ID: 1030057457

View in Genome Browser
Species Human (GRCh38)
Location 7:105596013-105596035
Sequence GGTTGAATCAGCATTTATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030057457_1030057462 -9 Left 1030057457 7:105596013-105596035 CCTCTATAAATGCTGATTCAACC 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1030057462 7:105596027-105596049 GATTCAACCGGATTATGGGGTGG 0: 1
1: 0
2: 0
3: 2
4: 36
1030057457_1030057465 4 Left 1030057457 7:105596013-105596035 CCTCTATAAATGCTGATTCAACC 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1030057465 7:105596040-105596062 TATGGGGTGGACCAGGCAACTGG No data
1030057457_1030057463 -3 Left 1030057457 7:105596013-105596035 CCTCTATAAATGCTGATTCAACC 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1030057463 7:105596033-105596055 ACCGGATTATGGGGTGGACCAGG 0: 1
1: 0
2: 0
3: 2
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030057457 Original CRISPR GGTTGAATCAGCATTTATAG AGG (reversed) Intronic
901869716 1:12130842-12130864 GATAGAATCAACATTTTTAGGGG + Intronic
902793732 1:18786633-18786655 TGTTCAATAAGCATTTATTGAGG - Intergenic
904307441 1:29599220-29599242 GGAACACTCAGCATTTATAGAGG + Intergenic
904396305 1:30224726-30224748 GGAAGACTCAGCATTTAGAGAGG - Intergenic
910266016 1:85338629-85338651 TGCTGAATCAGAATTTCTAGCGG + Intronic
921034737 1:211366070-211366092 AATAGAATCAGCATTTATTGAGG - Intronic
921884637 1:220293275-220293297 GGCCTAATCAGCATTTAGAGTGG - Intergenic
923396679 1:233572731-233572753 AATTTAATCAGCATTTAGAGGGG + Intergenic
924215397 1:241816140-241816162 AGCTGAATCAGCGTTTTTAGAGG - Intergenic
1073764506 10:106667005-106667027 GTTTGAATCAGAATTTAAATAGG + Intronic
1078215837 11:9311374-9311396 GGTTGGACCAGCAGTGATAGTGG - Intronic
1082092071 11:48098240-48098262 TGCTGAATCAGCATTTAATGGGG + Intronic
1091960488 12:4690103-4690125 GGCTGAGTCTCCATTTATAGGGG + Exonic
1092372545 12:7929171-7929193 GGATGAATCAGTATTTAAAAAGG + Intronic
1094041284 12:26123408-26123430 GGAGGAATCAGGATTTAAAGTGG - Intronic
1101425419 12:104584163-104584185 TGTTGAGTCATCATTTTTAGTGG + Intronic
1106024891 13:25947190-25947212 GGTCGAATTAGCATTTTCAGGGG + Intronic
1106871909 13:34030816-34030838 GGCAGAATCAGAATTTATAAAGG + Intergenic
1108477167 13:50831826-50831848 GGTTGAAGCAGAATTGATCGTGG + Intronic
1111793366 13:92886709-92886731 TGTTGAATCAGCATTTTCATGGG - Intergenic
1112803548 13:103137893-103137915 CATTGAAACAACATTTATAGAGG - Intergenic
1116785926 14:49288748-49288770 GGTTTACTCTGCATTTAGAGGGG - Intergenic
1122474627 14:101998404-101998426 AATTGGATCAGCATTTATAAAGG - Intronic
1126923170 15:53550572-53550594 GGTTGAATGAGTCTTTAAAGGGG - Intronic
1133732320 16:8588535-8588557 GGATGAATGAGCATTTGTGGAGG - Intronic
1136415706 16:30102267-30102289 GGTTGGATTGGCAATTATAGGGG - Intergenic
1137997787 16:53237800-53237822 CATTGAATCAGAATGTATAGGGG + Intronic
1138815550 16:60199299-60199321 AGTTGAATCAACATTTTCAGTGG + Intergenic
1140772461 16:78217340-78217362 GGTGGAAACAGCATGTATATAGG + Intronic
