ID: 1030064525

View in Genome Browser
Species Human (GRCh38)
Location 7:105649147-105649169
Sequence AAACACTGCTCCACAAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 4, 3: 62, 4: 300}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030064525 Original CRISPR AAACACTGCTCCACAAAGAA AGG (reversed) Intronic
900747042 1:4367570-4367592 AAACAATCCTCCAGGAAGAAAGG + Intergenic
901282331 1:8048309-8048331 AAGCCCTGCTCCACCAGGAAGGG + Intergenic
902154190 1:14470639-14470661 AAACTCTGCTCAACAGAGAAAGG - Intergenic
902244777 1:15113465-15113487 AAACACTGGTCTGGAAAGAAAGG + Intronic
902996410 1:20228965-20228987 AACCAATACTCCACAGAGAAGGG + Intergenic
903151215 1:21410662-21410684 AAACACTTCCCCAAAAATAAAGG - Intergenic
904394469 1:30209370-30209392 AAATTCTCCCCCACAAAGAACGG - Intergenic
904903080 1:33872982-33873004 AAACACTGCTACTCAAAGGGAGG - Intronic
908199087 1:61775776-61775798 AAACACTGCTAAACAATGAAAGG - Intronic
908337566 1:63143077-63143099 TCACACTTCTCCACAAATAATGG - Intergenic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
909843909 1:80365940-80365962 AAACAGTGCTTCAGAAAAAATGG + Intergenic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
912253775 1:108038342-108038364 AACCACTGCTCTAAAAAGAATGG + Intergenic
915160843 1:153919481-153919503 CATCACTGCTACACAAAGAAAGG + Intronic
916306793 1:163344662-163344684 AAACATTGCTTCACAAAAGATGG - Intronic
917215227 1:172671294-172671316 GAACCCTCCTCCACAAAGAATGG - Intergenic
918017006 1:180644998-180645020 AAAACCTGCTTCACAAAGATAGG + Intronic
918523779 1:185443021-185443043 GAACACTGCTCCCCACAAAAGGG + Intergenic
918750947 1:188268590-188268612 AAACCCTGCTTCACAAAAATAGG + Intergenic
918915099 1:190625284-190625306 AACCAGGGCTCCACAAAGAATGG - Intergenic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
920924872 1:210331342-210331364 AGACCCTGCTTCACAAAGATAGG + Intronic
921159832 1:212464993-212465015 AAACACAGCTCCCCCAAGACAGG + Intergenic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
924244505 1:242070668-242070690 AAACCCTGTTTCACAAAGACAGG + Intergenic
924703956 1:246482871-246482893 AAACACTGCTCCACAGACAAGGG + Intronic
924821773 1:247498992-247499014 AAACCATGCTTCACAAAGACAGG + Intergenic
924926975 1:248692586-248692608 GTACACTGCCCAACAAAGAAAGG - Intergenic
1063005885 10:1970249-1970271 AAATCCTGCTTCACAAAGACAGG - Intergenic
1063594393 10:7420640-7420662 AAACCCTGCTTCCCAAAGATAGG - Intergenic
1063850012 10:10177179-10177201 CAAAACTGCTCCACAAAAGAAGG - Intergenic
1064563055 10:16611404-16611426 AAAAATTCCTCAACAAAGAATGG - Intronic
1065622444 10:27596702-27596724 ACATACTGCTGAACAAAGAATGG - Intergenic
1067014184 10:42743974-42743996 AAACACTGCTACACTAAGCTAGG - Intergenic
1067405391 10:46018574-46018596 AAACACTTCTCCAGGAAGGAAGG + Intronic
1067430212 10:46237771-46237793 AAACACTGAGACACAAATAATGG + Intergenic
1067707158 10:48615582-48615604 AAACAAAGCTACACAAAGTATGG + Intronic
1068125811 10:52840743-52840765 AAAGAATGCTCCTCCAAGAAAGG - Intergenic
1068163331 10:53296745-53296767 AGACCCTGCTTCACAAAGATAGG + Intergenic
1068301377 10:55145632-55145654 AAACACTGCCCAAGAAACAAAGG - Intronic
1069095671 10:64256832-64256854 AGACACTGCTCCTCAAAGAGCGG - Intergenic
