ID: 1030056947

View in Genome Browser
Species Human (GRCh38)
Location 7:105591525-105591547
Sequence TATGCTCTAGAACCCTGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 52}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030056947_1030056957 14 Left 1030056947 7:105591525-105591547 CCCCCGCAGGGTTCTAGAGCATA 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1030056957 7:105591562-105591584 CCTGATTTGTTATGGAGGGAGGG 0: 1
1: 0
2: 0
3: 16
4: 183
1030056947_1030056953 9 Left 1030056947 7:105591525-105591547 CCCCCGCAGGGTTCTAGAGCATA 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1030056953 7:105591557-105591579 ACTGTCCTGATTTGTTATGGAGG No data
1030056947_1030056954 10 Left 1030056947 7:105591525-105591547 CCCCCGCAGGGTTCTAGAGCATA 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1030056954 7:105591558-105591580 CTGTCCTGATTTGTTATGGAGGG No data
1030056947_1030056952 6 Left 1030056947 7:105591525-105591547 CCCCCGCAGGGTTCTAGAGCATA 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1030056952 7:105591554-105591576 CCAACTGTCCTGATTTGTTATGG 0: 1
1: 1
2: 1
3: 25
4: 191
1030056947_1030056955 13 Left 1030056947 7:105591525-105591547 CCCCCGCAGGGTTCTAGAGCATA 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1030056955 7:105591561-105591583 TCCTGATTTGTTATGGAGGGAGG No data
1030056947_1030056958 15 Left 1030056947 7:105591525-105591547 CCCCCGCAGGGTTCTAGAGCATA 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1030056958 7:105591563-105591585 CTGATTTGTTATGGAGGGAGGGG 0: 1
1: 0
2: 2
3: 22
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030056947 Original CRISPR TATGCTCTAGAACCCTGCGG GGG (reversed) Intronic
902114279 1:14108094-14108116 GATGCTCTAGAAGCTTGCCGTGG + Intergenic
902787386 1:18741853-18741875 TATTCTCTAGGAGCCTGCAGGGG + Intronic
1064141633 10:12795544-12795566 TATGCTCCAAAACACTGCAGGGG - Intronic
1067005885 10:42661572-42661594 CATGCTCTTCAACCCTGCTGTGG + Intergenic
1067011557 10:42718757-42718779 TAGGCTATAGAATCCTGAGGCGG + Intergenic
1067312029 10:45123082-45123104 TAGGCTATAGAATCCTGAGGCGG - Intergenic
1076767983 10:132647016-132647038 TCTGCTCGAGGACCCTGCGCTGG - Intronic
1085904514 11:80743932-80743954 TTAGCTCTAGAACCCTGAGATGG + Intergenic
1089696072 11:120217054-120217076 TAGGCTAAAGAACCCTGGGGAGG + Intronic
1092367470 12:7889094-7889116 TGTGCTCAAGAACCCTCCTGGGG - Intronic
1110996933 13:82122383-82122405 TATGCATTAGAATCCTGCTGAGG + Intergenic
1121101708 14:91254011-91254033 CAGGCTCTAGAACACTGCGTGGG + Intergenic
1122432705 14:101666058-101666080 TTTGCTATGGAACCCTGAGGTGG - Intergenic
1122945991 14:105009759-105009781 TTTGCTCTGCAACCCTGTGGGGG + Exonic
1124786130 15:32682263-32682285 TGTGCACTAGAACCATGAGGAGG - Intronic
1127560669 15:60133108-60133130 TATGCTCCAGAAGCCTTAGGAGG + Intergenic
1144749726 17:17640109-17640131 TCTGCCCTAGAGCCCTGCAGAGG + Intergenic
