ID: 1030057626

View in Genome Browser
Species Human (GRCh38)
Location 7:105597298-105597320
Sequence CCCAGGGAACAGAAGGGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 299}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030057626 Original CRISPR CCCAGGGAACAGAAGGGCAT GGG (reversed) Intronic
900212316 1:1462200-1462222 CCCAGGGAAGGGGAGGGCATAGG - Intronic
900224986 1:1528819-1528841 CCCAGGGAAGGGGAGGGCATAGG - Intronic
900625709 1:3607694-3607716 CGCAAGGAACAGAAAGGCCTGGG - Intronic
901647938 1:10726741-10726763 CCCAGGGACCAGAGCGGCCTTGG - Intronic
901876389 1:12169157-12169179 CAAAGGGAACAAAAGGGCCTGGG - Intronic
901924859 1:12559795-12559817 CCCAGGGGAAAGATGGGCAGGGG + Intergenic
902118259 1:14139685-14139707 CCCAGTGCCCAGCAGGGCATGGG + Intergenic
902563671 1:17295629-17295651 CCCAGGGAGCACAGGTGCATGGG + Intergenic
902589017 1:17460309-17460331 CACAGCGAAGGGAAGGGCATAGG - Intergenic
902838972 1:19063460-19063482 CCCAGGGAACAAGAGGACATTGG - Intergenic
904031372 1:27535600-27535622 TCTAAGGAACAGAATGGCATTGG - Intronic
904366696 1:30015592-30015614 ACCTGGGAAGAGAAGGGCAGTGG + Intergenic
904774715 1:32899775-32899797 CCCAGGGAGCAGGAAGGGATGGG + Intronic
905626964 1:39495583-39495605 CCCAGGGAAGGGAAGGGCCGTGG - Intronic
905669972 1:39785188-39785210 CCCAGGGAAGGGAAGGGCCGTGG + Intronic
906221832 1:44086568-44086590 CCCAGGAAACAAAAAGGCAAAGG - Intergenic
907612728 1:55888872-55888894 CCCAGGGATCTCAAGGACATAGG - Intergenic
907976530 1:59436279-59436301 CCCATGAAACAGAAGGGCAGAGG - Intronic
908146617 1:61252938-61252960 CCAAGGGAAAAAAAGGGAATTGG + Intronic
908826521 1:68137916-68137938 CGCAGGTAACGGAAGGCCATTGG - Exonic
911907585 1:103589418-103589440 CCCCGAGAACAGAACAGCATGGG + Intergenic
912033118 1:105274655-105274677 CCCTGGGAACATAAGTCCATTGG - Intergenic
914674701 1:149899697-149899719 CACAGGGAACACAGGGGCTTCGG + Intronic
915162351 1:153929479-153929501 CCCAGGGAACAGGAGGCCGAAGG + Exonic
915645792 1:157271024-157271046 CCCAAGGAGCAGAAGGTCTTTGG - Intergenic
916434827 1:164768366-164768388 CCCAGGACACAGAGGGGCACAGG + Intronic
917724094 1:177813128-177813150 CCCCGGTAACAGAAGGACTTTGG + Intergenic
920222975 1:204417662-204417684 GCCAGGGAGTAGAAGGGCAAGGG - Intergenic
920661997 1:207923060-207923082 CCTAGGGAAGAGAAAGTCATCGG + Intergenic
922548985 1:226480129-226480151 ACCAGGAATCAGAATGGCATTGG - Intergenic
923906771 1:238393840-238393862 CACAGGGAACAGCAGGGAAATGG + Intergenic
1065928114 10:30454146-30454168 TCCAGCAAAGAGAAGGGCATGGG - Intronic
1066012944 10:31210920-31210942 CCCAGGGAGCAGCAGGGGATGGG - Intergenic
1067289381 10:44930111-44930133 CCCAGAGACCACATGGGCATAGG - Intronic
1068218913 10:54018146-54018168 CCTAAGGAAAAGAAGGTCATAGG - Intronic
1069659043 10:70111473-70111495 CCCAGGGACCAAAATGACATCGG + Intronic
1069849891 10:71397713-71397735 CCCAGGGCTCAGAAGGGGAGGGG - Intronic
1070387066 10:75935195-75935217 CCCAAGAAAGAGAAGGGCAAGGG + Intronic
1070480282 10:76875523-76875545 CACAGGGAAGAGAGGGTCATGGG + Intronic