1069401207 10:68048809-68048831 AAACACTGCTCTAAAAAGAAAGG + Intronic
1069536885 10:69260327-69260349 AAGGATTGCTCCAAAAAGAAGGG + Intronic
1069603553 10:69725280-69725302 AAACACTGGTCCACACAGTCAGG - Intergenic
1070316988 10:75323205-75323227 AAACACTGCTCAGCAATAAAAGG - Intergenic
1070615233 10:77964555-77964577 AAACCCTGCTTCACAAGGATAGG - Intergenic
1071478406 10:86044097-86044119 AAACACTGCTCAAGATAGCAGGG + Intronic
1072224505 10:93355984-93356006 AAACCCTGCTACTGAAAGAAAGG + Intronic
1072669648 10:97420046-97420068 AAACACTGCTCTACAAGGGGAGG + Intronic
1073773814 10:106764362-106764384 AAGTGCTCCTCCACAAAGAAGGG + Intronic
1074628204 10:115218278-115218300 AAACTCTGCTCCACGAAGACAGG + Intronic
1078157692 11:8812916-8812938 AAACAGTGCTCCCAAAAAAAAGG + Intronic
1078473112 11:11607968-11607990 AAATATTTCTCCACAAACAAGGG + Intronic
1078826109 11:14931718-14931740 AAATCCTGCTTCACAAAGATAGG + Intronic
1078900248 11:15635347-15635369 AAAGACTGCTCCCCAAAGGCCGG - Intergenic
1079000617 11:16752005-16752027 AAACCCTGTTTCACAAAGACAGG - Intronic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1080804832 11:35642989-35643011 GAAAACTCCTCAACAAAGAAAGG - Intergenic
1081860069 11:46328042-46328064 AAACACAGCTCCTAAAGGAAAGG + Intergenic
1082153987 11:48779988-48780010 AAAAACTACTCAAAAAAGAAAGG + Intergenic
1083083813 11:60121921-60121943 AAACCCTGCTTCATAAAGATAGG - Intergenic
1084843155 11:71875100-71875122 AAACAATGCCCAACAATGAAAGG + Intronic
1085662627 11:78383392-78383414 AAACACTGAAACACAAGGAATGG + Intronic
1086189510 11:84062031-84062053 AAACACTGCTTTTCATAGAAGGG + Intronic
1087921905 11:103876411-103876433 GAACACTGCTTCTCAAAGTATGG - Intergenic
1088707052 11:112473235-112473257 AAAAACTGCTCAACAAACTAAGG - Intergenic
1089661682 11:119990197-119990219 AAACACCCTTCCCCAAAGAAGGG - Intergenic
1090211747 11:124925561-124925583 GAACACAGATTCACAAAGAAAGG + Intronic
1091914972 12:4265074-4265096 AAATACAGCTACTCAAAGAAAGG + Intergenic
1092734818 12:11570981-11571003 AAAAAATATTCCACAAAGAAAGG - Intergenic
1094812782 12:34156141-34156163 AAAGCCTGCTTCACAAAGACAGG - Intergenic
1096653932 12:53076687-53076709 ACACACTGCTCCACTCAGAAAGG + Intronic
1097656873 12:62375901-62375923 AAAAGCTGATCCACAAGGAAAGG - Intronic
1100657580 12:96663033-96663055 AAACACTGTTACAAGAAGAAGGG - Intronic
1100691212 12:97040286-97040308 AATCCCTCCTCCACAATGAATGG + Intergenic
1101596559 12:106171177-106171199 AAACACTGCCCTACAGAGAGAGG + Intergenic
1102004004 12:109577312-109577334 AAACACTGTTCCAAAGAGCAAGG - Intronic
1102987494 12:117290389-117290411 AAACAGTCCCCCACAAAGAATGG - Exonic
1104728779 12:131093872-131093894 CACCACAGCTCCACAAGGAAAGG - Intronic
1105456829 13:20548736-20548758 TAAAACTGCTCCACAAGAAAAGG + Intergenic
1106574367 13:30961045-30961067 AGAGACTGATCCACAAATAATGG - Intronic
1106981153 13:35282389-35282411 TAACACTGCTCAAGAAAGACTGG - Intronic
1108468283 13:50741126-50741148 GAACAATGCTCCAAACAGAAGGG + Intronic
1108690106 13:52851723-52851745 AAACACAGCTCCACAATGGCCGG + Intergenic
1108840747 13:54611579-54611601 TGACACCGTTCCACAAAGAAGGG - Intergenic
1109002753 13:56827142-56827164 CAACACTATTCCACAAATAAAGG - Intergenic
