ID: 1030058454

View in Genome Browser
Species Human (GRCh38)
Location 7:105603470-105603492
Sequence GAGGATCGCTTGAGCTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030058454_1030058462 3 Left 1030058454 7:105603470-105603492 CCTCCCAAGCTCAAGCGATCCTC No data
Right 1030058462 7:105603496-105603518 CCTGAGCCCACCAAATAGCTGGG No data
1030058454_1030058466 30 Left 1030058454 7:105603470-105603492 CCTCCCAAGCTCAAGCGATCCTC No data
Right 1030058466 7:105603523-105603545 CAGCTGCGCACCACCATGCCCGG No data
1030058454_1030058460 2 Left 1030058454 7:105603470-105603492 CCTCCCAAGCTCAAGCGATCCTC No data
Right 1030058460 7:105603495-105603517 GCCTGAGCCCACCAAATAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030058454 Original CRISPR GAGGATCGCTTGAGCTTGGG AGG (reversed) Intergenic