1070599231 10:77854156-77854178 TCCAGAGAAAAGAAGGGCAAAGG + Intronic
1070666873 10:78351209-78351231 TCCGGGCAACAGAATGGCATAGG - Intergenic
1073323090 10:102627577-102627599 GCCAGGGAACAGCAGGGGCTGGG - Intronic
1073477601 10:103764437-103764459 ACCAGGAAAAAGAAGGGCACAGG + Intronic
1074472018 10:113735850-113735872 CCCAGGGGCCAGCAGCGCATTGG + Intergenic
1075101349 10:119508376-119508398 TCCATGGAAGAGAAGGGCATGGG - Intronic
1076296320 10:129387540-129387562 CACAGAGGACAGAGGGGCATGGG + Intergenic
1077887307 11:6395473-6395495 CCCAGGGAACTAAAGGGTGTGGG - Exonic
1077958655 11:7049075-7049097 GACAGTGAACAGAAGGGCATTGG + Intronic
1078362939 11:10683638-10683660 CCAAGGGACCAGTAGGGGATGGG + Intronic
1079100084 11:17535679-17535701 CCATGGGAACAGAAGGGGAAGGG + Intronic
1080682082 11:34486524-34486546 CAGAGTGAATAGAAGGGCATGGG + Intronic
1080861930 11:36157513-36157535 CCCAGAGAACAGATGAACATTGG + Intronic
1081371750 11:42312827-42312849 CCCACCGACCAGAAGGCCATGGG - Intergenic
1082600104 11:55138633-55138655 CAAAGGGAACACAAGGGCAGAGG + Intergenic
1082790881 11:57346099-57346121 CCCAGGAGACAGAAGGACAGAGG - Intronic
1082968187 11:58989876-58989898 CCCAGGAAGCAGAAGGGGTTGGG - Intronic
1083617415 11:64033234-64033256 ACCAGGGACCAGAAGTGAATCGG - Intronic
1083772678 11:64877359-64877381 CTCAGTGCACAGAAGGGCTTAGG + Intronic
1084697333 11:70763490-70763512 CTCAGAGCACAGAAGGGCATGGG - Intronic
1085173294 11:74466703-74466725 CCCATGGGACAGAAGGGGAAAGG - Intronic
1086333500 11:85777221-85777243 CCAAGGGAAAAGTAGGGCTTGGG - Intronic
1086375260 11:86193805-86193827 CTCAGGGAACAGAAAGGCCTGGG - Intergenic
1088387494 11:109275693-109275715 CCCAGGGAACATAACTCCATTGG - Intergenic
1088440794 11:109867811-109867833 CCAAGGGGACAGAAGTCCATTGG - Intergenic
1088887289 11:114017846-114017868 CAGAGGTAAGAGAAGGGCATAGG - Intergenic
1091230009 11:133982163-133982185 CCCAGGTATCAGCAGGGGATGGG + Intergenic
1092903788 12:13084184-13084206 CCCAGTGAACAAGGGGGCATAGG - Intronic
1094387182 12:29907630-29907652 GCCAGGGAACAGAAGGCTCTGGG + Intergenic
1095970997 12:47901945-47901967 CCCAGGGAAAAGACGAGAATTGG + Intronic
1096008384 12:48191132-48191154 CCCAGAGAATAGAAATGCATGGG - Intergenic
1097200156 12:57271408-57271430 TCCAGGGAGCAGAAGGGAAAAGG - Intronic
1097898874 12:64853751-64853773 CCCAGGAAACACAAGGGGTTGGG - Intronic
1098405525 12:70122470-70122492 CTGAGGGAAAAGAAGGGCATTGG - Intergenic
1100173801 12:92007067-92007089 CTCAGGGAAAGGAAGAGCATGGG + Intronic
1100456915 12:94760561-94760583 CTCAGTGACCAGAAGGGCATTGG - Intergenic
1100476069 12:94936447-94936469 CCCAGGAAAAAGAAGGGCATGGG + Intronic
1102063114 12:109950170-109950192 CCTAGTAAACAGAGGGGCATGGG + Intronic
1102464287 12:113119442-113119464 CCCTGGGAACAGATGGGGAAAGG + Exonic
1102576981 12:113861854-113861876 CCCAGGCAGCTGAAGGGCCTTGG + Intronic
1103558073 12:121777892-121777914 CCCAGGGTACGGCAGGGCCTTGG + Exonic
1103776385 12:123369633-123369655 CCCAGAAAACAGCAGGGCAAAGG + Intergenic
