ID: 1030060594

View in Genome Browser
Species Human (GRCh38)
Location 7:105618011-105618033
Sequence CTGCTGTCACTGAGCAACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 166}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030060594_1030060598 3 Left 1030060594 7:105618011-105618033 CCAATGTTGCTCAGTGACAGCAG 0: 1
1: 0
2: 1
3: 23
4: 166
Right 1030060598 7:105618037-105618059 GGTTAGGCAAGTCCTGAACAGGG 0: 1
1: 0
2: 0
3: 5
4: 115
1030060594_1030060605 26 Left 1030060594 7:105618011-105618033 CCAATGTTGCTCAGTGACAGCAG 0: 1
1: 0
2: 1
3: 23
4: 166
Right 1030060605 7:105618060-105618082 GGGAGGGACCTGATGCCCTGTGG 0: 1
1: 0
2: 6
3: 22
4: 260
1030060594_1030060599 4 Left 1030060594 7:105618011-105618033 CCAATGTTGCTCAGTGACAGCAG 0: 1
1: 0
2: 1
3: 23
4: 166
Right 1030060599 7:105618038-105618060 GTTAGGCAAGTCCTGAACAGGGG 0: 1
1: 0
2: 0
3: 7
4: 68
1030060594_1030060603 10 Left 1030060594 7:105618011-105618033 CCAATGTTGCTCAGTGACAGCAG 0: 1
1: 0
2: 1
3: 23
4: 166
Right 1030060603 7:105618044-105618066 CAAGTCCTGAACAGGGGGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 171
1030060594_1030060601 6 Left 1030060594 7:105618011-105618033 CCAATGTTGCTCAGTGACAGCAG 0: 1
1: 0
2: 1
3: 23
4: 166
Right 1030060601 7:105618040-105618062 TAGGCAAGTCCTGAACAGGGGGG 0: 1
1: 0
2: 0
3: 13
4: 104
1030060594_1030060600 5 Left 1030060594 7:105618011-105618033 CCAATGTTGCTCAGTGACAGCAG 0: 1
1: 0
2: 1
3: 23
4: 166
Right 1030060600 7:105618039-105618061 TTAGGCAAGTCCTGAACAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 89
1030060594_1030060597 2 Left 1030060594 7:105618011-105618033 CCAATGTTGCTCAGTGACAGCAG 0: 1
1: 0
2: 1
3: 23
4: 166
Right 1030060597 7:105618036-105618058 TGGTTAGGCAAGTCCTGAACAGG 0: 1
1: 0
2: 0
3: 8
4: 87
1030060594_1030060602 9 Left 1030060594 7:105618011-105618033 CCAATGTTGCTCAGTGACAGCAG 0: 1
1: 0
2: 1
3: 23
4: 166
Right 1030060602 7:105618043-105618065 GCAAGTCCTGAACAGGGGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030060594 Original CRISPR CTGCTGTCACTGAGCAACAT TGG (reversed) Intronic
901195726 1:7438804-7438826 CTGCTGTTACTGAGCAGGGTTGG + Intronic
901948997 1:12726415-12726437 CTCCTGCCTCTGAGCCACATTGG - Exonic
903662809 1:24989009-24989031 CTGCCTTCACAGAGCAACACTGG + Intergenic
904549245 1:31301653-31301675 CTGCTCACAGTTAGCAACATTGG - Intronic
910672150 1:89784267-89784289 CTGCAGTCTCTGCTCAACATGGG - Intronic
911645670 1:100334991-100335013 TTGTTGTCCCTGAGCAACATAGG + Intergenic
917998595 1:180468126-180468148 CTGCTGGTTCTGAGCTACATTGG - Intronic
922364508 1:224851442-224851464 CAGCTGTCACTGACCAGCATAGG - Intergenic
1062829442 10:595816-595838 CGGCTGACCCTGAACAACATGGG - Intronic
1064018555 10:11791529-11791551 CTGCTGTCTCTGAGCCACAGAGG - Intergenic
1065204337 10:23343482-23343504 CTGCTGTAACAAAACAACATAGG - Intronic
1065444583 10:25785105-25785127 CTCCTTTCGCTGGGCAACATAGG + Intergenic
1066477634 10:35763538-35763560 CTCCTATCACTGAACAACATGGG + Intergenic
1067005879 10:42661526-42661548 CTGCTGTTAGTGAGCTACTTTGG + Intergenic
1067349003 10:45458829-45458851 CTTCTTTGACTGAGCAACATTGG - Intronic
