ID: 1030063019

View in Genome Browser
Species Human (GRCh38)
Location 7:105638294-105638316
Sequence TGGTCAAGTGACTAGCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030063019_1030063024 6 Left 1030063019 7:105638294-105638316 CCAGCAAGCTAGTCACTTGACCA 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1030063024 7:105638323-105638345 CAGGGCTTCTATCGTCAAGGTGG 0: 1
1: 0
2: 0
3: 5
4: 44
1030063019_1030063025 18 Left 1030063019 7:105638294-105638316 CCAGCAAGCTAGTCACTTGACCA 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1030063025 7:105638335-105638357 CGTCAAGGTGGTACTTACCTAGG 0: 1
1: 0
2: 0
3: 0
4: 47
1030063019_1030063023 3 Left 1030063019 7:105638294-105638316 CCAGCAAGCTAGTCACTTGACCA 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1030063023 7:105638320-105638342 ATTCAGGGCTTCTATCGTCAAGG 0: 1
1: 0
2: 0
3: 7
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030063019 Original CRISPR TGGTCAAGTGACTAGCTTGC TGG (reversed) Intronic
905938102 1:41840740-41840762 TCGTCCAGTGACTGGCTGGCTGG - Intronic
908602173 1:65752370-65752392 AGGCCAGGTGGCTAGCTTGCTGG - Intergenic
915040519 1:152964629-152964651 TGAACAACTGACTAGCTGGCTGG - Intergenic
916968619 1:169982547-169982569 TGATCCAGTGACTACCTTTCTGG + Intronic
919770229 1:201154010-201154032 TGGTTAAGGGCCTAGCGTGCTGG - Exonic
921254531 1:213327488-213327510 TGGTCATGTGCCTGACTTGCGGG + Intergenic
921281057 1:213568696-213568718 TGAGCAAGTGACAATCTTGCAGG - Intergenic
921712421 1:218386248-218386270 TGCACAAGTGACTTGCCTGCTGG + Intronic
1066304102 10:34122730-34122752 AGGTCAAGTGTCAAACTTGCCGG - Intronic
1071375659 10:84999938-84999960 TGATCATGTGACTATCCTGCAGG + Intergenic
1084630285 11:70343704-70343726 TTGCCAAGACACTAGCTTGCTGG - Exonic
1088990692 11:114950837-114950859 TGGTGAAGAAACTGGCTTGCAGG - Intergenic
1092064785 12:5580935-5580957 TGATCACCTGACTAGCTGGCTGG + Intronic
1095485419 12:42679507-42679529 TGGTTATGTCACAAGCTTGCAGG - Intergenic
1106852565 13:33810515-33810537 TGGTATAGTGCCTAGGTTGCTGG + Intergenic
1108533930 13:51353479-51353501 AGGTAAAGTAACTAGTTTGCAGG + Intronic
1109938248 13:69323289-69323311 AGGTCAGGTTACTAGTTTGCAGG + Intergenic
1110538957 13:76686224-76686246 TGGTGAAGTGACTAAAATGCAGG + Intergenic
1115811221 14:37110262-37110284 TGCTCAAGGGACTAGTTTTCTGG - Intronic
1116221594 14:42095384-42095406 TGGTCAAGTCACAGCCTTGCAGG - Intergenic
1126937822 15:53730826-53730848 TGGTCAAGTGAGTAGATTAATGG - Intronic
1134504206 16:14791983-14792005 TGGACATGTGATTAGCTTGATGG + Intronic
1134576367 16:15336925-15336947 TGGACATGTGATTAGCTTGATGG - Intergenic
1134726076 16:16419576-16419598 TGGACATGTGATTAGCTTGATGG + Intergenic
1134941357 16:18292284-18292306 TGGACATGTGATTAGCTTGATGG - Intergenic
1137451592 16:48579710-48579732 TGGTGAAGTGAGTCTCTTGCAGG - Intronic
1143805602 17:9423794-9423816 TGGTGCAGTGTCTAGCTTTCTGG - Intronic
1143883770 17:10050968-10050990 TGGTCAACTGAGTGGTTTGCAGG - Intronic
1148947377 17:51275670-51275692 TGGTAAAGTGACTTGCTAGTTGG + Intronic
1150323341 17:64235113-64235135 TGGTAAAGTGATTAGCTAGAGGG - Intronic
1152213067 17:79013571-79013593 TTGTCAACTGACCAGTTTGCTGG - Intergenic