1110414760 13:75240151-75240173 TAAAACTTCTCCACAAAAAAAGG + Intergenic
1111215262 13:85133061-85133083 AAGCACTGCACCACAGAGAGGGG + Intergenic
1111885470 13:94015384-94015406 ATACACAACTCCACAAAAAAAGG - Intronic
1112308082 13:98293443-98293465 AAACACTGGGCCACTAAGAAAGG + Intronic
1113030110 13:105983547-105983569 AGAAACTGCCACACAAAGAATGG + Intergenic
1113401436 13:109997657-109997679 AAACCCTGCTTCAGAAAGATAGG - Intergenic
1113563155 13:111299844-111299866 AAACATTTCTCCATGAAGAAGGG - Intronic
1114513280 14:23280074-23280096 CAACACTCCACCACCAAGAAGGG - Intronic
1115431407 14:33323030-33323052 AGACATAGCTCCTCAAAGAAAGG + Intronic
1116140382 14:40985936-40985958 AAACCCTGCTTCACAAAAATGGG + Intergenic
1117331774 14:54719525-54719547 AAACAGTGTGTCACAAAGAAGGG - Intronic
1117335483 14:54754030-54754052 CAAGGCTGCTCCAGAAAGAAGGG - Intronic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1118615170 14:67570016-67570038 AGAAACTGCTGCACAAAGAGGGG + Intronic
1118654586 14:67933206-67933228 AAACACTACTCCTCAGGGAATGG - Intronic
1119327612 14:73770581-73770603 AAACACCTCTCACCAAAGAAAGG + Intronic
1119548227 14:75489012-75489034 AGAAACTGCTCCACAAGAAAGGG - Intergenic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1121381278 14:93470522-93470544 AAACACTGCTCCAGACACAAGGG - Intronic
1121733457 14:96202307-96202329 AAACCCTGCCCCACTAAGCAGGG - Intergenic
1122226571 14:100284275-100284297 ATGCACTGCTCCATAAACAAGGG - Intergenic
1122515848 14:102307888-102307910 AACCACTTGTCCACAATGAAGGG - Intergenic
1123226724 15:17044043-17044065 AAATACTTCTCAAAAAAGAAAGG - Intergenic
1123226742 15:17044382-17044404 AAATACTTCTCAAAAAAGAAAGG - Intergenic
1123784317 15:23654086-23654108 AAAAACTGCTCTACAAAATAAGG - Intergenic
1124440275 15:29680753-29680775 AAACTCTGCTTCACAAACACAGG + Intergenic
1124478204 15:30054625-30054647 AATGACTGTTTCACAAAGAATGG + Intergenic
1124534084 15:30529523-30529545 AAATATTTCTCCACAAACAATGG - Intergenic
1124764563 15:32478087-32478109 AAATATTTCTCCACAAACAATGG + Intergenic
1124847142 15:33302131-33302153 AAACACTTCAACACAAAGACAGG - Intergenic
1126257790 15:46648378-46648400 AAACACTGGTCTACCAATAAAGG - Intergenic
1127264306 15:57349116-57349138 AATCACTGTTCCACAAAGTTTGG - Intergenic
1128233587 15:66052127-66052149 TAACGCTGCTCCTCAAAGAGAGG + Intronic
1130931630 15:88432546-88432568 AAGCACTGCTACACAAAGCGTGG - Intergenic
1131036893 15:89228468-89228490 AAAAAATGCTCCACAAAAATGGG + Intergenic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1132007950 15:98247885-98247907 AAACAAAGCTTCATAAAGAAAGG - Intergenic
1136049199 16:27638575-27638597 AAAAGCTGCTCCACCAAGAGAGG + Intronic
1136273284 16:29161476-29161498 AAGCACTACTCAACAATGAAAGG - Intergenic
1136811983 16:33184394-33184416 AAACACAGCACCACAAGGAGGGG - Intergenic
1136818459 16:33294474-33294496 AAACACAGCACCACAAGGAGGGG - Intronic
1136825023 16:33351007-33351029 AAACACAGCACCACAAGGAGGGG - Intergenic
1136830089 16:33449778-33449800 AAACACAGCACCACAAGGAGGGG - Intergenic
1138425540 16:56929768-56929790 AAACCCTGCTTCACAGAGATGGG + Intergenic
1139834983 16:69830943-69830965 AAACACTGGTACACAGAGGAAGG - Intronic