1069907400 10:71739886-71739908 CTGCTGTCACCAAGTAACATGGG + Intronic
1071017394 10:81013955-81013977 AGGCTGTCACTGAGCCACACTGG - Intergenic
1071492084 10:86143126-86143148 CTGCTGTCCCTCAGGAACACTGG - Intronic
1073810479 10:107147263-107147285 CTGCTGAGACTTTGCAACATGGG + Intronic
1073891443 10:108106946-108106968 ATGCTGCCATTTAGCAACATTGG + Intergenic
1076888082 10:133271673-133271695 CTGCAGTCACTGAACATCCTGGG + Exonic
1078251903 11:9623290-9623312 CTGCTGGCTCTGGGCAAAATGGG - Intergenic
1078599036 11:12714644-12714666 CTGCTGTAACAAAGCACCATAGG + Intronic
1079205158 11:18408566-18408588 TTGCTTTCCCTGAGCCACATTGG + Intergenic
1081383728 11:42446503-42446525 CTGCTGTCACTGTGCATCTCAGG - Intergenic
1085783427 11:79430120-79430142 CTGCTGTCACTTAGCAGCGTTGG + Intronic
1090419975 11:126567964-126567986 CTGTTGTGACTGGGCAACTTGGG - Intronic
1092018077 12:5176233-5176255 CCTCTGTCACTTAGCAACTTGGG - Intergenic
1095194834 12:39301600-39301622 CTGCAGCCACTGAGCAAAACTGG + Exonic
1095234497 12:39780232-39780254 CTGCTGTCACTGTGTAATCTTGG - Intronic
1096176559 12:49524716-49524738 CAGATGTAACTGAGCTACATCGG - Exonic
1097402978 12:59152074-59152096 CTGCTGTCACTGAGAGAGAAGGG - Intergenic
1099584887 12:84503876-84503898 CTGCTGTCAGTGAGCCACTGTGG + Intergenic
1100601152 12:96112469-96112491 GTGCTGACACTGAGAAACCTTGG + Intergenic
1101135218 12:101737270-101737292 CTGCAGTCATTGAGAAACGTAGG - Exonic
1103436575 12:120931507-120931529 CTGCTGCCACTGTGGGACATAGG + Intergenic
1103932514 12:124458083-124458105 CTGCTGTGACTCAGCTGCATTGG + Intronic
1104791257 12:131483533-131483555 CTGCTGGGACTGAGCCACAGTGG + Intergenic
1106026388 13:25959654-25959676 CTACTGCCACTGAGAAACATGGG - Intronic
1107006592 13:35619408-35619430 CTGCTGCCACTGAGCCATATGGG - Intronic
1107789613 13:43988717-43988739 CTGCTGCCATTGAGCCACCTAGG + Intergenic
1107889350 13:44900668-44900690 CTGATTTCATTGAGCAACAGGGG - Intergenic
1108314423 13:49223442-49223464 CTGCTGTCACTCAGCTCCAAAGG + Intergenic
1111859564 13:93684615-93684637 ATAATGTCACTGAGCAACCTAGG + Intronic
1113731241 13:112642926-112642948 GTGCTGTCACTGAACAGCAGCGG + Intergenic
1116569435 14:46496819-46496841 CTGCTAGCATTGAGCACCATTGG - Intergenic
1116786069 14:49290000-49290022 CTGCTGTCACAGAATATCATAGG - Intergenic
1117511068 14:56451606-56451628 CTGCTGCCATTTAGAAACATTGG + Intergenic
1117719441 14:58614800-58614822 CTGGGGTCAATGAGAAACATAGG - Intergenic
1120399816 14:84016472-84016494 CTGCTTTCATTGAACAACACCGG - Intergenic
1123939985 15:25212148-25212170 CTCCTGGCATTGACCAACATAGG + Intergenic
1123944213 15:25231189-25231211 CTCCTGGCATTGACCAACATAGG + Intergenic
1125039054 15:35161945-35161967 CTGCTGCCACTTATCAAAATGGG - Intergenic
1134394258 16:13848562-13848584 ATGCTGTCACTGTGGAACACTGG - Intergenic
1135218907 16:20596045-20596067 CTGCTGTCACAGACCCACTTTGG - Intergenic
1135236838 16:20764776-20764798 CATCTGTCACTGAGCAAGGTGGG - Intronic
1135270130 16:21061994-21062016 GTGCTGTCACTGAGCAGAAATGG + Intronic
1135578298 16:23603543-23603565 CACCTGTCTCTGACCAACATTGG - Exonic
