ID: 1030058456

View in Genome Browser
Species Human (GRCh38)
Location 7:105603474-105603496
Sequence GCGGGAGGATCGCTTGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030058456_1030058462 -1 Left 1030058456 7:105603474-105603496 CCAAGCTCAAGCGATCCTCCCGC No data
Right 1030058462 7:105603496-105603518 CCTGAGCCCACCAAATAGCTGGG No data
1030058456_1030058460 -2 Left 1030058456 7:105603474-105603496 CCAAGCTCAAGCGATCCTCCCGC No data
Right 1030058460 7:105603495-105603517 GCCTGAGCCCACCAAATAGCTGG No data
1030058456_1030058466 26 Left 1030058456 7:105603474-105603496 CCAAGCTCAAGCGATCCTCCCGC No data
Right 1030058466 7:105603523-105603545 CAGCTGCGCACCACCATGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030058456 Original CRISPR GCGGGAGGATCGCTTGAGCT TGG (reversed) Intergenic