1140601045 16:76475264-76475286 AAACTCTGCTCCCCAAAGATAGG + Intronic
1141194106 16:81846793-81846815 AAACACTTCACCTCAGAGAAAGG + Intronic
1141386421 16:83625909-83625931 AAACACTGCACCCCAAAGTCAGG + Intronic
1141714547 16:85719242-85719264 AGACACTGCTGCGGAAAGAACGG + Intronic
1142076836 16:88123342-88123364 AAGCACTGCTCAACAATAAAAGG - Intergenic
1202990561 16_KI270728v1_random:7364-7386 AAACACAGCACCACAAGGAGGGG - Intergenic
1143870007 17:9951444-9951466 AAACACTTCCCTACAAAGAAAGG + Intronic
1143962524 17:10732328-10732350 AGACACTGATCCTCGAAGAAAGG - Intergenic
1144471202 17:15542981-15543003 AAACACTGCTAGAAAAAGACTGG + Intronic
1144925264 17:18801712-18801734 AAACACTGCTAGAAAAAGACTGG - Intronic
1146110130 17:30082058-30082080 AGACCCTGTTCCACAGAGAAGGG - Intronic
1146681320 17:34810456-34810478 AGTGAATGCTCCACAAAGAAAGG - Intergenic
1149440340 17:56668629-56668651 AAACCCTGCTTTACAAAGATAGG - Intergenic
1150196033 17:63300440-63300462 AACCACTGCTCAAGTAAGAAAGG - Intronic
1151740282 17:75977323-75977345 CCACCCTGCTCCACAAGGAACGG - Intronic
1152163770 17:78687304-78687326 AAACACTGCTTCACAAAGACAGG + Intronic
1152309428 17:79540576-79540598 GCACACTCCTCCACACAGAAGGG + Intergenic
1153427076 18:4976770-4976792 AATCACTGCTCTAGAAAGCATGG - Intergenic
1154354318 18:13613354-13613376 AAACACAGCTGCACATGGAATGG - Intronic
1155374162 18:25137879-25137901 AAACAGTGCTGCATAAAGAACGG - Intronic
1156375731 18:36513872-36513894 AAACACTGCTGCACACACCATGG - Intronic
1156494007 18:37513925-37513947 ACACACGGCACCACACAGAAGGG - Intronic
1157723442 18:49944315-49944337 CAACAATGCACCACAGAGAACGG + Intronic
1158343224 18:56488750-56488772 AAACACAGCATCACCAAGAAAGG + Intergenic
1158407281 18:57171352-57171374 AAACACTGCTAAAGACAGAAGGG + Intergenic
1159247003 18:65819351-65819373 TCGCACTGCTCCACAAAGAGCGG + Intronic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1160162818 18:76488018-76488040 AATCACTGCTGCACAAACAGAGG + Intronic
1161041386 19:2112457-2112479 ACACACTGATCCACAGAGACAGG + Intronic
1163588697 19:18178068-18178090 GAATCCTGCTCCACTAAGAATGG + Exonic
1165270166 19:34699346-34699368 AAACACTCCTCCTCAACAAATGG + Intergenic
1165278818 19:34779575-34779597 AACCACTGCTCCAGATGGAAAGG + Intergenic
1165785852 19:38461437-38461459 CACCACTGCCCCACAAAGAAAGG + Intronic
1166441484 19:42819170-42819192 AAACACTGGGAGACAAAGAAGGG + Intronic
1168570520 19:57464329-57464351 AATCACTTATCCACAAAAAAGGG - Intronic
926783702 2:16499338-16499360 AAACACTGATCCACGGAGTATGG - Intergenic
926824699 2:16892887-16892909 AAACTCTGCTTCACAAACATAGG - Intergenic
927105742 2:19822560-19822582 AAATTGTGCTCTACAAAGAAGGG - Intergenic
928040359 2:27869835-27869857 AAACTCTGCTTCACAAAGATAGG + Intronic
928551001 2:32370500-32370522 AGTGACTGCACCACAAAGAAAGG - Intronic
928850864 2:35744020-35744042 AACCACTGCTTCAGAAAGGAAGG - Intergenic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
929817751 2:45249007-45249029 AAAAAGTGCCCCATAAAGAATGG - Intergenic
931123973 2:59253277-59253299 GACCACTGCTCCACACAGTAAGG - Intergenic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
936689924 2:114874410-114874432 AAACCCTGCTTCACCAAGATAGG - Intronic