1104380133 12:128300150-128300172 CCCAGGGAACAAAAAGTCACTGG - Intronic
1104472032 12:129037000-129037022 CCCAGGGAGAAGAGGGCCATGGG + Intergenic
1104760341 12:131294212-131294234 CCCAGGACACAGAAGGGACTGGG + Intergenic
1104819426 12:131666435-131666457 CCCAGGACACAGAAGGGACTGGG - Intergenic
1105001120 12:132689394-132689416 CACAGGGAACAGCAGGGCAAAGG + Intronic
1106084810 13:26531888-26531910 CGAAGGGAACAGAGGGCCATTGG + Intergenic
1106099439 13:26681785-26681807 CTCAGGGAACAGGAGGGCCTGGG - Intronic
1107482312 13:40795040-40795062 CCCAGGGAACGGAAGGCCAGTGG + Intronic
1109378250 13:61525180-61525202 CCCAGAGAACTGAAAGGCAGGGG - Intergenic
1109816194 13:67588523-67588545 CCCAGGAAGCAGAAGGGGTTGGG + Intergenic
1112595824 13:100806045-100806067 CCGAGGGAAGAGAAAGGCAGAGG - Intergenic
1113534965 13:111058790-111058812 CCCTGGGAACAAAACTGCATTGG - Intergenic
1114353982 14:21887185-21887207 ACCAGGGAATAGAGGGGCTTGGG - Intergenic
1114482460 14:23044258-23044280 GCCAGGGGACAGCAGGGCAGTGG - Exonic
1117339917 14:54784107-54784129 CCCAGGGAACAGCGGTGCAAAGG + Intronic
1119029766 14:71182877-71182899 ACCAGGGAACTGAAGGTCAAAGG + Intergenic
1119542665 14:75450991-75451013 CCAAGGGGACAGCAGGGCAAAGG + Intronic
1119711827 14:76828058-76828080 TCCAGGGAGCAGAAGGGAGTTGG + Intronic
1119860729 14:77934087-77934109 TCTAGGGAACAGAAGGCCAGGGG + Intronic
1119953796 14:78773353-78773375 CCCTTGGAAAAGAAGGGCAAGGG - Intronic
1120736363 14:88057513-88057535 CCCAGGGAACATAACTCCATTGG - Intergenic
1121600639 14:95200456-95200478 GCCAGGGAGGAGAAGGGCCTGGG - Intronic
1121786901 14:96668784-96668806 GTCAGGGACGAGAAGGGCATTGG + Intergenic
1122307071 14:100773030-100773052 CCCAGGGAGGAGAAGGGGAGAGG + Intergenic
1122947690 14:105020760-105020782 CCCGGGGAACAGAGGGGCCCGGG - Intronic
1124086046 15:26551574-26551596 CACAGGGGACAGGAGTGCATGGG - Intronic
1124397164 15:29312724-29312746 CTCAGGGAACAGATAGGCAGGGG - Intronic
1125766940 15:42142381-42142403 CCCAGGGAGCAGAGGGCCACAGG + Intronic
1126190244 15:45871402-45871424 CCCAGGGAACAGAACTCCATTGG + Intergenic
1126793886 15:52244231-52244253 CCCAGGGTGCAGACGTGCATGGG - Intronic
1126910551 15:53412885-53412907 GCCTGGGAACAGAAAGGCAAAGG - Intergenic
1127836887 15:62797398-62797420 CCCAGGTACCAGCAGGGCCTGGG + Exonic
1129492443 15:75941744-75941766 CACAGGGAGCAGGAGGGAATGGG + Exonic
1129910446 15:79221887-79221909 CCCAAGACACAGAAGGGCACGGG - Intergenic
1129948471 15:79562868-79562890 CCCAGGGAACATAAGGGACCTGG - Intergenic
1130867382 15:87944352-87944374 CCGAGGAAACAGTAGGGCAAAGG + Intronic
1131495930 15:92910714-92910736 CTGAAGGAACAGAACGGCATGGG - Intronic
1132114104 15:99123498-99123520 ACCAGGGAACAGAAGGGAGGGGG - Intronic
1132196025 15:99915459-99915481 CCCAGGGAATAGCAGGACATTGG + Intergenic
1132283454 15:100641198-100641220 CCAAGGGAAGAGAAGGGCAGTGG - Intronic
1132465892 16:77360-77382 CCCAGTGGACGGAAGGGCCTAGG - Intronic
1132519531 16:381078-381100 CTCAGGGAACAGAAATGCAAAGG + Intronic
1132578888 16:676195-676217 CCCAGGGAACAGACAGGCACGGG + Intronic
