ID: 1030058465

View in Genome Browser
Species Human (GRCh38)
Location 7:105603506-105603528
Sequence CAGCTGTGATCCCAGCTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030058465_1030058469 9 Left 1030058465 7:105603506-105603528 CCAAATAGCTGGGATCACAGCTG No data
Right 1030058469 7:105603538-105603560 ATGCCCGGCTACCTTTTTTTAGG No data
1030058465_1030058474 16 Left 1030058465 7:105603506-105603528 CCAAATAGCTGGGATCACAGCTG No data
Right 1030058474 7:105603545-105603567 GCTACCTTTTTTTAGGGACAGGG No data
1030058465_1030058466 -6 Left 1030058465 7:105603506-105603528 CCAAATAGCTGGGATCACAGCTG No data
Right 1030058466 7:105603523-105603545 CAGCTGCGCACCACCATGCCCGG No data
1030058465_1030058470 10 Left 1030058465 7:105603506-105603528 CCAAATAGCTGGGATCACAGCTG No data
Right 1030058470 7:105603539-105603561 TGCCCGGCTACCTTTTTTTAGGG No data
1030058465_1030058473 15 Left 1030058465 7:105603506-105603528 CCAAATAGCTGGGATCACAGCTG No data
Right 1030058473 7:105603544-105603566 GGCTACCTTTTTTTAGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030058465 Original CRISPR CAGCTGTGATCCCAGCTATT TGG (reversed) Intergenic