937165890 2:119816753-119816775 AAACACTGCTTCATAAAGATAGG + Intronic
938596931 2:132797106-132797128 AACCACTGCTCAACATAGTAAGG - Intronic
938956534 2:136303969-136303991 AAACACCACTCCTCAAAGCAGGG - Intergenic
939234709 2:139476446-139476468 TAAGACTGCTCTTCAAAGAAAGG + Intergenic
941615647 2:167715876-167715898 TAAAACTTCTCCACAAAAAAAGG + Intergenic
941726133 2:168862651-168862673 AAACTCTGTGACACAAAGAAGGG - Intronic
941776126 2:169395643-169395665 AAACACTGCTCCAGAAGGCCTGG + Intergenic
943704760 2:191022721-191022743 TAAAAGTCCTCCACAAAGAATGG - Intergenic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
945031159 2:205664917-205664939 AAACACAGGTACACAAAGAAGGG - Intergenic
946411371 2:219516896-219516918 AAGCACTGCTCCCCAAAGCAAGG + Intronic
947349646 2:229229789-229229811 AAACCCAGCTCCACCAGGAAAGG - Intronic
947701363 2:232237335-232237357 AAAGACAGCTCCACCAGGAAGGG + Intronic
1169664424 20:8019117-8019139 AAACACTGTCCCCCAAAGCAAGG + Intronic
1171743403 20:28932681-28932703 AAATACTTCTCAAAAAAGAAAGG + Intergenic
1171829271 20:29970448-29970470 CAAAACTGCTCTACAAAAAAAGG - Intergenic
1172313305 20:33934320-33934342 AAACTCTGTCCCAAAAAGAAAGG + Intergenic
1174847466 20:53956774-53956796 AAATACACCTCCACAAAAAATGG - Intronic
1175694980 20:61095740-61095762 GAAAACTGCTTCACAAAGATAGG + Intergenic
1177248795 21:18566367-18566389 AAGCACTGATCCAACAAGAAAGG - Intergenic
1177719264 21:24883509-24883531 TAACACAACTTCACAAAGAAAGG - Intergenic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1179300104 21:40100694-40100716 AAACACTGCGGTATAAAGAAGGG + Intronic
1180252846 21:46601062-46601084 AAACACTGCCCCACCGTGAATGG - Intronic
1180353684 22:11822922-11822944 AAAAACTGCACCACAGAGAAGGG - Intergenic
1180400606 22:12417450-12417472 AAATACTTCTCAAAAAAGAAAGG - Intergenic
1180400621 22:12417790-12417812 AAATACTTCTCAAAAAAGAAAGG - Intergenic
1182319953 22:29472136-29472158 GCACACGGCTCCACAGAGAAAGG + Intergenic
1184513906 22:44948720-44948742 AAACCCGGCTTCACAAAGACAGG + Intronic
949460472 3:4287572-4287594 AAACACAGCTTCACAAAGATAGG + Intronic
950037497 3:9897646-9897668 CAACACTGCTCAACAAGGGAAGG - Intergenic
950280503 3:11703951-11703973 AAACACTGATCCACGAGGCATGG + Intronic
950403204 3:12787103-12787125 AGAAAATGCTCCAAAAAGAACGG + Intergenic
950510530 3:13423188-13423210 AAACACTGACACCCAAAGAAGGG - Intergenic
950758430 3:15197996-15198018 AAACCCTGCTTCATAAAGATAGG + Intergenic
953569403 3:44059115-44059137 ATACCCAGCTCCACAAAGGACGG - Intergenic
954470074 3:50686266-50686288 AAACTCTGCTGCACAAAAATAGG + Intronic
956869136 3:73399308-73399330 AAACACTGCTCTCCAAACAGAGG - Intronic
958422793 3:93947421-93947443 AAAAACTGCTCCCTAAAGATAGG + Intronic
960166171 3:114404178-114404200 AGACACTGATATACAAAGAAAGG - Intronic
961580837 3:127880760-127880782 AAACCCTGCTTCACAAACAGAGG + Intergenic
961932882 3:130552793-130552815 AAAGACTGCTACATATAGAAAGG - Intergenic
962119848 3:132549895-132549917 AAATACTACTCCATGAAGAAGGG - Intergenic
962545041 3:136425287-136425309 ATACACTGCTAAAAAAAGAAAGG + Intronic
963153562 3:142072446-142072468 AAACAGTGATTCAAAAAGAAAGG + Intronic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