1135196283 16:20397780-20397802 TCCAGGGAAGAGCAGGGCAGGGG - Intronic
1135486674 16:22871727-22871749 CCCTGTGGATAGAAGGGCATTGG - Intronic
1136186024 16:28589452-28589474 CCAGGGCAACAGATGGGCATGGG - Intronic
1139243606 16:65419418-65419440 CCCAAGGAGAAGAAGGGGATTGG + Intergenic
1139365396 16:66429391-66429413 CCCAGAGCAGAGCAGGGCATAGG + Intronic
1139464518 16:67147143-67147165 TCCACGGGACAGAGGGGCATGGG - Exonic
1139664120 16:68444291-68444313 CCCAGGGAGCAGGAGGGTCTTGG + Intronic
1141791805 16:86241987-86242009 CCCAGGGCACGGGAGTGCATTGG + Intergenic
1203142902 16_KI270728v1_random:1780530-1780552 CCCTGGGATCAGAAGGCCAAGGG - Intergenic
1143012854 17:3875799-3875821 ACCAGAGAACAGAAGGGCTCAGG - Intronic
1144780115 17:17803860-17803882 GCCCAGGAACAGGAGGGCATTGG + Intronic
1145058278 17:19717044-19717066 CCCAGGGAAAAGCAGGGCTGAGG - Intronic
1146721878 17:35129664-35129686 CCCTGGGAAAAGAGGGGCCTTGG + Intronic
1147654686 17:42082146-42082168 GCCATGGAACAGGATGGCATAGG - Intergenic
1147656897 17:42096266-42096288 CCCAGGGAAGAGGCTGGCATGGG + Intergenic
1147746695 17:42699109-42699131 AACAGGGATGAGAAGGGCATTGG - Exonic
1148152603 17:45405329-45405351 CCCAGGGACCAGAAGGTGAGGGG - Intronic
1148687083 17:49507029-49507051 CCCAGGGCACAGAACGGGAGAGG + Intronic
1149588633 17:57811013-57811035 CCCAGGGAACCGAAGGCCCCCGG - Intergenic
1150006046 17:61469641-61469663 CCCTGGGTACAGAAAGGCAGTGG - Intronic
1151823731 17:76512150-76512172 CCCAGGGAACAGAAAGCCCAGGG - Intergenic
1152137291 17:78512027-78512049 CCTAGGGAGCAGAAGGGCCCTGG + Intronic
1155830238 18:30507756-30507778 CCCAAGGAACAGAATAGGATGGG + Intergenic
1156254720 18:35384000-35384022 CCCAAGGAAAAGAAGGCCAAGGG - Intergenic
1157430602 18:47621355-47621377 CCCAGAGAGCTGGAGGGCATGGG + Intergenic
1158373098 18:56831716-56831738 CCCAGGAAACACAAGGGGTTGGG + Intronic
1161126629 19:2561441-2561463 TCCTGGGCACAGAAGGGCAGTGG - Intronic
1161847389 19:6719541-6719563 CCCAGAGAAGATAATGGCATTGG - Intronic
1162461986 19:10818758-10818780 CCCAGGGAGAAGAAGGGCCAGGG + Intronic
1162525216 19:11202811-11202833 CCCCGAGAACATCAGGGCATGGG + Intronic
1163534345 19:17868624-17868646 CCCAGGGAACCAAGGGGCAGGGG + Intergenic
1163559589 19:18010754-18010776 CCCAGGGCCCAGAGAGGCATGGG - Intronic
1166096292 19:40541474-40541496 CCCAGGGGACAGCAGGGCCTTGG - Intronic
1167267083 19:48488593-48488615 CTCAAGGAACAGAAGGACACTGG - Intronic
1168347596 19:55658635-55658657 CCAGGGGAAGAGAAGGGCCTCGG - Intronic
1168356748 19:55704849-55704871 CCCAGGGAACAGAAATGAAGTGG - Intronic
925182180 2:1824473-1824495 CACAGGGAGGAGAGGGGCATGGG + Intronic
925438676 2:3865178-3865200 CCCAGGGGTCAGCAGAGCATTGG - Intergenic
925683046 2:6443526-6443548 TCCAGGGAAGAGAATGGGATAGG + Intergenic
926039804 2:9664061-9664083 CCCAGGGAACAGAGTGGGAGTGG - Intergenic
927216015 2:20668105-20668127 CCCAGGGAAAACTAGGGCAGAGG + Intronic
927428288 2:23005244-23005266 CCCAGGGAACAGTTGGCTATGGG + Intergenic
929336537 2:40754204-40754226 CTTAGGGAACAAAAGGGAATGGG - Intergenic
