - Intronic
1038361704 8:26886003-26886025 AACCTGCCATAAAAATGAATTGG - Intergenic
1038929426 8:32176516-32176538 AAACTACCATCAGAGTAAACAGG + Intronic
1039773911 8:40716835-40716857 GACCAGCTAACAAAGTAAAAAGG - Intronic
1040411256 8:47156900-47156922 AAACTACCATCAAAGTGAACAGG + Intergenic
1042073351 8:64960742-64960764 AAACTGCCATCAGAGTGAACAGG + Intergenic
1042336656 8:67636570-67636592 AAGCTGCCATCAAAATTAAAGGG - Intronic
1042687358 8:71456949-71456971 AAACTACCATCAAAGTGAACAGG + Intronic
1042713195 8:71742464-71742486 AAACTACCATCAAAGTGAACAGG - Intergenic
1042766337 8:72326164-72326186 AAACTACCATCAAAGTGAACAGG + Intergenic
1043235023 8:77853773-77853795 AAACTGTCATCAAAGTGAACAGG - Intergenic
1043293302 8:78631491-78631513 TACCTCCCATCACAATAAAAAGG - Intergenic
1043833132 8:85014375-85014397 AAACTGCCATCAGAGTGAACAGG + Intergenic
1043878604 8:85515507-85515529 AACCTGCCAAGTAAATAAAATGG + Intergenic
1044210121 8:89540292-89540314 AAACTGCCATCAGAGTGAACAGG + Intergenic
1044292307 8:90486897-90486919 AACCTACCATCAGAGTGAACTGG - Intergenic
1045143065 8:99309133-99309155 AAACTACCATCAGAGTAAACAGG - Intronic
1045227153 8:100260167-100260189 TACCAGCCATCCAAATAAAATGG + Intronic
1045408970 8:101896554-101896576 AAACTACCATCAGAGTAAACAGG + Intronic
1045823463 8:106369349-106369371 AAACTGTCATCAAAGTGAACAGG - Intronic
1046147971 8:110187190-110187212 AAACTGCCATCAGAGTGAACAGG - Intergenic
1046162576 8:110386846-110386868 AAACTACCATCAGAGTGAAAAGG - Intergenic
1046199629 8:110907545-110907567 AACCTGTCAGCTAAGTGAAAAGG - Intergenic
1046363108 8:113187120-113187142 AAACTCCCAGCAAAGTGAAAGGG - Intronic
1046706328 8:117456460-117456482 AAACTACCATCAGAGTAAACAGG + Intergenic
1046708230 8:117479320-117479342 AAACTACCATCAGAGTAAACAGG + Intergenic
1046813087 8:118553721-118553743 AAACTGCCATCAGAGTGAACAGG + Intronic
1046826756 8:118700292-118700314 AAACTGCCATCAGAGTGAACAGG - Intergenic
1047134152 8:122056537-122056559 AAACTATCATCAAAGTGAAAAGG + Intergenic
1048122312 8:131595659-131595681 AAACTACCATCAGAGTAAATGGG - Intergenic
1048685645 8:136902488-136902510 AATAAGCCATCAAAGAAAAATGG - Intergenic
1048792974 8:138121220-138121242 AAACTACCATCAAAGTGAACAGG + Intergenic
1050033273 9:1408594-1408616 AAACTACCATCAGAGTAAACAGG - Intergenic
1050319708 9:4439021-4439043 AATGTGCCATCAAAATATAATGG + Intergenic
1050330008 9:4536233-4536255 AAACTGCCATCAGAGTGAATAGG + Intronic
1050489969 9:6178160-6178182 AAACTACCATCAGAGTAAACAGG - Intergenic
1050808639 9:9716802-9716824 AAACTACCATCAAAGTGAACAGG - Intronic
1050860427 9:10422497-10422519 AAACTACCATCAGAGTAAACAGG + Intronic
1050861717 9:10442279-10442301 AATCTGCAATCAAGGAAAAAGGG + Intronic
1051117249 9:13709893-13709915 AAACTACCATCAGAGTAAACAGG - Intergenic
1051134786 9:13907389-13907411 AAACTACCATCAGAGTAAAAAGG + Intergenic
1051625594 9:19097289-19097311 AAACTGCCATCAGAGTGAACAGG + Intronic
1051839108 9:21374329-21374351 AAACTGCCATCAGAGTGAACAGG - Intergenic
1052065799 9:24018015-24018037 AAACTACCATCAGAGTGAAAAGG - Intergenic
