ID: 1030055262

View in Genome Browser
Species Human (GRCh38)
Location 7:105578754-105578776
Sequence GAGTGGACACAATTTTAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030055262_1030055265 23 Left 1030055262 7:105578754-105578776 CCAAGTTAAAATTGTGTCCACTC 0: 1
1: 0
2: 2
3: 13
4: 132
Right 1030055265 7:105578800-105578822 TCTCACTCTGTTGCTCAGGCTGG 0: 1191
1: 26271
2: 82573
3: 179480
4: 250371
1030055262_1030055264 19 Left 1030055262 7:105578754-105578776 CCAAGTTAAAATTGTGTCCACTC 0: 1
1: 0
2: 2
3: 13
4: 132
Right 1030055264 7:105578796-105578818 AGAGTCTCACTCTGTTGCTCAGG 0: 361
1: 8964
2: 38488
3: 98121
4: 178243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030055262 Original CRISPR GAGTGGACACAATTTTAACT TGG (reversed) Intronic
900850383 1:5137899-5137921 CAGTGGACATAGTTTTAGCTGGG + Intergenic
902605764 1:17568544-17568566 GAGTGGTCCCATTTTTCACTGGG + Intronic
904817347 1:33214808-33214830 GAGTGAAAGCCATTTTAACTGGG - Intergenic
907078916 1:51603524-51603546 AAGTGGACAAAATCTTAAATAGG + Intronic
907098693 1:51806845-51806867 GAGTATTCACAATTTTAACTGGG + Exonic
907171632 1:52471410-52471432 GTGTAAACACAATTTTATCTGGG - Intronic
911946639 1:104118129-104118151 GAGTGGTCACATTTTTAATGTGG + Intergenic
913233707 1:116762896-116762918 GGGTGGCCACAATTTTATCTTGG - Intronic
915756498 1:158266284-158266306 GAGTGCACACAATTCTGACAGGG + Intergenic
917210599 1:172628135-172628157 TATTTGACACAATTGTAACTAGG - Intergenic
918274593 1:182941637-182941659 GAGTGCACACAATTCTGACAGGG + Intronic
918746782 1:188211473-188211495 GAGTGCACACAATTTCACATGGG - Intergenic
920240422 1:204543724-204543746 GAGAGGAGGCTATTTTAACTAGG - Intronic
923924103 1:238603892-238603914 TAGTATACACAATTATAACTAGG - Intergenic
1065482385 10:26208938-26208960 GAGTGGCCATAATTTTAAGTGGG - Intronic
1066190691 10:33053062-33053084 GTTTGGAAACAATTTTAACCAGG + Intergenic
1068359755 10:55962031-55962053 GAGTGGACAGAATTTCAGCTGGG - Intergenic
1071421750 10:85507218-85507240 GACTGGACATAATGTTGACTAGG + Intergenic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1072901491 10:99411540-99411562 GAGTGGATACAGTTTTAACTAGG - Intronic
1073196922 10:101699027-101699049 CAGTGGACACAATATTGGCTGGG + Intergenic
1074911440 10:117913296-117913318 AAGTGGACAACATGTTAACTAGG - Intergenic
1076273714 10:129178536-129178558 CACTGGAAACAAATTTAACTGGG - Intergenic
1077967761 11:7153814-7153836 GAGTGGGAACTACTTTAACTTGG - Intergenic
1078418007 11:11181647-11181669 GAGTGCACACAATTCTGACAGGG + Intergenic
1089105713 11:116002154-116002176 GAGTGGAAACAATGTTCAGTGGG + Intergenic
1093885206 12:24451477-24451499 GGGTAGACGTAATTTTAACTAGG + Intergenic
1095301644 12:40590964-40590986 CAGTGGGAAAAATTTTAACTAGG + Intergenic
1099392823 12:82101590-82101612 GAGTGGACATAATTTGAAATAGG - Intergenic