964704216 3:159601363-159601385 CAACACAGCACCACACAGAAGGG + Intronic
965602279 3:170467248-170467270 AAACCCTCCTCCACTGAGAAGGG + Exonic
967057664 3:185843720-185843742 ATACACTGCTCCTCTGAGAAAGG + Intergenic
967438808 3:189482303-189482325 AAACACTGCAGCAGAAATAAAGG + Intergenic
967658976 3:192082062-192082084 AATCCCTGATTCACAAAGAAAGG + Intergenic
967785299 3:193487163-193487185 AAAGAGTGCTTCAGAAAGAATGG + Intronic
969784244 4:9441159-9441181 AAACAATGCCCAACAATGAAAGG + Intergenic
970317745 4:14845588-14845610 AAACACTGCAGCCCAAAAAAAGG + Intergenic
970967987 4:21949278-21949300 AAATACTGCTGCACAAAGTTAGG + Intergenic
971305920 4:25481503-25481525 AAACACTACTCCTGTAAGAAAGG + Intergenic
972170801 4:36343103-36343125 AAACAGTGCTACTCAAAGCATGG + Intronic
972902764 4:43704637-43704659 AAACACAGCTGAACAAAGTAAGG + Intergenic
973557066 4:52094162-52094184 AAACTCTGCTCTATTAAGAAGGG - Intronic
975417449 4:74121401-74121423 AAACCCTACTTCACAAAGATAGG - Intronic
975625355 4:76340567-76340589 AAACACTGCTTCACAAAGATAGG - Intronic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
978072008 4:104485013-104485035 AAACACTGATGCACAAATGAAGG + Intronic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
978315962 4:107437526-107437548 AAACACTGTTTCACAACGATAGG + Intergenic
978474880 4:109115457-109115479 GAACAAAGCTACACAAAGAAAGG + Intronic
978855082 4:113385720-113385742 AAACAGGGATCCACAATGAACGG - Intergenic
979829230 4:125280146-125280168 AAACCCTTCTTCACAAAGATAGG - Intergenic
980938367 4:139248017-139248039 AATCACATCTCCACGAAGAAGGG + Intergenic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
983677640 4:170314707-170314729 AAACTCAGCTTCACAAAGATAGG - Intergenic
983762794 4:171433454-171433476 AAAAAGTGCTCTACACAGAAAGG + Intergenic
984545557 4:181097691-181097713 AAAAACTGTGCCACAAAGTATGG + Intergenic
985753417 5:1697339-1697361 AAACTCTGCTTCACAAAGACAGG + Intergenic
986350178 5:6870326-6870348 CAACCCTGCTTCACAAAGATAGG + Intergenic
987250643 5:16097273-16097295 AAATACAGCTCTACAAAGAAAGG - Intronic
987267385 5:16270984-16271006 AAACAGTGCTGCACAAACATGGG - Intergenic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
988272124 5:29031096-29031118 AAACCCTGGTCCCCAAAGAAGGG + Intergenic
988831562 5:34992513-34992535 ACACAGTGCTCCTCAGAGAAAGG - Intergenic
989409070 5:41096542-41096564 ATACACTGCCCCACTAAGAAAGG - Intergenic
990826020 5:59898825-59898847 AAAACCTGCTCCACTCAGAAGGG - Intronic
990847976 5:60165966-60165988 AATCACTTAACCACAAAGAAGGG - Intronic
991061850 5:62384445-62384467 TAACACTCCTCAACAAAGAAAGG - Intronic
992019960 5:72612723-72612745 GATCATAGCTCCACAAAGAAAGG - Intergenic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
996009126 5:118461335-118461357 TAACACTGCTGCAGAAACAAAGG + Intergenic
997435599 5:133872297-133872319 AGACACTGCTCCAGAACTAAAGG + Intergenic
997900374 5:137758015-137758037 AAACCCTGCTTCACAAATATAGG + Intergenic
999048224 5:148492463-148492485 AAACACTTCTCCTGAAACAAGGG - Intronic
1001894462 5:175366505-175366527 AAACCCTGCTTCGCAAAGATAGG - Intergenic
1001961351 5:175882058-175882080 AGGCCCTGCTCCCCAAAGAAGGG - Exonic
1002788373 6:420885-420907 ACAGCCTGTTCCACAAAGAAAGG + Intergenic
