ID: 1030058470

View in Genome Browser
Species Human (GRCh38)
Location 7:105603539-105603561
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030058464_1030058470 13 Left 1030058464 7:105603503-105603525 CCACCAAATAGCTGGGATCACAG No data
Right 1030058470 7:105603539-105603561 TGCCCGGCTACCTTTTTTTAGGG No data
1030058465_1030058470 10 Left 1030058465 7:105603506-105603528 CCAAATAGCTGGGATCACAGCTG No data
Right 1030058470 7:105603539-105603561 TGCCCGGCTACCTTTTTTTAGGG No data
1030058463_1030058470 14 Left 1030058463 7:105603502-105603524 CCCACCAAATAGCTGGGATCACA No data
Right 1030058470 7:105603539-105603561 TGCCCGGCTACCTTTTTTTAGGG No data
1030058458_1030058470 24 Left 1030058458 7:105603492-105603514 CCCGCCTGAGCCCACCAAATAGC No data
Right 1030058470 7:105603539-105603561 TGCCCGGCTACCTTTTTTTAGGG No data
1030058461_1030058470 20 Left 1030058461 7:105603496-105603518 CCTGAGCCCACCAAATAGCTGGG No data
Right 1030058470 7:105603539-105603561 TGCCCGGCTACCTTTTTTTAGGG No data
1030058459_1030058470 23 Left 1030058459 7:105603493-105603515 CCGCCTGAGCCCACCAAATAGCT No data
Right 1030058470 7:105603539-105603561 TGCCCGGCTACCTTTTTTTAGGG No data
1030058457_1030058470 27 Left 1030058457 7:105603489-105603511 CCTCCCGCCTGAGCCCACCAAAT No data
Right 1030058470 7:105603539-105603561 TGCCCGGCTACCTTTTTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030058470 Original CRISPR TGCCCGGCTACCTTTTTTTA GGG Intergenic