930010363 2:46933220-46933242 CCCGAGGAACAGAAGGGACTGGG + Intronic
932111596 2:69006669-69006691 ACCAGGGCACAGAAGGGCTTGGG - Intergenic
932590553 2:73064123-73064145 CCCAGGGAAGAGCAGGCCTTGGG + Intronic
935261862 2:101362674-101362696 CCCTGGGAGCTGAAGGACATGGG + Intronic
936009587 2:108916917-108916939 CCCAAGGAGCAGGAGGACATGGG + Intronic
936438450 2:112529071-112529093 CCCCGGGAACGGCAGGGCACTGG + Exonic
936857694 2:116980118-116980140 CCCTGGGAACATAAGTCCATTGG + Intergenic
938194364 2:129314048-129314070 CCCAGGGGACAGAGGAACATTGG + Intergenic
940877490 2:158912609-158912631 ACCAGGGAATAGAATGGCACAGG - Intergenic
942467793 2:176226912-176226934 ACCAAGGAAGAGAATGGCATGGG - Intergenic
942717724 2:178913035-178913057 GCCAGGGAACAGAGGTGCACTGG - Intronic
943558184 2:189430399-189430421 CCCAGGAAACACAAGGGGTTGGG + Intergenic
944999200 2:205330475-205330497 CCCAGAAGACAGCAGGGCATAGG + Intronic
945169414 2:206980257-206980279 GCCAGGGAACAGAAGAGAAGTGG + Intergenic
946162067 2:217841376-217841398 CACAGGGAACAGATGGACATGGG + Intronic
946412288 2:219521429-219521451 CCCAAGAAGCAGAAGGGCAGGGG - Intronic
947222616 2:227808157-227808179 TCCAGGGAAGGGAAGGGGATTGG - Intergenic
947593458 2:231397286-231397308 CGCAGGGAAATGAAAGGCATTGG + Intronic
947766736 2:232642720-232642742 CCTCGGGAACAGAACAGCATCGG - Intronic
948121962 2:235537324-235537346 CCCAAGGAAGAGAAAGGCAGAGG + Intronic
948213269 2:236210608-236210630 CACAGGAAACAGAAGGCCTTTGG + Intronic
948565239 2:238882172-238882194 CCCAGGGAAAAGAAGGCAAGTGG - Intronic
1169084467 20:2818189-2818211 CTCAGGCACCAGAAGGGCTTTGG + Intronic
1169144072 20:3241023-3241045 CCGAGGGAACAGAACCGCAGGGG - Intergenic
1170368796 20:15625955-15625977 CCCAGGGAACAGAAAATCCTGGG + Intronic
1171245274 20:23605888-23605910 GCCAGGGATCTGAAGGGCAAAGG - Intergenic
1172978283 20:38922457-38922479 CCCAGGGCACATAAGAGCAAAGG + Exonic
1173842303 20:46165884-46165906 CATAGGGAGCAGAAGGGCAGTGG - Intergenic
1173954389 20:47019280-47019302 CCCAGATGACAGAAGGGCAGCGG + Intronic
1174363473 20:50042721-50042743 CCCAGGGGGCAGAAGAGCCTGGG - Intergenic
1174505513 20:51015175-51015197 CCCAGAGAACAGGAGGGATTTGG + Intronic
1175641408 20:60633585-60633607 CCCAGAGGCCAGCAGGGCATGGG + Intergenic
1176216752 20:63951684-63951706 CCCAGGGCTCAGCAGGGCACAGG + Intronic
1176216766 20:63951726-63951748 CCCAGGGCTCAGCAGGGCACAGG + Intronic
1176216780 20:63951768-63951790 CCCAGGGCTCAGCAGGGCACAGG + Intronic
1177578881 21:22994126-22994148 CCCAGGGAACATAACTCCATTGG + Intergenic
1178581429 21:33841672-33841694 CCCAGGTAACAGTTGGGCAACGG + Intronic
1178738595 21:35175766-35175788 CCAAGGGAAAAGAAGGGCTGAGG - Intronic
1178990098 21:37346161-37346183 CCCAGGGAACAGAAAAGGATAGG - Intergenic
1179566735 21:42253596-42253618 CCTAGGAAACAGAGTGGCATGGG - Intronic
1179917330 21:44485885-44485907 CCCAGGATACAGAAAGGCCTCGG + Intergenic
1180017394 21:45096295-45096317 CACAGGGAACAGAAGCGCAAGGG + Intronic
