ID: 1030050583

View in Genome Browser
Species Human (GRCh38)
Location 7:105533451-105533473
Sequence GGCAGGTTATTGCAAATCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030050581_1030050583 -8 Left 1030050581 7:105533436-105533458 CCATTTTACTTTGATGGCAGGTT 0: 1
1: 0
2: 0
3: 24
4: 742
Right 1030050583 7:105533451-105533473 GGCAGGTTATTGCAAATCAAGGG No data
1030050575_1030050583 30 Left 1030050575 7:105533398-105533420 CCTAGTACGGGAGTATATGTCAG 0: 1
1: 0
2: 1
3: 3
4: 33
Right 1030050583 7:105533451-105533473 GGCAGGTTATTGCAAATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030050583 Original CRISPR GGCAGGTTATTGCAAATCAA GGG Intronic