1143914383 17:10278053-10278075 GATTGAATTAGCATTTGTTGAGG + Intergenic
1146490563 17:33278517-33278539 TATTGAATCAGAATTTATAGGGG - Intronic
1146822958 17:35999283-35999305 GGTTTTATCAGCGTTTATGGTGG + Intronic
1151034786 17:70786024-70786046 GGTTAAATCAGCCTTTGTAAAGG - Intergenic
1155854049 18:30809927-30809949 AGTTTTATCAGCATTTATAAAGG - Intergenic
1156935251 18:42697461-42697483 GGTTGAAACAGCAGTAACAGTGG + Intergenic
1157184207 18:45524328-45524350 GATTGAACAAGCATTTATTGAGG - Intronic
1157261059 18:46175509-46175531 GGTTTAACAAGCATTTTTAGAGG + Intronic
1165524016 19:36337356-36337378 GGTTGAATCTGCACATATGGAGG - Exonic
1166011072 19:39943366-39943388 GGTTGGACCAGCAGTGATAGTGG - Intergenic
928071732 2:28223760-28223782 GGTTGAAACAGCATTTCTCAGGG + Intronic
930853126 2:55983293-55983315 GTGTGAATAAGCATTTATAAAGG + Intergenic
930974248 2:57436039-57436061 TGTTAAATCAGCATTTCTATAGG + Intergenic
931635730 2:64339307-64339329 GGTTGTAGCTGCATTTCTAGGGG + Intergenic
933477403 2:82808540-82808562 GGTTGAATGAACATTGATTGTGG - Intergenic
937202449 2:120213039-120213061 GGTCAAATCCGCATTCATAGAGG - Intergenic
937465544 2:122130493-122130515 TTTTGAATCTGCTTTTATAGGGG + Intergenic
938602218 2:132854039-132854061 AGTTCACTCAGCATTTATTGAGG + Intronic
940799979 2:158122851-158122873 GTTTGAATCAGCTTAAATAGAGG + Intronic
941351576 2:164443730-164443752 GATTCAATCAGCATTAATGGTGG + Intergenic
944741518 2:202617388-202617410 GGTCAAATCCGCATTCATAGGGG - Intergenic
944939145 2:204604428-204604450 TGTTAAAACAGCATTTAAAGGGG - Intronic
946693098 2:222324593-222324615 GATTCAATCAACATTTATTGAGG + Intergenic
1171178224 20:23071025-23071047 GATAGAATCAGCATTTATTGGGG - Intergenic
1171775274 20:29360979-29361001 TTTTGCATCAGCATTTATAAGGG - Intergenic
1171901071 20:30857393-30857415 TTTTGCATCAGCATTTATAAGGG + Intergenic
1173239385 20:41280330-41280352 AACTGAATCAGTATTTATAGAGG + Intronic
1180334435 22:11563343-11563365 TTTTGCATCAGCATTTATAAGGG + Intergenic
955901336 3:63759170-63759192 GGTAGAATCAGGATTTAAACTGG + Intergenic
957868362 3:86054247-86054269 GGTTCAATTATCATTTATAGTGG + Intronic
960549868 3:118963148-118963170 CCTTGAATCAGCATTTTAAGCGG - Intronic
960777552 3:121275498-121275520 TCTTGAATCAACATTCATAGTGG - Intronic
961114053 3:124313710-124313732 GGTTAAATCAGAATCTAGAGTGG - Intronic
962856172 3:139347087-139347109 GGTTTAAACAACATTTCTAGAGG + Intronic
963385068 3:144582045-144582067 GGTTGGATCACCAACTATAGTGG + Intergenic
963598786 3:147359521-147359543 GGTGGAATCAGCATCTGTACTGG - Intergenic
967197240 3:187039017-187039039 CATTGAATCAGCAGTTAAAGAGG - Intronic
969666259 4:8559057-8559079 GGCTGAACCAGCATTTCCAGGGG - Intronic
971131930 4:23820971-23820993 GGTAGAAATAGCATTTATATTGG - Intronic
972903877 4:43720801-43720823 AGTTGTATCAGGATGTATAGTGG + Intergenic
976151265 4:82094609-82094631 GTTAGAATCATCAATTATAGTGG + Intergenic
977491569 4:97719687-97719709 AGCTCAATAAGCATTTATAGAGG - Intronic
980750344 4:137079042-137079064 GTTTGTATCAGCATTTTTATAGG - Intergenic