1182415895 22:30221261-30221283 CCCAGGAAACAGAAGTGCCTGGG + Intergenic
1183062819 22:35346261-35346283 CCCAGGGAGCAGAAGGGGCAGGG + Intronic
1183280116 22:36927514-36927536 CTGGGGGATCAGAAGGGCATGGG + Intronic
1183623188 22:38986686-38986708 CCCATGTCACAGAAGGGCAGCGG - Intronic
1184154400 22:42657743-42657765 CCCAGGGAACAGGGGGGCAGAGG - Intergenic
1184194033 22:42914635-42914657 CTCAGGGAATAGCAGGGCTTTGG + Intronic
1184406692 22:44304565-44304587 CCCAGGGACGAGCAGGGCAGTGG - Intronic
1184454052 22:44599181-44599203 CCCAGGGAACAGCAAGTCCTGGG + Intergenic
1184466599 22:44672168-44672190 GGCAGGGGACAGAAGGGCACAGG - Intronic
1185147480 22:49147159-49147181 CCCATGGAACAGACGGGCGCAGG + Intergenic
950649412 3:14397848-14397870 CCCAGGTTGCAGAAGGGCAATGG + Intergenic
951441144 3:22725581-22725603 ACAAGGGAAAAGAAAGGCATAGG - Intergenic
951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG + Intronic
953569030 3:44057133-44057155 CACAGGAAACAGAAGGACCTCGG - Intergenic
954127901 3:48542976-48542998 CCCAGGAGAGAGAAGGGCAATGG + Intronic
954593227 3:51802021-51802043 CCCTTGGAACAGAAGAGGATGGG + Intergenic
956210314 3:66795669-66795691 CCCAGGGCAGGGCAGGGCATCGG - Intergenic
959099611 3:101995615-101995637 CCCAGATACTAGAAGGGCATGGG - Intergenic
959862927 3:111236049-111236071 CTCAGGGAGCCTAAGGGCATAGG - Intronic
960666031 3:120109601-120109623 CCCAGAAAACAGTATGGCATGGG + Intergenic
960874197 3:122280587-122280609 CCCAGGGAAGGGAAGGGGAGGGG - Intronic
961858886 3:129898198-129898220 ACCAAGGAACAGAATGGCATTGG - Intergenic
961919748 3:130413540-130413562 CCCAGGGAAGAGAAGGTCAAAGG + Exonic
962372666 3:134833784-134833806 ACCAGCCAACAGAAGGGCAGAGG + Intronic
963077227 3:141358313-141358335 CCCAGGGAACAAAGGAGCAAAGG + Intronic
964024705 3:152058324-152058346 CAGTGGGAACAGAAGGGCAAGGG - Intergenic
964478597 3:157120215-157120237 CCCAGAGACCAGAGGGGCCTTGG - Intergenic
965720675 3:171657976-171657998 CCCAGTGAACAAATGGGCAAGGG + Intronic
967772214 3:193346369-193346391 CACAGGGGACAGAAAGGCAGAGG + Intronic
968691581 4:1992897-1992919 CCCAAGGAACAGAAGGGGCTGGG - Intronic
968922028 4:3527272-3527294 TCCAGGGCACAGAGGGGCACGGG - Intronic
971463768 4:26931689-26931711 CAAAGGGAAGGGAAGGGCATAGG + Intronic
973969994 4:56203902-56203924 CCCAGGGATTAGAAGGCCAGTGG - Intronic
975203237 4:71615970-71615992 CCCAGGAAGCACAAGGGGATGGG + Intergenic
977518209 4:98048501-98048523 CCCAGGGAACAAGAGAGCACAGG - Intronic
978924915 4:114231564-114231586 CCCTGGGAACAGAACTTCATTGG + Intergenic
979160043 4:117448360-117448382 CCCTGGGAACAGAACTCCATTGG - Intergenic
979670309 4:123354394-123354416 CCTAGGTAACAGCAGTGCATAGG + Intergenic
981933219 4:150211813-150211835 CAGAGGGAACAGAAGATCATAGG - Intronic
982451033 4:155552481-155552503 CCCTGGGAACATAACTGCATTGG + Intergenic
982866657 4:160521731-160521753 GCAAGGGAACAGAGAGGCATTGG - Intergenic
983677780 4:170316590-170316612 CCCAGGGAACACAAGGGGTCAGG + Intergenic
984603518 4:181756816-181756838 CCCAGGGCACAGAAGGAGCTAGG - Intergenic