1003362114 6:5437248-5437270 AAACACTACTCCAAATAAAAAGG - Intronic
1004428611 6:15523517-15523539 AAGGACTGCTCCTCAAAGATAGG - Intronic
1004462997 6:15856047-15856069 AAACACTGCTGGACATAGAGCGG + Intergenic
1004546524 6:16603500-16603522 AAACACAGTTCCATAAGGAAAGG + Intronic
1004599281 6:17132154-17132176 AAACCCTGCTGCACAAAGATGGG - Intergenic
1005468202 6:26136093-26136115 AAACCTAGCTCCACAAAGTAGGG + Intronic
1006911489 6:37566334-37566356 GAAAACTGCTCCCCAAGGAAGGG - Intergenic
1006979535 6:38135890-38135912 AATACCTGCTCCACAGAGAAGGG - Intronic
1007749579 6:44063763-44063785 AACCACTCCTCAACAAAGCAGGG + Intergenic
1012432958 6:99185519-99185541 GACCGCTGCTCCACAAAGAGGGG - Intergenic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1014321800 6:119939202-119939224 AATCACAGCTGAACAAAGAAGGG - Intergenic
1015306148 6:131710828-131710850 TAAAACTTCTCCACAAAAAAAGG + Exonic
1015514921 6:134074051-134074073 AAACACTGCTCCCCAAAAGCTGG + Intergenic
1015998975 6:139023640-139023662 AACCTCTTCTCCACAAAAAAAGG - Intergenic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1017930742 6:158952567-158952589 AAACAGTGATCCACAAATATTGG - Intergenic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1018835228 6:167478122-167478144 TAACACTGATCCATGAAGAAGGG - Intergenic
1019965522 7:4495672-4495694 CATTACTGCTCCACAATGAAGGG - Intergenic
1020621455 7:10525003-10525025 AAACACTGCTCAGCACAGAGAGG - Intergenic
1020946382 7:14613608-14613630 AAAACCTCCTCCACAAAGAAAGG + Intronic
1022625059 7:32026697-32026719 AAACTCAGGTCCACAAAAAATGG + Intronic
1022674640 7:32487626-32487648 AATCACTGCTCCCCAAAAATGGG + Intronic
1023209262 7:37785461-37785483 AATCTCTGCTCCTGAAAGAATGG - Intronic
1023766238 7:43513573-43513595 CAACACTGCACGAGAAAGAAAGG - Intronic
1026318534 7:69248733-69248755 AAACAATTTTCCACAAAAAAAGG + Intergenic
1026605048 7:71808689-71808711 AAACACTGATCCACCAACAAAGG + Intronic
1027391575 7:77709122-77709144 AATAACTGCTCGACATAGAAGGG + Intronic
1027590671 7:80115121-80115143 AAACAATGCTTAACACAGAAAGG + Intergenic
1028214711 7:88117520-88117542 AATCACTGCTCCACTAAGGAGGG - Intronic
1029025570 7:97413623-97413645 AATCAATGCTCCACGAGGAATGG - Intergenic
1029819271 7:103130189-103130211 AAATACTGCCCCAGAAAGAAAGG + Intronic
1030014247 7:105202834-105202856 ATTCAATGCTACACAAAGAAAGG + Intronic
1030064525 7:105649147-105649169 AAACACTGCTCCACAAAGAAAGG - Intronic
1031385382 7:121143681-121143703 AAAAAATGCTCCACCAAAAAGGG - Intronic
1031936708 7:127742630-127742652 TGAAAGTGCTCCACAAAGAATGG + Intronic
1032993377 7:137418759-137418781 AAAAACTGCTAAACAAAGAATGG + Intronic
1033678834 7:143571985-143572007 TAAAACTTCTCCACAAAAAAAGG - Exonic
1033693004 7:143757469-143757491 TAAAACTTCTCCACAAAAAAAGG + Exonic
1033731401 7:144183671-144183693 TAAAACTTCTCCACAAAAAAAGG - Exonic
1033740263 7:144269061-144269083 TAAAACTTCTCCACAAAAAAAGG + Exonic
1034699730 7:153085454-153085476 AAACACTTCTTCACAACCAATGG + Intergenic
1036382638 8:8247412-8247434 AAATCCTGCTTCACAAAGACAGG - Intergenic
1037504117 8:19513809-19513831 AAACACATCTAGACAAAGAAAGG + Intronic
1038097066 8:24325111-24325133 CTAAACTCCTCCACAAAGAATGG - Intronic
1038960989 8:32519850-32519872 AAACACGGTGGCACAAAGAAGGG - Intronic