1152863219 17:82708216-82708238 TGCTCAAGTGCCTGGCTTTCAGG - Intergenic
1156796045 18:41047542-41047564 TGGCAAAGGGACTAGCTTGAGGG - Intergenic
1166787828 19:45379858-45379880 TGGGCAGGTGGCTGGCTTGCTGG + Exonic
1168681297 19:58317958-58317980 TGGTAAAGTGACTGGCAGGCGGG - Intergenic
926291140 2:11531297-11531319 AGGTTAAGTGACTTGCCTGCTGG + Intergenic
926707463 2:15846850-15846872 TGATCACGTGACTGTCTTGCTGG + Intergenic
929928750 2:46235999-46236021 AGGTCAAGTGACAAGCTAGAAGG - Intergenic
931037505 2:58259777-58259799 TCGTAAAGTGACTATCTTTCTGG + Intergenic
932093827 2:68829444-68829466 TGGTCAGGTCACGTGCTTGCCGG + Intergenic
932262831 2:70341590-70341612 GGGGCTAGTGACCAGCTTGCAGG + Intergenic
936738468 2:115475252-115475274 TGGTGAAGTGACTGGGATGCAGG - Intronic
937750753 2:125473880-125473902 TGGCCAAGTGACTCCCATGCAGG - Intergenic
946471507 2:219964985-219965007 TGGGCAAGGGACAAACTTGCTGG + Intergenic
1185054541 22:48572300-48572322 TGGTCAAGTGAGAAGCCTGTTGG - Intronic
952094978 3:29939990-29940012 TGGTCATGTCATTAGCTTGCAGG - Intronic
952286385 3:31973377-31973399 TAGACTAGTGACTAGCTTTCTGG - Intronic
953141506 3:40233465-40233487 TGGTCCAGTGGGTAGCTTTCTGG - Intronic
957398240 3:79673095-79673117 ATGTAAAGTGACTAGCTTTCAGG - Intronic
967722518 3:192830392-192830414 TGGTGAGGTAATTAGCTTGCAGG - Intronic
968938879 4:3627759-3627781 TGGTCATGTGGCTGGCTGGCTGG + Intergenic
969706456 4:8794834-8794856 TGGTCAAGAGGCTAGCTAGCAGG - Intergenic
976311146 4:83614821-83614843 TGGTTTGGTGACTGGCTTGCTGG + Intergenic
994566871 5:101459815-101459837 TGGACAAGTGACTAGGTTACTGG + Intergenic
996310697 5:122100912-122100934 TGGTTAAGGGACTTGCTTGGAGG - Intergenic
1003459523 6:6317551-6317573 TGGGCAAGTGTCTGGCTTGCTGG + Intronic
1016803064 6:148185852-148185874 TGGTCCTCTGACTGGCTTGCTGG + Intergenic
1017124898 6:151056327-151056349 TGGCCAAGTGACTGACGTGCTGG + Intronic
1018955550 6:168407959-168407981 AGGTCAAGTGACCAGGGTGCAGG - Intergenic
1021370372 7:19837543-19837565 TGCTAAAGTGAGTAACTTGCAGG + Intergenic
1030063019 7:105638294-105638316 TGGTCAAGTGACTAGCTTGCTGG - Intronic
1031952805 7:127909755-127909777 TGATCCAGTGACTAGCTTTGGGG + Intronic
1032151759 7:129434958-129434980 AGGTTAAGTGACTGGCTTGAGGG + Intronic
1033592168 7:142818445-142818467 TGGGCAGTTGACTTGCTTGCAGG - Intergenic
1037582009 8:20251073-20251095 TGGTGAAGTGACCAGCCTGAGGG + Intronic
1038955798 8:32467274-32467296 TGGCAAAGTGATTAGCTAGCTGG + Intronic
1045919665 8:107514522-107514544 TGGTCAAGTGAATATTTTGAAGG + Intergenic
1048823549 8:138401153-138401175 AGGTCAAATGTCTAGATTGCAGG + Intronic
1054451863 9:65407561-65407583 TGGTCATGTGGCTGGCTGGCTGG - Intergenic
1058415661 9:104785903-104785925 TGGGCAAGTGACTAACTCCCTGG - Intronic
1061429882 9:130524138-130524160 CGATCAAGTGACCAGATTGCGGG - Intergenic
1194118244 X:89929555-89929577 TGGTCAGGTGACCAACTTCCAGG + Intergenic
1197466720 X:126813672-126813694 TGGTCAAATAAATAGCTTGTTGG - Intergenic
1198650476 X:138858274-138858296 TGGTCAAAGGACTACCTTGTTGG + Intronic
1200471122 Y:3587120-3587142 TGGTCAGGTGACCAACTTCCAGG + Intergenic
1201539063 Y:15086387-15086409 TGGTGAACTGACAAACTTGCTGG + Intergenic