985867310 5:2524087-2524109 CCCAGTGAACACAGGGGCAAGGG + Intergenic
986615345 5:9611796-9611818 CACAGAGAACAGAAGGTAATAGG + Intergenic
987038524 5:14040655-14040677 CCCAGGGAACAGAGGGCACTTGG + Intergenic
988624890 5:32863705-32863727 CCCAGAGAAAAGAAATGCATTGG + Intergenic
995440873 5:112190909-112190931 CCCAGGAAACAGAAAGGAACTGG + Intronic
996879635 5:128281307-128281329 CATAGGGAAAAGGAGGGCATAGG - Intronic
998359344 5:141571838-141571860 CCCAGGGAAGGGAAGGGAATAGG + Intronic
999981896 5:156965828-156965850 ACCAGGAAACAGAAAGTCATGGG + Intergenic
1000195165 5:158950123-158950145 GCCAGGAAATAGAAGAGCATGGG - Intronic
1001042833 5:168349103-168349125 CACAGGGAACAGAAGGGACTCGG - Intronic
1001731096 5:173959303-173959325 CGCAGGGACCAGAAGGGGAAAGG - Exonic
1002021775 5:176368225-176368247 CCAAGGGAAAAGAAGGGGATGGG + Intronic
1003829598 6:9993396-9993418 CCGAGAGAACATAAGGGCAGGGG + Intronic
1005218885 6:23563437-23563459 CACAGGGAACAGAAGGTAAGAGG - Intergenic
1005993640 6:30918954-30918976 CCAAGAGAAGAGAAGGCCATTGG - Intronic
1006626517 6:35401828-35401850 GGCAGGGACCAGAAGGGCAGAGG + Intronic
1007249006 6:40482962-40482984 CCAAGGGAACAGAGGGACAGTGG - Intronic
1007538243 6:42615488-42615510 CCCAGGCAACAGGAGTGCAGTGG + Intronic
1007658236 6:43465881-43465903 CCCAGGGGAAAGATGGGCCTGGG - Intergenic
1008055314 6:46939365-46939387 CACAGGAAACAGGAGGGCACTGG + Intronic
1009332493 6:62441248-62441270 CCCTGGGAACATAAGTCCATTGG - Intergenic
1013460114 6:110366655-110366677 CCCAGAGAACAGAAGGCCAGGGG + Intergenic
1018398304 6:163398459-163398481 CCCAGGGAACTGGAGGTAATGGG + Intergenic
1018528656 6:164740674-164740696 CCCAAGGCAGAGAAGGTCATCGG + Intergenic
1019138159 6:169925058-169925080 CCCAGGCAGCAGAAGTGCTTTGG + Intergenic
1019700818 7:2474417-2474439 CCCAGGGGACTGAAAGGCAGGGG - Intergenic
1020138393 7:5599073-5599095 CCCAGGGAACACGAGGGCTGGGG - Intronic
1022523553 7:31023009-31023031 CCCAGTGACCAGGAGGTCATGGG + Intergenic
1023013444 7:35943044-35943066 TTCAGGGAACAGATGGGCTTTGG + Intergenic
1024352690 7:48382916-48382938 TCCGGAGAACAGAAGGGCAAGGG + Intronic
1026564283 7:71476939-71476961 CCCAGGGACCAGAGAGGCAGTGG + Intronic
1026969876 7:74461288-74461310 CACAGGGAACAGGAGGGGAAAGG - Intronic
1028139258 7:87254706-87254728 CCCAGGGAACAGCATGGAAAGGG - Intergenic
1029607598 7:101608581-101608603 CCCAGGGAAAAGAAAAGCAGGGG - Intergenic
1030057626 7:105597298-105597320 CCCAGGGAACAGAAGGGCATGGG - Intronic
1030085495 7:105811995-105812017 CCCAGAAAACAGAAGGGAAAGGG - Intronic
1033357707 7:140613899-140613921 CCATGGGAAAAGAAGGGAATGGG - Intronic
1033598053 7:142870535-142870557 CACAGGGGTCAGAAGGGCCTGGG - Exonic
1035263481 7:157675862-157675884 CCCAGGGAATGGAAGGGCAATGG + Intronic
1035652774 8:1281454-1281476 CCCAGGGGACAGAAGGGCTGGGG - Intergenic
1036748626 8:11428758-11428780 CCCAGGGAGCAGCCGAGCATGGG - Intronic
1037444507 8:18951429-18951451 ACCACGGAACAGCAGGGCAGTGG + Intronic
1037766033 8:21772840-21772862 TCCAGGGAGCAGAAGGGGCTTGG + Intronic
