ID: 1030058466

View in Genome Browser
Species Human (GRCh38)
Location 7:105603523-105603545
Sequence CAGCTGCGCACCACCATGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030058464_1030058466 -3 Left 1030058464 7:105603503-105603525 CCACCAAATAGCTGGGATCACAG No data
Right 1030058466 7:105603523-105603545 CAGCTGCGCACCACCATGCCCGG No data
1030058463_1030058466 -2 Left 1030058463 7:105603502-105603524 CCCACCAAATAGCTGGGATCACA No data
Right 1030058466 7:105603523-105603545 CAGCTGCGCACCACCATGCCCGG No data
1030058465_1030058466 -6 Left 1030058465 7:105603506-105603528 CCAAATAGCTGGGATCACAGCTG No data
Right 1030058466 7:105603523-105603545 CAGCTGCGCACCACCATGCCCGG No data
1030058455_1030058466 27 Left 1030058455 7:105603473-105603495 CCCAAGCTCAAGCGATCCTCCCG No data
Right 1030058466 7:105603523-105603545 CAGCTGCGCACCACCATGCCCGG No data
1030058461_1030058466 4 Left 1030058461 7:105603496-105603518 CCTGAGCCCACCAAATAGCTGGG No data
Right 1030058466 7:105603523-105603545 CAGCTGCGCACCACCATGCCCGG No data
1030058459_1030058466 7 Left 1030058459 7:105603493-105603515 CCGCCTGAGCCCACCAAATAGCT No data
Right 1030058466 7:105603523-105603545 CAGCTGCGCACCACCATGCCCGG No data
1030058457_1030058466 11 Left 1030058457 7:105603489-105603511 CCTCCCGCCTGAGCCCACCAAAT No data
Right 1030058466 7:105603523-105603545 CAGCTGCGCACCACCATGCCCGG No data
1030058454_1030058466 30 Left 1030058454 7:105603470-105603492 CCTCCCAAGCTCAAGCGATCCTC No data
Right 1030058466 7:105603523-105603545 CAGCTGCGCACCACCATGCCCGG No data
1030058458_1030058466 8 Left 1030058458 7:105603492-105603514 CCCGCCTGAGCCCACCAAATAGC No data
Right 1030058466 7:105603523-105603545 CAGCTGCGCACCACCATGCCCGG No data
1030058456_1030058466 26 Left 1030058456 7:105603474-105603496 CCAAGCTCAAGCGATCCTCCCGC No data
Right 1030058466 7:105603523-105603545 CAGCTGCGCACCACCATGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030058466 Original CRISPR CAGCTGCGCACCACCATGCC CGG Intergenic