ID: 1030058474

View in Genome Browser
Species Human (GRCh38)
Location 7:105603545-105603567
Sequence GCTACCTTTTTTTAGGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030058464_1030058474 19 Left 1030058464 7:105603503-105603525 CCACCAAATAGCTGGGATCACAG No data
Right 1030058474 7:105603545-105603567 GCTACCTTTTTTTAGGGACAGGG No data
1030058465_1030058474 16 Left 1030058465 7:105603506-105603528 CCAAATAGCTGGGATCACAGCTG No data
Right 1030058474 7:105603545-105603567 GCTACCTTTTTTTAGGGACAGGG No data
1030058458_1030058474 30 Left 1030058458 7:105603492-105603514 CCCGCCTGAGCCCACCAAATAGC No data
Right 1030058474 7:105603545-105603567 GCTACCTTTTTTTAGGGACAGGG No data
1030058461_1030058474 26 Left 1030058461 7:105603496-105603518 CCTGAGCCCACCAAATAGCTGGG No data
Right 1030058474 7:105603545-105603567 GCTACCTTTTTTTAGGGACAGGG No data
1030058459_1030058474 29 Left 1030058459 7:105603493-105603515 CCGCCTGAGCCCACCAAATAGCT No data
Right 1030058474 7:105603545-105603567 GCTACCTTTTTTTAGGGACAGGG No data
1030058463_1030058474 20 Left 1030058463 7:105603502-105603524 CCCACCAAATAGCTGGGATCACA No data
Right 1030058474 7:105603545-105603567 GCTACCTTTTTTTAGGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030058474 Original CRISPR GCTACCTTTTTTTAGGGACA GGG Intergenic