1052392941 9:27902325-27902347 AAACTACCATCAAAGTGAACAGG - Intergenic
1052422910 9:28266957-28266979 AACCTGTCACCAAAGTACAGAGG + Intronic
1052639213 9:31143085-31143107 AAACTGTCATCAAAGTGAACAGG + Intergenic
1054808462 9:69414720-69414742 AAACTACCATCAGAGTGAAAAGG - Intergenic
1055213935 9:73835300-73835322 AAACTACCATCAGAGTGAAAAGG + Intergenic
1055215217 9:73851606-73851628 AAACTACCATCAAAGTGAAAAGG + Intergenic
1055380214 9:75698556-75698578 AACATGCAATCAAAGGAGAAGGG - Intergenic
1057162668 9:92900880-92900902 AAACTGCCATCAGAGTGAACAGG - Intergenic
1057442224 9:95090958-95090980 AACCTGCCCTCAATGACAAAGGG + Intergenic
1058552203 9:106126916-106126938 AAACTGCCATCAGAGTGAACAGG - Intergenic
1059964143 9:119597023-119597045 AAACTGTGATCAAAATAAAATGG + Intergenic
1060725631 9:126003847-126003869 AACCAGGCAACAAAGTAAAGAGG + Intergenic
1061595356 9:131625312-131625334 AATCTGTCATAAAAGTAATAAGG - Intronic
1203690771 Un_GL000214v1:40454-40476 AAACTGCCATCAGAGTGAACAGG - Intergenic
1203554935 Un_KI270743v1:198712-198734 AAACTGCCATCAGAGTGAACAGG + Intergenic
1203645524 Un_KI270751v1:63737-63759 AAACTGCCATCAGAGTGAACAGG + Intergenic
1185916553 X:4041843-4041865 AAGATTGCATCAAAGTAAAAAGG - Intergenic
1186463721 X:9768202-9768224 ACCCTGTCATCAAAGTGAGAGGG + Intronic
1186539494 X:10385841-10385863 AAACTACCATCAGAGTGAAAAGG - Intergenic
1186845579 X:13527573-13527595 AAACTGCCATCAGAGTGAACAGG - Intergenic
1186889430 X:13945793-13945815 AAACTACCATCAGAGTGAAAAGG + Intergenic
1186993417 X:15093586-15093608 AAACTACCATCAGAGTGAAAAGG + Intergenic
1187170681 X:16848373-16848395 AAGCCGTCATCAAAATAAAAGGG + Intronic
1187210153 X:17222191-17222213 AAACTGCCATCAGAGTGAACAGG - Intergenic
1187875752 X:23802526-23802548 AACTTGCCTTCAAAATTAAATGG - Intergenic
1188037316 X:25333228-25333250 AAACTACCATCAGAGTGAAAAGG + Intergenic
1188191785 X:27180624-27180646 CACCTGCAATCGCAGTAAAAGGG - Intergenic
1189203069 X:39214591-39214613 AGCCTGACATCACAATAAAAAGG - Intergenic
1189627051 X:42909808-42909830 AAACTACCATCAAAGTGAACAGG + Intergenic
1189728816 X:43997305-43997327 TACCTGCCATCAAGGGAATAAGG + Intergenic
1189742000 X:44128486-44128508 AAACTCCCAGCAAAGTAGAAGGG - Intergenic
1190210026 X:48438632-48438654 AAACTGCCATCAGAGTGAATAGG + Intergenic
1190593281 X:52026594-52026616 AAACTGTCATCAAAGTGAACAGG - Intergenic
1190620004 X:52277735-52277757 GACATGACATCAAATTAAAAAGG - Intergenic
1191032332 X:55988153-55988175 AAACTACCATCAGAGTAAACAGG - Intergenic
1191132053 X:57024819-57024841 AAACTACCATCAGAGTAAACAGG - Intergenic
1191200008 X:57770425-57770447 AAACTGTCATCAGAGTAAACAGG - Intergenic
1191203633 X:57811224-57811246 AAACTGCCATCAGAGTGAACTGG - Intergenic
1191270070 X:58454249-58454271 AAACTGCCATCAGAGTGAACAGG - Intergenic
1192010924 X:67271599-67271621 AAACTACCATCAGAGTAAACAGG + Intergenic
1193206931 X:78760257-78760279 AAACTACCATCAGAGTGAAAAGG - Intergenic
1193268297 X:79499316-79499338 AAACTACCATCAGAGTAAACAGG + Intergenic