1146262436 17:31430874-31430896 GATGCTGAAGAACCCTGCAGTGG + Intronic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1155073633 18:22337033-22337055 TGTGCTCAAGAACCCTGGGGTGG - Intergenic
1159044268 18:63353874-63353896 TATGCTTTAGAACTAGGCGGAGG + Intronic
1159493296 18:69166772-69166794 TATTCTCTAGAACCCTGGTGTGG + Intergenic
925144280 2:1570464-1570486 TGAGCTCTAGACCCCTGGGGAGG - Intergenic
936150793 2:110021092-110021114 TAGCCTCTAGAACTCTGAGGAGG + Intergenic
936193883 2:110350277-110350299 TAGCCTCTAGAACTCTGAGGAGG - Intergenic
938398431 2:130967560-130967582 CATGCTGCAGAAGCCTGCGGGGG - Intronic
943698324 2:190960922-190960944 TTTGCTTTAGAAACCTGGGGTGG - Intronic
1171992240 20:31705617-31705639 GATGCTGTAGAACCCAGAGGAGG + Intronic
1175860377 20:62147308-62147330 TGTGCTGGGGAACCCTGCGGTGG + Intronic
950172272 3:10847163-10847185 TTTGCTCAAGGACCCTCCGGTGG + Intronic
954198985 3:49013103-49013125 TCTGCTCAAGGACCCTGGGGTGG + Exonic
961552274 3:127676263-127676285 CCTGCTCTAGAAGCCTGGGGAGG - Exonic
964367918 3:155969407-155969429 TTTGCTCAAGAACCCAGCGCAGG - Intergenic
970612804 4:17741384-17741406 TTTGCTCTTGAACCCTGGGCAGG - Intronic
972725779 4:41745789-41745811 TCTGATCTGGAATCCTGCGGCGG - Exonic
974830698 4:67185631-67185653 TATGCTCCAGAAGCCTGTGTTGG - Intergenic
981550045 4:145934799-145934821 TATGCTGTAGAATCCTTAGGGGG + Intronic
992528005 5:77630287-77630309 TGTGCTCTAGCGCCTTGCGGCGG + Exonic
996954746 5:129169424-129169446 TATGCTCTAAAACCCTTCTGAGG - Intergenic
997487983 5:134248007-134248029 TAGGCTCTAGGACCCTGAGGGGG - Intergenic
1002045742 5:176540966-176540988 TAGGCTTTGGAACCCTGCTGTGG + Intergenic
1003875020 6:10427241-10427263 CAGGCTCTGGAACCCTGGGGAGG + Intergenic
1007381051 6:41490387-41490409 GATGCTCTAGACCTCTGTGGTGG - Intergenic
1012457102 6:99419254-99419276 CATGGTTTAGGACCCTGCGGTGG - Intronic
1017773269 6:157659944-157659966 TTTGCTCTAGAACCATGCTGTGG + Intronic
1019366679 7:636710-636732 TGTGCTGTAGAAGCCTGCTGGGG + Intronic
1024587802 7:50856525-50856547 TGTGTTCAAGAAACCTGCGGTGG - Intergenic
1029577709 7:101414319-101414341 TCTGTTCTAGAACCCTCGGGCGG + Intronic
1030056947 7:105591525-105591547 TATGCTCTAGAACCCTGCGGGGG - Intronic
1034535734 7:151724662-151724684 TGTGCTCTCGGACCCTGCGCAGG + Intronic
1036497638 8:9283868-9283890 TATGCTGTTGAAACCTGGGGTGG - Intergenic
1040641416 8:49338543-49338565 TGTGTTTTAGAACCATGCGGAGG + Intergenic
1045708486 8:104956093-104956115 TATGCTCTACAACTCTGCGCAGG + Intronic
1050443880 9:5697125-5697147 AAAGCTCTAGAAACCTGCAGGGG - Intronic
1057972403 9:99570595-99570617 CCTGCTCTAGGACCCTGCAGCGG - Intergenic
1060655860 9:125372297-125372319 GATGCTCAAGAACCCCGCTGAGG - Intergenic
1186769049 X:12799403-12799425 TGTGCCCTAGAAACCTGCTGTGG + Intronic
1196381267 X:115092423-115092445 TATGGTCTAATACCCTGTGGAGG + Intergenic
1201612603 Y:15860081-15860103 TATGCTCTAGAAGCCTTGTGAGG + Intergenic