1136681293 16:31964736-31964758 CTGCTGGAAATGAGCAACAAGGG + Intergenic
1136781605 16:32906248-32906270 CTGCTGGAAATGAGCAACAAGGG + Intergenic
1136888188 16:33947592-33947614 CTGCTGGAAATGAGCAACAAGGG - Intergenic
1139699460 16:68698706-68698728 CTGCTGTGACTGACCTACAGTGG + Exonic
1141446970 16:84066539-84066561 CTGCTGTCTGTGTGGAACATGGG - Exonic
1203084260 16_KI270728v1_random:1170230-1170252 CTGCTGGAAATGAGCAACAAGGG + Intergenic
1145320652 17:21765361-21765383 CTGCTGGCCCTGGGCACCATAGG - Intergenic
1149661253 17:58335161-58335183 AGGCTGTCACTGGGCAACCTTGG + Intergenic
1150647242 17:66986523-66986545 GTGATGTCACTGAGCAAGACAGG + Intronic
1150977545 17:70105484-70105506 TTGCTGTCACTTTGCAACAGTGG - Intronic
1151142158 17:72003984-72004006 CTGCTGGCACTCAGCACCATGGG - Intergenic
1152512647 17:80800980-80801002 CTGCTGTCCCTGGGCCACACGGG - Intronic
1152621718 17:81368251-81368273 CTGCCTTCACTGAGCAGCATCGG + Intergenic
1155102721 18:22628950-22628972 CTGCTGTCACTCAGCAGTTTAGG + Intergenic
1155426771 18:25715383-25715405 CTTCTGCCACTCAGCAGCATGGG + Intergenic
1155982534 18:32196161-32196183 CTGGTGTCACTGCGCCACCTCGG + Intronic
1157568069 18:48693479-48693501 GGGCTGTCACTGAGCAACCAGGG + Intronic
1158250243 18:55479723-55479745 CCGGTGTCACAGAGCAACGTGGG - Intronic
1158395291 18:57074775-57074797 CAGCTGTCACTCAGCCACAGTGG - Intergenic
1158528134 18:58233815-58233837 CTGCTGTCTCTGAGCCCTATGGG + Intronic
1158545537 18:58393146-58393168 CTGAAGTCACAGAGAAACATGGG - Intronic
1160412190 18:78682799-78682821 CCACTGTCATTGTGCAACATCGG + Intergenic
1163031291 19:14545845-14545867 CTGCTGTCCCCGAGGAGCATCGG + Intronic
1165262671 19:34634318-34634340 CTGCCTTCACTGAGCACCCTGGG + Intronic
931466535 2:62492723-62492745 CTACAGTCACTGAGCATCTTGGG - Intergenic
932310206 2:70733767-70733789 CTGATGTCACTGTGCCACCTGGG + Intronic
941885061 2:170519519-170519541 CTGCTGTCACAGAGAAAAATGGG + Exonic
941931943 2:170950598-170950620 ATGCTGTCACTGAACAAAAAGGG - Intronic
943301968 2:186213995-186214017 CAGCTGTCACTGAGCAGCATGGG + Intergenic
943365672 2:186965342-186965364 CTTTTTTCATTGAGCAACATTGG + Intergenic
943596149 2:189859479-189859501 CTGCTGTCACAGAGCTCCATAGG - Intronic
944773404 2:202936551-202936573 CTTCTGTCACTTAGCATAATGGG + Intronic
945864174 2:215158501-215158523 CTAGTGTCACTGACCACCATTGG - Intergenic
946295105 2:218777789-218777811 CTGCTGCCCTTGGGCAACATGGG + Intergenic
946490809 2:220147123-220147145 ATGCTGTTACTTAGCAACAAAGG - Intergenic
1170251141 20:14284174-14284196 CTGCTGTTACTGATCAGGATAGG + Intronic
1172332893 20:34088043-34088065 CTACTGTGTCTGAGTAACATAGG + Intronic
1173492310 20:43493008-43493030 CTGCTGCCTCTGATCTACATGGG - Intergenic
1175179577 20:57136032-57136054 ATGCTGTCTCTGAGCCAAATCGG + Intergenic
1175598688 20:60255571-60255593 CTGCTGCCACTGTGCACCACGGG - Intergenic
1178307288 21:31501274-31501296 CCGTTGTAACTGAGCAGCATTGG - Intronic
1179523766 21:41962197-41962219 CTTCTGTCACTGAGAAGCAGGGG + Intergenic
1181310921 22:21944329-21944351 GTGCTCTCCCTGTGCAACATGGG - Intronic
1181346597 22:22223970-22223992 CTCATGTCACTGGGCCACATGGG + Intergenic