1099470664 12:83043766-83043788 TAGTAGACACAATATTAATTTGG + Intronic
1100898655 12:99214001-99214023 GAGTAGACTCAATTTTCGCTCGG - Intronic
1103529134 12:121588129-121588151 GAGGGGAGAAAATTTTAACGGGG + Intergenic
1109255598 13:60076761-60076783 CACTGGTCACAATCTTAACTTGG + Intronic
1111520544 13:89396934-89396956 GAGTGAAAGCCATTTTAACTGGG + Intergenic
1113305348 13:109072397-109072419 GAGGGGACACAATGTAAAATGGG - Intronic
1120737411 14:88068531-88068553 CAGTTCACACAATTTTCACTTGG + Intergenic
1123218969 14:106839321-106839343 GAGTGGACAAAATTACAACATGG + Intergenic
1127018442 15:54716422-54716444 GAATGGTAACAATTATAACTTGG + Intergenic
1130053881 15:80506333-80506355 GAGTGGACCCAATTCCAACAAGG + Intronic
1130949496 15:88574215-88574237 GAGTGGACACAAATAGCACTGGG - Intergenic
1131003061 15:88953921-88953943 GAGTGCACACAATTCTCACAGGG - Intergenic
1133658102 16:7886626-7886648 CAGTGGACATAATTGTAAATGGG - Intergenic
1135977178 16:27116144-27116166 GAATGGACACAAATTAAACATGG + Intergenic
1137287697 16:47030161-47030183 GGGTGGACACACATTTAATTAGG - Intergenic
1137571963 16:49572336-49572358 GAGTGGGAAGGATTTTAACTGGG + Intronic
1137880413 16:52040061-52040083 GTGTGGACATAATTTTCTCTTGG + Intronic
1138866011 16:60820571-60820593 CAGTGGCCACAAATTAAACTTGG - Intergenic
1145408850 17:22637680-22637702 GAGGAGATACAATTTTAAGTAGG + Intergenic
1149939862 17:60852289-60852311 GAGTGGACACAATTCTGACAGGG - Intronic
1151224273 17:72637037-72637059 ATCTGGACACAGTTTTAACTGGG - Intergenic
1151301541 17:73231053-73231075 GAGTGGACTAAATTTGAAATTGG - Intronic
1154944174 18:21145159-21145181 GACAGAACATAATTTTAACTTGG + Intergenic
1155284899 18:24277515-24277537 GGGTGGTCACCATTTTAAATAGG + Intronic
1155453322 18:25985555-25985577 GAGGGGTTACAATTTTAAGTAGG - Intergenic
1156856112 18:41783019-41783041 GAGTGGCCCCAAGTATAACTTGG + Intergenic
1158502694 18:58018015-58018037 GAGTGCACACAATTCTGACAGGG + Intergenic
1162173402 19:8809871-8809893 GAGTGGCCACAATTTTCACTGGG - Exonic
1168042154 19:53767355-53767377 GAGTCCACACAATTCTAACAGGG + Intergenic
929380896 2:41352143-41352165 GGGTAGACACATTTTTAAATAGG - Intergenic
934576488 2:95404958-95404980 CAGTGGAAACCATTTTAAGTAGG + Intronic
934638712 2:96013127-96013149 CAGTGGAAACCATTTTAAGTTGG + Intergenic
936629948 2:114191492-114191514 GAGTGGGTAAAATGTTAACTAGG - Intergenic
936706684 2:115083510-115083532 GAGTGGACACAAATATAATGAGG - Intronic
937561808 2:123233483-123233505 GAGTATACACAGTTATAACTGGG - Intergenic
938232817 2:129676228-129676250 GAATGGACAAAATTTAAAATAGG - Intergenic
942000196 2:171638848-171638870 GAGAGGGCACAATTCAAACTTGG - Intergenic
942820308 2:180105966-180105988 GATTGGACACATGTTTACCTTGG + Intergenic
945422360 2:209654634-209654656 GAGTATACACAACTTTAACAGGG + Intronic
