ID: 1030056969

View in Genome Browser
Species Human (GRCh38)
Location 7:105591655-105591677
Sequence TATGCTGGTGGTCCACACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030056969_1030056974 1 Left 1030056969 7:105591655-105591677 CCTATGTGTGGACCACCAGCATA 0: 1
1: 0
2: 2
3: 6
4: 93
Right 1030056974 7:105591679-105591701 AGACACTGGGCTTTAGTGTCAGG 0: 1
1: 0
2: 1
3: 18
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030056969 Original CRISPR TATGCTGGTGGTCCACACAT AGG (reversed) Intronic
900515052 1:3077762-3077784 AGTGCTGGTGGTCCACGCACGGG - Intronic
902561482 1:17280287-17280309 TAAGCAGGTGGTCCTCACGTTGG + Intronic
912463323 1:109852054-109852076 GATGCTGGTGACCCACAGATGGG - Intergenic
914042650 1:144064029-144064051 GATGCTGGTTGTCCAGACAGGGG + Intergenic
917745708 1:178004855-178004877 TATACTGGTGGTGCATAGATAGG + Intergenic
921004217 1:211076593-211076615 GATGTTGGTGGTCTACAGATGGG - Intronic
1077822926 11:5768151-5768173 TATGCTGGTGGTACCCACTATGG - Intronic
1081682313 11:45016961-45016983 GATGTTGGTGGTCTACAGATGGG + Intergenic
1091287612 11:134416700-134416722 TATGCTAGTGGTCCATAGATGGG + Intergenic
1091937902 12:4447887-4447909 TATGCTGGTGGTCCTCACTTAGG + Intergenic
1092661855 12:10747508-10747530 TTTGCTGGAGGTCCACACCTGGG + Intergenic
1094345821 12:29467760-29467782 GATGGTGGTGTTCCACACTTAGG - Intronic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1111102564 13:83606695-83606717 TACAATGGTGGTACACACATTGG - Intergenic
1112832046 13:103464897-103464919 AATGCTGGTGGTCTACTCCTGGG + Intergenic
1115632899 14:35263340-35263362 TATGCTGGCTCTACACACATTGG - Intronic
1120825685 14:88952882-88952904 TCTTCTGATGGTCCACACTTAGG - Intergenic
1125509582 15:40285759-40285781 CAGGCTGGTGGGCCACACACAGG - Intronic
1125833963 15:42735006-42735028 TATGCTGGTGCTTAACACAGGGG - Intronic
1131375129 15:91916798-91916820 TATACTTGGGGTCTACACATTGG + Intronic
1132770704 16:1561210-1561232 AATGCTCGTGGGGCACACATGGG + Intronic
1132837647 16:1962477-1962499 TCGGTAGGTGGTCCACACATGGG - Exonic
1134131419 16:11652869-11652891 TATGGTGGTGGTCCACCCCAGGG + Intergenic
1141285967 16:82672382-82672404 TAAGGTGGTGGTGCATACATGGG - Intronic
1147662770 17:42125821-42125843 TCTCCTGGAGGTCCACACCTCGG + Exonic
1150127812 17:62649669-62649691 TGAGCTGTTGCTCCACACATTGG - Intronic
1159497855 18:69229178-69229200 TATGCTGGTGTTCCACTGAAAGG + Intergenic
1162192477 19:8957837-8957859 TGAACTGGTGGTCCCCACATTGG + Exonic
1163156895 19:15444582-15444604 TATCCTGGTGGTTCTCAAATGGG - Intronic
1165410558 19:35658257-35658279 TATGCTGTTTGTCCAAACAGGGG - Intronic
1166803661 19:45472634-45472656 TGTGCTGGTGGCCCACAAACCGG + Exonic
1168298154 19:55387951-55387973 GTTGATGGTGGTCCGCACATAGG - Exonic
925456182 2:4018503-4018525 AATGCTGGTTGTCCAGACAAAGG - Intergenic
927687758 2:25183885-25183907 TCTGATGGTGATCCACACTTTGG + Intergenic
928308049 2:30187401-30187423 TAGGTAGGTGGTCCACGCATGGG + Intergenic
929865650 2:45715227-45715249 GATGCTCCTGGTCCACACAATGG + Intronic
931503658 2:62899635-62899657 TATGCTGGAGTTCCACACTGAGG + Intronic
933524286 2:83416230-83416252 TTTGCTGTTGGTGCACACATAGG - Intergenic
934528543 2:95069330-95069352 TATGCTTGTGGTCTAGAAATAGG - Intergenic
935468760 2:103431326-103431348 TATGAACGTGGACCACACATGGG + Intergenic
946705702 2:222456709-222456731 TAACCTGGTTGTCAACACATGGG + Intronic
947706957 2:232284078-232284100 AATGCTGGTGTTGCACACAGAGG - Intronic
1170045955 20:12085375-12085397 CAGGCTGGGGGTCCACACACAGG + Intergenic
1171138823 20:22723182-22723204 TCTGCTGGTGGGCCACCAATTGG - Intergenic
1175901993 20:62363609-62363631 TCTGCTGTTTGTCCACACAAAGG + Intronic
1178418079 21:32420059-32420081 TGAGCCGGTGGTGCACACATGGG - Intronic
953587013 3:44211054-44211076 TAAGCTGGTGGCCAACACACTGG - Intergenic
954513768 3:51152651-51152673 TATGCTGGTGATCTACAGATGGG + Intronic
