ID: 1030058457

View in Genome Browser
Species Human (GRCh38)
Location 7:105603489-105603511
Sequence ATTTGGTGGGCTCAGGCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030058457_1030058470 27 Left 1030058457 7:105603489-105603511 CCTCCCGCCTGAGCCCACCAAAT No data
Right 1030058470 7:105603539-105603561 TGCCCGGCTACCTTTTTTTAGGG No data
1030058457_1030058466 11 Left 1030058457 7:105603489-105603511 CCTCCCGCCTGAGCCCACCAAAT No data
Right 1030058466 7:105603523-105603545 CAGCTGCGCACCACCATGCCCGG No data
1030058457_1030058469 26 Left 1030058457 7:105603489-105603511 CCTCCCGCCTGAGCCCACCAAAT No data
Right 1030058469 7:105603538-105603560 ATGCCCGGCTACCTTTTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030058457 Original CRISPR ATTTGGTGGGCTCAGGCGGG AGG (reversed) Intergenic