945729097 2:213510565-213510587 AACTGGAAACAACTTTAACTTGG + Intronic
945958299 2:216106593-216106615 GACTGCACACAATTTTGACACGG + Intergenic
946518447 2:220439414-220439436 GAATGGAAACCATTTTAACTAGG + Intergenic
947482059 2:230509834-230509856 AAGTGAACACAATTGTCACTTGG - Intronic
947496579 2:230642135-230642157 AGGTGGACACATCTTTAACTGGG + Intergenic
1170385586 20:15812660-15812682 CATTAGACACAATTTTAGCTAGG + Intronic
1174492899 20:50914906-50914928 CAGTGGACCAAATTTTAAGTTGG + Intronic
1175358964 20:58391953-58391975 GAAGCAACACAATTTTAACTTGG - Intronic
1175360317 20:58405100-58405122 GAATGGATTCAATTTTAAGTAGG + Intronic
1175586395 20:60144131-60144153 GAGTGGACACAACATTTCCTGGG - Intergenic
1175867949 20:62191367-62191389 GAGGGGACACCATTTTCTCTAGG + Intronic
1179306750 21:40160923-40160945 GACAGGACACAAATTGAACTTGG - Intronic
1185124834 22:49003892-49003914 GAATAGACACAATTTTAAGTTGG + Intergenic
951364674 3:21766813-21766835 CAGTAAATACAATTTTAACTAGG - Intronic
956215981 3:66849424-66849446 CAGTGAAGAAAATTTTAACTGGG + Intergenic
956307478 3:67842107-67842129 GACTGGCTACAACTTTAACTTGG - Intergenic
962561407 3:136610396-136610418 GAGTGCACACAATTCTGACAGGG - Intronic
963372949 3:144425044-144425066 CAAAGGAGACAATTTTAACTTGG - Intergenic
963944191 3:151127417-151127439 GAGTAGGGACAATTTTCACTTGG + Intronic
965370105 3:167851644-167851666 GAGAGGAAACATTATTAACTAGG + Intergenic
968133502 3:196206857-196206879 GAGAGGAAACAATTCTAACTGGG - Intronic
970559655 4:17270025-17270047 GAGTGGACTGAATTTTAAAAGGG - Intergenic
971822413 4:31575415-31575437 GGGTGGATGCAATTTTAAATAGG + Intergenic
971911399 4:32800777-32800799 GAATGGACACAAGTTCAATTTGG - Intergenic
973549363 4:52017097-52017119 GGGTGAGTACAATTTTAACTAGG - Exonic
975115948 4:70680994-70681016 GAGAAGACACAATCTTAGCTGGG + Intronic
977298559 4:95239552-95239574 GAGTGGACACCAATATAACCAGG - Intronic
980331350 4:131415149-131415171 AAGTGGACAGAATTTTAAATGGG + Intergenic
981410685 4:144426759-144426781 GAATGGCCACAATTATAAATAGG + Intergenic
982135956 4:152274304-152274326 GAGATGACACAGTCTTAACTTGG - Intergenic
982855003 4:160370732-160370754 AAGTAGACATAATTTTATCTAGG + Intergenic
984476456 4:180241628-180241650 CAGTGGACGCTATTTTAAATTGG + Intergenic
987898579 5:23981082-23981104 GAGTAGACACACTTATAAGTGGG + Intronic
994523223 5:100868833-100868855 CAGTGGAAACAATTTTGCCTGGG - Intronic
995384289 5:111571634-111571656 GAGTGCACACAATTCTGACAGGG + Intergenic
998939688 5:147267865-147267887 GAATGGGCAGCATTTTAACTGGG - Intronic
1000801259 5:165729302-165729324 CATTGTACACAATTTTAAATTGG - Intergenic
1003712802 6:8612468-8612490 TAGTGAACAAAATTTTAACTTGG - Intergenic
1003716343 6:8650466-8650488 AAGTGGACACAAATTGAACCAGG + Intergenic
1004972941 6:20932361-20932383 GGGTGGACACGATTCTAATTAGG - Intronic