1193269155 X:79509118-79509140 AAACTACCATCAGAGTAAACAGG + Intergenic
1193302300 X:79904067-79904089 AAACTACCATCAGAGTGAAAAGG + Intergenic
1193343326 X:80378188-80378210 AAACTGCCATCAGAGTGAAGAGG - Intronic
1193356594 X:80526210-80526232 AAACTACCATCAGAGTAAACAGG - Intergenic
1193400074 X:81032011-81032033 AAACTACCATCAAAGTGAACAGG + Intergenic
1193610343 X:83623914-83623936 AAACTGCCATCAGAGTGAACAGG - Intergenic
1193727486 X:85059829-85059851 AAACTACCATCAAAGTGAACAGG - Intronic
1193751842 X:85355497-85355519 AAACTACCATCAGAGTGAAAAGG + Intronic
1193781879 X:85712869-85712891 AAACTGCCATCAGAGTGAACAGG - Intergenic
1193904010 X:87221069-87221091 AAACTGCCATCAGAGTGAACAGG + Intergenic
1194446259 X:93990662-93990684 AAACTGTCATCAAAGTGAACAGG + Intergenic
1194514876 X:94840152-94840174 AAACTACCATCAGAGTGAAAAGG - Intergenic
1195224463 X:102778068-102778090 AAACTACCATCAGAGTGAAAAGG - Intergenic
1195282893 X:103354182-103354204 AAACTTCCATCAGAGTAAACAGG - Intergenic
1196004147 X:110817703-110817725 AAACTACCATCAGAGTGAAAAGG - Intergenic
1196079381 X:111615051-111615073 AAACTACCATCAAAGTGAACAGG + Intergenic
1196640887 X:118059448-118059470 ACCCTGCTATCAACGTATAAGGG + Intronic
1197179800 X:123522074-123522096 AAACTACCATCAGAGTGAAAAGG + Intergenic
1197239209 X:124105356-124105378 AAACTACCATCAGAGTAAACAGG - Intronic
1197649500 X:129049424-129049446 AAACTACCATCAGAGTAAACAGG + Intergenic
1198191417 X:134310582-134310604 AAACTGCCATCAGAGTGAACAGG + Intergenic
1198317007 X:135478059-135478081 AACCTTCAGTCATAGTAAAAAGG + Intergenic
1198404795 X:136301539-136301561 AAACTACCATCAGAGTAAACAGG - Intronic
1199221565 X:145322104-145322126 AAACTGCCATCAGAGTGAACAGG - Intergenic
1199481254 X:148300703-148300725 AAACTACCATCAAAGTGAACAGG - Intergenic
1199482057 X:148308682-148308704 TACCTTTCATAAAAGTAAAAAGG - Intergenic
1199827134 X:151511434-151511456 AATCTGCCAACATATTAAAAGGG + Intergenic
1200529105 Y:4312914-4312936 AAGCTGCCATCAGAGTGAACAGG + Intergenic
1200733596 Y:6769937-6769959 AAACTACCATCAGAGTGAAAAGG - Intergenic
1201296576 Y:12468369-12468391 AACCTGCTAGCAAATAAAAAGGG + Intergenic
1201350144 Y:13030905-13030927 AAACTACCATCAAAGTGAACAGG + Intergenic
1201699425 Y:16863944-16863966 AAACTACCATCAAAGTGAACAGG + Intergenic
1201736084 Y:17263560-17263582 AAACTGCCATCAGAGTGAACAGG + Intergenic
1201783760 Y:17750961-17750983 AAACTACCATCAGAGTAAATGGG + Intergenic
1201817793 Y:18155026-18155048 AAACTACCATCAGAGTAAATGGG - Intergenic
1201915522 Y:19177683-19177705 AAACTACCATCAGAGTAAATAGG + Intergenic
1202025510 Y:20518677-20518699 AACCTCCCATCAGAGTCCAAGGG + Intergenic
1202035381 Y:20628338-20628360 AAACTGCCATCAGAGTGAACAGG + Intergenic
1202241948 Y:22780106-22780128 AAACTACCATCAGAGTAAACAGG + Intergenic
1202327762 Y:23709630-23709652 AAACTGCCATCAGAGTGAACAGG + Intergenic
1202394932 Y:24413850-24413872 AAACTACCATCAGAGTAAACAGG + Intergenic
1202475852 Y:25256242-25256264 AAACTACCATCAGAGTAAACAGG - Intergenic
1202543008 Y:25960422-25960444 AAACTGCCATCAGAGTGAACAGG - Intergenic