982117031 4:152106399-152106421 AGCTGAATCAGCGTTTTTAGTGG + Intergenic
985084694 4:186300226-186300248 GGTTGAATAAGCATCTTTATAGG + Intergenic
985917150 5:2930817-2930839 CCTTTAATCAGCATCTATAGGGG - Intergenic
990810874 5:59721645-59721667 TGTTTAAACAGCATTTTTAGGGG - Intronic
996465219 5:123793624-123793646 GGCTGAAACAGTATTTAGAGGGG - Intergenic
1000517285 5:162253921-162253943 GGTAGAGTCAGAATTTATACTGG - Intergenic
1008768743 6:54952432-54952454 GTTTGACTTAGCATTTATGGAGG + Intergenic
1010086571 6:71925438-71925460 GTTTGAAACAGGAATTATAGAGG + Intronic
1010432572 6:75795504-75795526 GGTTTTATCAGGTTTTATAGAGG + Intronic
1011717695 6:90124049-90124071 GGCTGAGTCAGAATTTCTAGAGG + Intronic
1017150896 6:151279066-151279088 TGTTCAATAAGCAGTTATAGTGG + Intronic
1017380950 6:153828958-153828980 TATTGAATCAGAATTTCTAGTGG - Intergenic
1022893835 7:34728966-34728988 AGTTAAATTAGAATTTATAGTGG + Intronic
1025000336 7:55310632-55310654 GGTCAAATTAGCATTTATAAAGG + Intergenic
1025730851 7:64105869-64105891 GGTCAAATCTGCATTTGTAGGGG + Intronic
1026849255 7:73714820-73714842 GACTGAATCAGAATTTATAGGGG + Intronic
1030057457 7:105596013-105596035 GGTTGAATCAGCATTTATAGAGG - Intronic
1032855725 7:135832213-135832235 AGTTGAATCAGCATCTCCAGTGG + Intergenic
1037160388 8:15763897-15763919 AGTTAAATCAGCATTTAAAATGG - Intronic
1038102967 8:24400014-24400036 CGTTGAAAGAGCATTTAAAGTGG - Intronic
1039350301 8:36756865-36756887 GGAATAATCAGCTTTTATAGTGG - Intergenic
1044048508 8:87468953-87468975 GGCTGAAACATCATTTATAAAGG + Intronic
1044254142 8:90039903-90039925 GGTTGAATGAGCAATAATAATGG + Intronic
1044890366 8:96828589-96828611 GGTTCAAGCAGTATTTACAGAGG - Intronic
1045711551 8:104990443-104990465 GGCAGAATCAGCATTTGGAGGGG - Intronic
1047406809 8:124592268-124592290 GCTTGAATCAGCATTTACTGGGG + Intronic
1050904277 9:10984273-10984295 TGTGGACTCAGCATTTATAATGG - Intergenic
1052659986 9:31416408-31416430 GTGTGAATGAGGATTTATAGGGG + Intergenic
1052957088 9:34261366-34261388 TGTTAAATCAGCATTCATAATGG - Intronic
1058180617 9:101793630-101793652 GGTCGAATCCGCATTCATAGGGG + Intergenic
1058878520 9:109265916-109265938 GCTAGAAGCAGCATTCATAGAGG + Intronic
1186767844 X:12790200-12790222 GGTTGAATCAGCCTTTGTTGAGG + Intergenic
1188609101 X:32073774-32073796 GTTTAAATCAGAATTTATATAGG - Intronic
1188637118 X:32447722-32447744 GGCAGCATCAGCATTTGTAGTGG + Intronic
1193230227 X:79035658-79035680 GGTTGATTCCCCATTTATAAGGG + Intergenic
1195070894 X:101278225-101278247 GGTTGGATCAGAATTTAAAGAGG - Intronic
1196393193 X:115231564-115231586 AGTTGAATGAGCATTTCTTGTGG - Intronic
1196963054 X:121025006-121025028 GGTAGATTCTGCATTCATAGAGG + Intergenic
1199771830 X:150980105-150980127 GGTGGAATCACCTTTGATAGAGG + Intergenic
1201069742 Y:10135366-10135388 TTTTGCATCAGCATTTATAAGGG + Intergenic
1201404734 Y:13638208-13638230 TGTTGGATTAACATTTATAGGGG - Intergenic
1201758009 Y:17509937-17509959 TTTTGAATCAGCATTTGTAAGGG - Intergenic
1201843546 Y:18396045-18396067 TTTTGAATCAGCATTTGTAAGGG + Intergenic