1006503278 6:34471702-34471724 CAGTGGTCACAGTTTTGACTTGG + Intronic
1010150435 6:72725554-72725576 AAGAGTACACAATTTTAATTAGG + Intronic
1016124404 6:140382617-140382639 GAGTGGTCAGAATTAAAACTAGG - Intergenic
1017444281 6:154493260-154493282 GTGGGGATGCAATTTTAACTAGG - Intronic
1017562922 6:155649949-155649971 AATTAGAAACAATTTTAACTTGG + Intergenic
1018504162 6:164445818-164445840 GGGTGGCCACAGTTTAAACTGGG + Intergenic
1020593706 7:10176372-10176394 CAGTGGAAACTATTTTAACGAGG + Intergenic
1021179688 7:17491465-17491487 GAGTGGACAACACTTTAATTAGG - Intergenic
1021394963 7:20135961-20135983 TAGAGGACACAATTTTAATGTGG + Exonic
1022813256 7:33889545-33889567 CAGTGGAAACTATTTTAAATAGG - Intergenic
1024454003 7:49582027-49582049 AATTGGACACAAGTTTCACTGGG + Intergenic
1026551020 7:71368488-71368510 GAGGTGACAAAATTTGAACTGGG - Intronic
1030055262 7:105578754-105578776 GAGTGGACACAATTTTAACTTGG - Intronic
1030160844 7:106507083-106507105 CAGTAGACACAATTTTGCCTAGG + Intergenic
1031378086 7:121051659-121051681 GAGTGCACACAATTCTGACAGGG - Intronic
1033375340 7:140756063-140756085 GAGTAGACAGAAATGTAACTGGG + Intronic
1038086742 8:24206449-24206471 GAGTGGACACAATTCAAGTTGGG + Intergenic
1038525572 8:28270267-28270289 GAGTGGATACAGTTATATCTTGG - Intergenic
1039111098 8:34041261-34041283 GAGTGAACACATTTTGAATTAGG + Intergenic
1043365101 8:79523210-79523232 GAGGGGACACAATTATCTCTAGG + Intergenic
1047753271 8:127898766-127898788 GTGTGGCCACTATTTTAACAAGG - Intergenic
1047955205 8:129969502-129969524 GAGTAGATACAATTTTAATGTGG - Intronic
1052485942 9:29100265-29100287 GAGGGGAAGCCATTTTAACTGGG + Intergenic
1052486063 9:29101517-29101539 GAGGGGAAGCCATTTTAACTGGG - Intergenic
1056304767 9:85279155-85279177 CTGTGGACACAATTTTGGCTAGG + Intergenic
1057759377 9:97860358-97860380 CAGTGAACAAAATTTTAAATGGG + Intergenic
1059119967 9:111632758-111632780 GAGTGGATATAATTTTACCTTGG + Intronic
1060902858 9:127276301-127276323 GAGAGGAGAAAATTTTAACAGGG - Intronic
1186397553 X:9225059-9225081 GATTGGACAACATTTTAGCTAGG - Intergenic
1187739205 X:22337103-22337125 GAGGTAACACAAGTTTAACTGGG + Intergenic
1190359257 X:49633962-49633984 GAGGGGACAGAAGTATAACTGGG + Intergenic
1192217696 X:69174868-69174890 GAGTGCACACAATTCTGACAGGG - Intergenic
1193179545 X:78438475-78438497 TAGTGGAATCAATTTTAATTAGG + Intergenic
1195204718 X:102586408-102586430 GAGTGCACACAATTCTGACAGGG + Intergenic
1196047148 X:111268226-111268248 AAGAGGACACAATTTTAATTCGG + Intronic
1196318546 X:114259999-114260021 GAGCAGAAACACTTTTAACTGGG - Intergenic
1198835250 X:140797594-140797616 TAGTGGGCACAATTTTAAGCTGG + Intergenic
1199989735 X:152979689-152979711 GTGTGCACAGAATTTTAAATTGG - Intergenic
1200285305 X:154816630-154816652 GAGTGCACACAATTCTGACAGGG + Intronic
1200550544 Y:4573358-4573380 AAGTTGATAAAATTTTAACTCGG - Intergenic