956379589 3:68651612-68651634 TATACTGGTGGTCACCACATTGG - Intergenic
957910329 3:86612899-86612921 TATGCAGGTGGTCCTCAAAAAGG + Intergenic
962057430 3:131886838-131886860 TATGATGGGGGTACAAACATTGG - Intronic
964840773 3:160991171-160991193 TGGGCTGGTGGGCCACAGATTGG + Intronic
966943014 3:184758788-184758810 TATGCTGGAGGTTAACACAAAGG - Intergenic
968976509 4:3824883-3824905 TTTGCTGATGGTCCAGACGTGGG - Intergenic
971341225 4:25770830-25770852 GATGGTGGTGGTACACGCATTGG - Intronic
974986839 4:69037928-69037950 TATGATGGTTGGCCACACATAGG + Intronic
974992194 4:69106873-69106895 TATGATGGTTGGCCACACGTAGG + Intronic
988604180 5:32666102-32666124 CATGATGGTGGTCCCCATATGGG + Intergenic
988702369 5:33688176-33688198 TTTGCTTGTGGTTCATACATTGG - Intronic
992668123 5:79031544-79031566 TATGCTGTTGGTCCACACCTGGG + Intronic
993735929 5:91476963-91476985 TCTCCTGGAGGTCCACACCTTGG - Intergenic
993858879 5:93109543-93109565 CATGCAGGGGCTCCACACATAGG + Intergenic
996559046 5:124808987-124809009 GTTGATGGTGGTCCGCACATAGG + Intergenic
999290254 5:150420444-150420466 TATCTTTGTGGTCCACACTTTGG - Intergenic
1001337515 5:170811746-170811768 TATGCTGGTGACCTACAAATAGG + Intronic
1002849585 6:982025-982047 TATGCTGATGGACCATACAAAGG + Intergenic
1002994358 6:2268894-2268916 TGTGCTGGTAGTTCCCACATGGG - Intergenic
1003574747 6:7282463-7282485 GCTGCTTGTGGTCCACACAAGGG - Exonic
1008042771 6:46819376-46819398 TATGCTAATGGTCCAAAGATGGG - Intronic
1008045178 6:46844525-46844547 TGAGCTGGTGAGCCACACATGGG - Intergenic
1011288696 6:85752623-85752645 GATGTTGGTGATCTACACATGGG - Intergenic
1012428105 6:99136318-99136340 AATACAGGTGGTCCACAGATAGG - Intergenic
1012799138 6:103802831-103802853 GATGCTGGTGGCCTACAGATAGG - Intergenic
1015012931 6:128374353-128374375 TATGCTGGGGATACACACTTTGG - Intronic
1021755308 7:23845524-23845546 GATGTTGGTGGCCCACAGATGGG - Intergenic
1023281320 7:38573398-38573420 TATGCTTGTGTGCCACTCATAGG - Intronic
1030056969 7:105591655-105591677 TATGCTGGTGGTCCACACATAGG - Intronic
1030560767 7:111082634-111082656 CAGGCTTGTGGTTCACACATAGG + Intronic
1032325248 7:130921972-130921994 TTTGCTGATGGTTCAGACATCGG + Intergenic
1033556716 7:142494617-142494639 TATGCTGGTACACCACAAATTGG + Intergenic
1034713771 7:153220270-153220292 GATGCTGGTGGTCCACTTACAGG + Intergenic
1035938404 8:3868395-3868417 TGTGCAGATGGTCCACACAAGGG + Intronic
1037659179 8:20912458-20912480 GATGCTGGTGGTTCTCAGATTGG + Intergenic
1043662245 8:82758339-82758361 TCTTCTGGGGGTCCAGACATTGG - Intergenic
1046068798 8:109225587-109225609 AATGCTGGTGATTCAAACATAGG + Intergenic
1053652386 9:40182214-40182236 TGAGCTGGTGAGCCACACATGGG + Intergenic
1054532195 9:66194001-66194023 TGAGCTGGTGAGCCACACATGGG - Intergenic
1055392066 9:75833638-75833660 GAGGCTGGTGGTCCTCAAATTGG - Intergenic
1056215615 9:84403408-84403430 CATGCTGGTGGTAAATACATTGG + Intergenic
1056829862 9:89907070-89907092 GATGCTGGTGACCCACAGATGGG - Intergenic
1059718868 9:116939083-116939105 TTTGCTGGTGGGCCAGTCATGGG + Intronic
1060523709 9:124308864-124308886 TGGGCTGGTCGTCCACACACAGG - Intronic
1185827257 X:3263999-3264021 TATGCTGAACGCCCACACATTGG + Intergenic
1186757790 X:12691103-12691125 AAAGCTGGTGTCCCACACATTGG + Intronic
1191626518 X:63276510-63276532 TAAGCAGGTGGTCAACATATTGG - Intergenic
1191808636 X:65162917-65162939 GATGATGGTGATGCACACATGGG + Intergenic
1192557455 X:72101725-72101747 AATGCTGGTGTTCCACTCCTCGG - Intergenic
1192603411 X:72488374-72488396 AACTCTAGTGGTCCACACATTGG + Intronic
1196057519 X:111372069-111372091 AATGTTGCTGGTCCACACCTTGG + Intronic
1196143844 X:112295562-112295584 TCTGCTGGTAGCCCACACAAGGG + Intergenic
1198135704 X:133748177-133748199 TATGCATATAGTCCACACATAGG + Intronic
1201251627 Y:12064136-12064158 TATGCTGAATGCCCACACATTGG - Intergenic