1182058375 22:27378962-27378984 CTGCAGCCACTGGGCAACAGGGG + Intergenic
1183879251 22:40812632-40812654 CTGCTGTGACTCAGCCACGTCGG - Intronic
1183901511 22:41009504-41009526 CTGCTGTAAATGAGGAACATTGG - Intergenic
950917821 3:16663800-16663822 CAGCTGCCACTGAGCAGCAAAGG - Intronic
951041074 3:17989387-17989409 CTGCTGTAGATGAGAAACATGGG + Intronic
951399879 3:22218734-22218756 CTCCTGGCTCTCAGCAACATGGG + Intronic
952496688 3:33922176-33922198 ATCCTGTCACTGAGCAGTATGGG - Intergenic
953417659 3:42732198-42732220 CTGCTGACACTTGGCAGCATAGG - Intronic
954374731 3:50188300-50188322 CTGCCGTCTCTGACCAGCATGGG - Exonic
965433130 3:168613508-168613530 GTGCTGTGTCTGAGGAACATAGG + Intergenic
966131890 3:176650760-176650782 CTGGAGTCACTGAGCAAGAATGG - Intergenic
967161173 3:186739668-186739690 CTGCTGTGGGGGAGCAACATTGG + Intronic
967945351 3:194799587-194799609 CTGCTGACACTGATGAGCATGGG + Intergenic
973724723 4:53763913-53763935 CTGCTGTCACTGTGCACCACAGG + Intronic
974569446 4:63626029-63626051 CTGCTCTCTCTGATTAACATTGG + Intergenic
977922547 4:102661355-102661377 CTGCTGTCAAAGGGAAACATGGG - Intronic
979340251 4:119514112-119514134 CTGCTGTCAGTGAGCACTAATGG + Intronic
979543828 4:121917050-121917072 CTGCTGTAACTAAGTACCATAGG - Intronic
981748895 4:148074812-148074834 CTGCAGTCGCTGAGCAAGGTAGG - Intergenic
983120313 4:163875538-163875560 ATTCTGTCACCGAGCAAGATAGG - Intronic
983956444 4:173704072-173704094 CGGCTGTCACACAGCAACTTTGG - Intergenic
984203352 4:176755285-176755307 CTGCTGTAAGTGGGCAGCATGGG - Intronic
987334068 5:16883307-16883329 TTTCTGTAACTGAGCAACAGAGG + Intronic
988692266 5:33584682-33584704 CTGTTGTCACTGAGAAAGATAGG - Intronic
990203901 5:53408836-53408858 CTGTTGTCATTTAACAACATAGG - Intergenic
991517272 5:67451435-67451457 TTGCTTTCATTGAGCATCATGGG - Intergenic
995838091 5:116418033-116418055 CTGCTGGCACTGAGAAAATTGGG + Intergenic
1005166148 6:22923367-22923389 CTGGTGTCACTGCTCACCATTGG + Intergenic
1008290125 6:49705181-49705203 CTGCAGCCACTGTGCAAGATGGG + Intronic
1014022045 6:116602635-116602657 CTGCTGCCACTGAGTCACCTTGG - Intergenic
1014320554 6:119923805-119923827 GAGCTGTTACTGAGCTACATTGG + Intergenic
1016771980 6:147861853-147861875 CTGCTGTCACAGAGCCAGAAAGG - Intergenic
1017787572 6:157769238-157769260 CTGCTGTCACTTAGCAATGAGGG - Intronic
1021484319 7:21150058-21150080 CTTCTGTAACTGAGCACCATTGG + Intergenic
1021551806 7:21878951-21878973 CAGCTGGCATTGAGCAACAGGGG - Intronic
1022379370 7:29845318-29845340 CTGCTGTCACTGAGCTCAAGGGG - Intronic
1023715059 7:43035428-43035450 CTCCATTCAATGAGCAACATAGG - Intergenic
1023862114 7:44222951-44222973 CTGCTGTCACTGTGCAGCAGGGG - Intronic
1024049420 7:45609411-45609433 CTGCTGGCACTGAGCACGACAGG + Intronic
1025032451 7:55569046-55569068 CAGCTGGCACAGAGCAACAGGGG + Intronic
1026024143 7:66731857-66731879 CTGCTTTCACTGTGCACCTTGGG - Intronic
1027122486 7:75531876-75531898 CTTCTGTCTCTGAGCAGAATTGG + Intergenic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1029990383 7:104957782-104957804 CCGCTGTCACTTAGTAACAAGGG + Intergenic
1030060594 7:105618011-105618033 CTGCTGTCACTGAGCAACATTGG - Intronic