1039890076 8:41679921-41679943 GGACACTGATCCACAAAGCATGG - Intronic
1041980249 8:63849520-63849542 AACCACTGCTCTACAAGGATTGG - Intergenic
1042172330 8:66004260-66004282 AAGCCCTGCTTCACAAAGACAGG - Intergenic
1043050992 8:75385339-75385361 AAACCCTGCTTCACAAGGATAGG - Intergenic
1044031757 8:87247045-87247067 AAACTCTGCTTCACAAAGGTAGG + Intronic
1044477055 8:92639355-92639377 AAACACTGAGGCACAGAGAAGGG - Intergenic
1044886501 8:96783948-96783970 AAACAGTGCTACTCAAAGCATGG - Intronic
1045072006 8:98516533-98516555 ATTCACTGTTCCACAAAGCAAGG + Intronic
1047746812 8:127851298-127851320 ACACAGTGCACCCCAAAGAAAGG - Intergenic
1047938442 8:129804415-129804437 ATGCACTGCTCCAGAAATAATGG - Intergenic
1048605863 8:135968336-135968358 AAACCCAGCTCCCCAAGGAAAGG + Intergenic
1048970593 8:139643164-139643186 CATCACTGCCCCACAAAGCAGGG + Intronic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1051188443 9:14485460-14485482 ATACAATACACCACAAAGAATGG + Intergenic
1052838058 9:33265871-33265893 AAACAGTGGTTCACAAAGAAGGG - Intronic
1055444647 9:76370464-76370486 AAACATTGGAACACAAAGAAAGG + Intergenic
1055933504 9:81583812-81583834 CACCACTGCTCTACAAAGGACGG + Exonic
1056194971 9:84220250-84220272 GGACACTGCTCCACACTGAAAGG - Intergenic
1056343644 9:85666363-85666385 AAACAATGCTCCACATTTAATGG - Intronic
1056380454 9:86052847-86052869 AAACGCTGCTCCTCCAGGAAAGG + Intronic
1056732755 9:89180010-89180032 AAACTCTGCTCCATAGAGCAGGG - Intergenic
1057059691 9:91992622-91992644 AAACACATTTCCACAAAGAGAGG - Intergenic
1057775835 9:98008617-98008639 AAACTTTGCTTCACAAAGATAGG - Intronic
1058229481 9:102408214-102408236 AAACTCTGCTTCACAAAGATCGG - Intergenic
1058394657 9:104537121-104537143 AAAGACTACTCAACAAAGACTGG + Intergenic
1059064087 9:111064427-111064449 AAACTCTGCTAGAAAAAGAAAGG - Intergenic
1059756555 9:117299152-117299174 ATACACTGGACCACGAAGAATGG + Intronic
1203381636 Un_KI270435v1:53755-53777 AAATACTTCTCAAAAAAGAAAGG - Intergenic
1203401133 Un_KI270519v1:99111-99133 AAATACTTCTCAAAAAAGAAAGG - Intergenic
1186311207 X:8321528-8321550 AAACACAGCTTAAAAAAGAACGG - Intergenic
1188065688 X:25656668-25656690 AAACCCTGCTTCACAATGATAGG + Intergenic
1188861705 X:35265213-35265235 ACTCAGTGCTCCACAAAGTATGG - Intergenic
1190423915 X:50313525-50313547 AAGCACTGCTCTACATAGCATGG + Intronic
1191169437 X:57427250-57427272 AAAAACTTCCCAACAAAGAAAGG + Intronic
1192289631 X:69780318-69780340 AAACACTTATCTACAAAGACAGG - Intronic
1192982808 X:76365186-76365208 AAACACTACCCCATAAAAAAGGG - Intergenic
1194328450 X:92551027-92551049 GAACAGTGCTCCACAAACATAGG + Intronic
1194446700 X:93996394-93996416 AAACAGTGCTCAACAAACATAGG + Intergenic
1197277901 X:124501343-124501365 AAACAATTCTCCACAACCAATGG + Intronic
1197794557 X:130285493-130285515 AAACACTCCCCCATAAAGCATGG + Intergenic
1198184511 X:134240275-134240297 AAAAACTGCTCCACCAAAATAGG - Intronic
1198892171 X:141410078-141410100 AAAGATTGCTCAACAAAGGAAGG + Intergenic
1199733239 X:150657978-150658000 AAATACTGGTACAAAAAGAATGG + Exonic
1201757877 Y:17507215-17507237 AAACTCTGCTTCAGAAAGACAGG - Intergenic
1201843677 Y:18398767-18398789 AAACTCTGCTTCAGAAAGACAGG + Intergenic