ID: 1030050583 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:105533451-105533473 |
Sequence | GGCAGGTTATTGCAAATCAA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1030050581_1030050583 | -8 | Left | 1030050581 | 7:105533436-105533458 | CCATTTTACTTTGATGGCAGGTT | 0: 1 1: 0 2: 0 3: 24 4: 742 |
||
Right | 1030050583 | 7:105533451-105533473 | GGCAGGTTATTGCAAATCAAGGG | No data | ||||
1030050575_1030050583 | 30 | Left | 1030050575 | 7:105533398-105533420 | CCTAGTACGGGAGTATATGTCAG | 0: 1 1: 0 2: 1 3: 3 4: 33 |
||
Right | 1030050583 | 7:105533451-105533473 | GGCAGGTTATTGCAAATCAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1030050583 | Original CRISPR | GGCAGGTTATTGCAAATCAA GGG | Intronic | ||