1031090644 7:117349647-117349669 CTCCTTTCACTGAGCACCATAGG + Intergenic
1033609161 7:142949116-142949138 CTGGTGTCACTGAACCACAGGGG - Intronic
1033963848 7:146949347-146949369 CTGATGTCTCTGAACTACATCGG + Intronic
1034631160 7:152531527-152531549 CTGCAGTCACTGAGGATGATGGG - Intergenic
1035138981 7:156738211-156738233 CTGCTGTGACAGGGCAGCATTGG - Intronic
1037991090 8:23321673-23321695 CTGCTGCCACTGAGAACCAAAGG - Intronic
1038126788 8:24682946-24682968 CTGCTATGACTCAGCAAAATGGG - Intergenic
1038782503 8:30580161-30580183 CTGCGGACACTGAGAAACAATGG + Intronic
1039739930 8:40373195-40373217 CTGGTGTCACAGAACAACCTTGG - Intergenic
1040857928 8:51969779-51969801 CTTCTTTCACTGAGTAATATGGG - Intergenic
1041019848 8:53627516-53627538 CTGCTGTTACTGAATACCATAGG - Intergenic
1041313931 8:56542512-56542534 CTGCTGTCACTGAGTCCCACCGG - Intergenic
1041874795 8:62675657-62675679 CAGCTGTCAGTGAGCAAGAGAGG - Intronic
1043045613 8:75319928-75319950 CTGCAGTCATTGAGCAACACAGG + Intergenic
1043520994 8:81045028-81045050 CTGCTTTCAAGGAGCAGCATAGG - Intronic
1044505022 8:93006924-93006946 CTGCTGGCTCTGAGGAACCTGGG + Intronic
1044893587 8:96863769-96863791 ATGCTGTCACTGAGACACTTTGG - Intronic
1045809506 8:106205000-106205022 CTGCTGTCACTGGGGAGCATTGG - Intergenic
1046537729 8:115537016-115537038 ATGCTGTTACAGAGCAACAGAGG + Intronic
1046606594 8:116378369-116378391 ATCCTTTCACTGAACAACATTGG - Intergenic
1046665862 8:117002082-117002104 CTTCTGTCACTGTACCACATTGG + Intronic
1047929595 8:129713524-129713546 CTGCTGTCACTGAGGAGCCTTGG + Intergenic
1048318120 8:133376978-133377000 CTCCTGTCGCTGAGCACCTTGGG + Intergenic
1048446192 8:134495140-134495162 CTGCTGTCACAAAGCAGCACAGG + Intronic
1049400308 8:142423754-142423776 CTGCTGTCAGAGAGCCAGATAGG - Intergenic
1050369388 9:4904981-4905003 CTACTGTCACTGACAAACCTTGG + Intergenic
1052193465 9:25684106-25684128 CTGCAGGCACTGAACAACCTGGG + Intergenic
1054990533 9:71320447-71320469 CTCTTGTCTCTGACCAACATTGG - Intronic
1055110832 9:72557660-72557682 CTGCTGTCCCTGACACACATTGG - Intronic
1055795349 9:79969579-79969601 CTGCTGGCACTGAGCCCCTTGGG - Intergenic
1056219437 9:84436669-84436691 CTGCTGTCAGTGACCAAAGTAGG - Intergenic
1056509376 9:87288570-87288592 CTGAGCTCTCTGAGCAACATTGG + Intergenic
1058160095 9:101560846-101560868 CATCTGTTACAGAGCAACATTGG + Exonic
1059555597 9:115277093-115277115 CTGCTGTGACAGGGCAACAATGG + Intronic
1062452855 9:136622807-136622829 CTGCTGTCTCTCAGGCACATCGG + Intergenic
1185721885 X:2388842-2388864 CTGCTGTCACAGAATACCATAGG - Intronic
1186737622 X:12482178-12482200 CAGCTGGCTCTTAGCAACATAGG - Intronic
1187113018 X:16320823-16320845 TTGCAGTCACTGAGCAACGATGG + Intergenic
1189174013 X:38935831-38935853 CCGCTGTGACTGAGGAAAATAGG - Intergenic
1190373381 X:49764617-49764639 CTGATGTCACAGAGTAACTTAGG + Intergenic
1191225142 X:58034922-58034944 CTGCTGGCTCTGAGGAACCTGGG - Intergenic
1199084787 X:143616097-143616119 CTGCTGTCGCTCAGCAACACTGG + Intergenic
1200379426 X:155819440-155819462 CTGCTGTAACAGGGCAGCATTGG - Intergenic
1200753425 Y:6967887-6967909 CTGCTGTAACAGAGCACCACGGG + Intronic