1038157472 8:25003642-25003664 CCTAGGGAACAAAAGGGAGTGGG + Intergenic
1038481796 8:27907085-27907107 CCCAGGCAGCACATGGGCATTGG - Intronic
1043323956 8:79026515-79026537 CCCAGGACACAGAATAGCATGGG + Intergenic
1043405464 8:79927952-79927974 ACCAGGGAGCAGAAGGGGAAAGG + Intronic
1045599242 8:103694157-103694179 CTCAGGGACCAGCATGGCATTGG + Intronic
1046319679 8:112556787-112556809 GACAGGGGAGAGAAGGGCATGGG - Exonic
1046686384 8:117232179-117232201 CCCAGGCAACAGATGGACTTCGG + Intergenic
1048282290 8:133114347-133114369 CCCTGGGGACAGCAGGGCCTGGG - Intronic
1048387384 8:133924865-133924887 CTCAGGACACAGAAGTGCATAGG - Intergenic
1048773541 8:137920643-137920665 CGTAGAGAACAAAAGGGCATTGG + Intergenic
1049586092 8:143432994-143433016 CCCAGGGAACAGCGGAGCACAGG - Intergenic
1049983232 9:923979-924001 GCCAGTGAATGGAAGGGCATTGG + Intronic
1050592393 9:7173913-7173935 CCCAGGGAACAGGAGTGGAGAGG + Intergenic
1052006665 9:23357663-23357685 CCCAGGGAACATAACTCCATTGG - Intergenic
1052345064 9:27401109-27401131 GCCAGGGAACTGAAGAGCAGGGG + Intronic
1053644114 9:40111152-40111174 CCCACGGAGAAGCAGGGCATGGG + Intergenic
1054820388 9:69515930-69515952 CCAAGGGCACACAAGGCCATGGG + Intronic
1054904194 9:70400444-70400466 CCCAGGGAAAGGAAAGGCAAGGG + Intronic
1058262954 9:102859409-102859431 CCAAAGGAACTGAAGGGCTTAGG - Intergenic
1059014271 9:110497208-110497230 CCCAGGTAAAAGAAAGGCAATGG - Intronic
1059428417 9:114235689-114235711 CCAGGGGAACAGCAGGGCAGGGG - Intronic
1060147432 9:121265055-121265077 CCCATGGAACACTAGGGCAGGGG - Intronic
1060194835 9:121616900-121616922 CCCAGGGGACAGCAGTGCCTGGG - Intronic
1060962614 9:127691686-127691708 GCCTGGGGACAGAAGGGCCTGGG - Exonic
1061207258 9:129171960-129171982 CCCAGGGAAAACAAAAGCATTGG - Intergenic
1061406789 9:130396728-130396750 CCCAGGGCACAGAATGCCATTGG + Intronic
1061965395 9:134011024-134011046 ACCAGGGCTCAGAAGGGCAGTGG + Intergenic
1062032974 9:134370380-134370402 CACAGGGACCAGAAAGGCCTTGG - Intronic
1062065611 9:134524709-134524731 CCCAGGGGATGGGAGGGCATGGG - Intergenic
1187213792 X:17254919-17254941 CTCTGGGAACAGAAGGGACTAGG + Intergenic
1188014829 X:25097037-25097059 CCCTGGGAGCAGAAGGGACTTGG - Intergenic
1189318521 X:40073264-40073286 CCCAGGAAACAGACTGCCATTGG + Exonic
1190760027 X:53431354-53431376 CCCAGGGAAAGGAAGGGCAGAGG + Exonic
1191912210 X:66163163-66163185 CCCAGAGAAGAGAAGGGAGTGGG + Intronic
1197572163 X:128163190-128163212 CCCTGGGAACATAACTGCATTGG - Intergenic
1198893994 X:141430539-141430561 CCCAGGCTACTGAAGGGCAGTGG + Intergenic
1199477441 X:148260675-148260697 CCCAGGAAACACAAGGGGTTGGG - Intergenic
1199763134 X:150920764-150920786 CCTAGAAAACAGAAGGGCAAAGG - Intergenic
1200063980 X:153496088-153496110 CCCAGGGATCTGCAGGGCACAGG + Intronic
1200756981 Y:6999369-6999391 TCCAGGTAACAGAAGTGCCTAGG - Intronic
1201394725 Y:13536460-13536482 CCCAGGGAAGAGAAGGGCGGTGG + Intergenic
1202368915 Y:24184471-24184493 CCCAGGAATGAGGAGGGCATGGG - Intergenic
1202501870 Y:25485646-25485668 CCCAGGAATGAGGAGGGCATGGG + Intergenic