ID: 1030065460

View in Genome Browser
Species Human (GRCh38)
Location 7:105655780-105655802
Sequence TCCCGGAGCAACTGGGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 222}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030065460_1030065470 11 Left 1030065460 7:105655780-105655802 CCTCAGCCCCAGTTGCTCCGGGA 0: 1
1: 0
2: 1
3: 28
4: 222
Right 1030065470 7:105655814-105655836 GTAATTCCAAGCATTTGGAGAGG 0: 1
1: 0
2: 1
3: 47
4: 611
1030065460_1030065472 27 Left 1030065460 7:105655780-105655802 CCTCAGCCCCAGTTGCTCCGGGA 0: 1
1: 0
2: 1
3: 28
4: 222
Right 1030065472 7:105655830-105655852 GGAGAGGAGCCCCGCCTACCTGG 0: 1
1: 0
2: 1
3: 10
4: 181
1030065460_1030065468 6 Left 1030065460 7:105655780-105655802 CCTCAGCCCCAGTTGCTCCGGGA 0: 1
1: 0
2: 1
3: 28
4: 222
Right 1030065468 7:105655809-105655831 GCCTGGTAATTCCAAGCATTTGG 0: 1
1: 0
2: 0
3: 8
4: 122
1030065460_1030065474 29 Left 1030065460 7:105655780-105655802 CCTCAGCCCCAGTTGCTCCGGGA 0: 1
1: 0
2: 1
3: 28
4: 222
Right 1030065474 7:105655832-105655854 AGAGGAGCCCCGCCTACCTGGGG No data
1030065460_1030065473 28 Left 1030065460 7:105655780-105655802 CCTCAGCCCCAGTTGCTCCGGGA 0: 1
1: 0
2: 1
3: 28
4: 222
Right 1030065473 7:105655831-105655853 GAGAGGAGCCCCGCCTACCTGGG 0: 1
1: 0
2: 1
3: 8
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030065460 Original CRISPR TCCCGGAGCAACTGGGGCTG AGG (reversed) Intronic
900218511 1:1494961-1494983 GGCTGGAGCTACTGGGGCTGTGG - Intronic
900382767 1:2392972-2392994 TCCCGGAGGAATTGGGGATGGGG + Intronic
900933661 1:5752104-5752126 TCCCAGGGCAGCAGGGGCTGAGG + Intergenic
901054733 1:6443869-6443891 TCCCGGTGCAGACGGGGCTGTGG - Intronic
901451840 1:9340630-9340652 CCCCGCAGCACCTGGGTCTGCGG + Intronic
901629918 1:10643018-10643040 TCCCTGAGGAAGTGGGGCTGTGG + Intronic
902185566 1:14722780-14722802 TCACGTAGGAACAGGGGCTGGGG - Intronic
902479627 1:16704734-16704756 TCCCGGTGCAGAGGGGGCTGTGG + Intergenic
904856500 1:33501880-33501902 ACCCGGAGCCACTGTGGCTCCGG - Intergenic
906033686 1:42738354-42738376 CCCCGAGGCCACTGGGGCTGGGG + Intronic
906684082 1:47751767-47751789 TCCCGGAAGATCTGGAGCTGGGG + Intergenic
906955768 1:50372465-50372487 GCCCGGTGCAAATGGGACTGAGG - Intergenic
907297497 1:53464721-53464743 GGCGGGAGGAACTGGGGCTGCGG - Exonic
908935864 1:69374489-69374511 TCCAGGAGTCACTGGGGCTCAGG + Intergenic
909798404 1:79773785-79773807 TCCTATAGCCACTGGGGCTGTGG - Intergenic
911856893 1:102889454-102889476 TCCAGGAGCAAAAGGGGATGGGG - Exonic
913106400 1:115617609-115617631 ACCCTGAGCACCTGGGACTGGGG - Intergenic
914255348 1:145957831-145957853 GCCCGGAGTGACTGGGGCCGCGG - Exonic
919759949 1:201091611-201091633 TCCCAGGGAAAGTGGGGCTGTGG - Intronic
920812912 1:209303858-209303880 TCCCAGAAAAACTGGGGCTCTGG + Intergenic
921362224 1:214340821-214340843 TCCTGGTGAAACTGGGGCAGAGG - Intergenic
922447434 1:225709240-225709262 TGCCGGAGCTACTGGAGATGTGG - Intergenic
922753612 1:228082405-228082427 TCCTGCAGCAACTGGAGCTGCGG - Intergenic
924351148 1:243115719-243115741 TGCCTGGGCAGCTGGGGCTGCGG - Intergenic
1062906017 10:1180211-1180233 TCCAGGCACACCTGGGGCTGTGG + Exonic
1062906062 10:1180340-1180362 TCCAGGCACACCTGGGGCTGTGG + Exonic
1062906092 10:1180426-1180448 TCCAGGCACACCTGGGGCTGTGG + Exonic
1063174727 10:3540935-3540957 TCCCACAGCAACAAGGGCTGGGG - Intergenic
1065113608 10:22463187-22463209 CCCCAGAGCATATGGGGCTGAGG - Intergenic
1067044421 10:42976284-42976306 TCCCAGAGGAGCTGGGGCTGAGG - Intergenic
1067096591 10:43305280-43305302 CCCCGGTGATACTGGGGCTGAGG + Intergenic
1067166489 10:43869806-43869828 ACCCGGAGCCACAGTGGCTGAGG + Intergenic
1069879205 10:71581224-71581246 TTCCTGAGCAGCTAGGGCTGGGG - Intronic
1071016041 10:80998154-80998176 ACCCTGACCTACTGGGGCTGAGG - Intergenic
1072536741 10:96370037-96370059 TCCCGGAGACGCTGGGGCCGGGG - Intronic
1073541836 10:104321373-104321395 TCACGGGGCAACAGGGGCTGAGG + Intronic
1074455273 10:113590611-113590633 ACCCGGAGCAGCTGGGCCTCAGG - Exonic
1075106719 10:119543971-119543993 TTGGGGTGCAACTGGGGCTGTGG - Intergenic
1076521821 10:131085958-131085980 TCCCAGGGCACTTGGGGCTGTGG - Intergenic
1076723976 10:132404879-132404901 TCCCGGAGCCACAGCGGGTGAGG - Exonic
1076888087 10:133271689-133271711 TCCTGGGGAAACTGGAGCTGGGG + Exonic
1076889333 10:133276274-133276296 TCCTGGAGTGACTTGGGCTGGGG - Intronic
1078417792 11:11180160-11180182 GCCAGAGGCAACTGGGGCTGTGG + Intergenic
1078551271 11:12281975-12281997 TCCCAGGGCAACTAAGGCTGTGG - Intronic
1078768322 11:14321507-14321529 TCCAGGAGCAAGTGGGAGTGGGG + Intronic
1079323254 11:19470049-19470071 TCCCTGCTCCACTGGGGCTGAGG + Intronic
1081567225 11:44267440-44267462 TCTCAGAGCACCAGGGGCTGGGG + Intronic
1082767555 11:57181346-57181368 TCCAGCAGCCACTGAGGCTGAGG + Intergenic
1083199234 11:61109870-61109892 ACCCCGAGCAACTGGGGCTACGG - Intronic
1084064079 11:66693486-66693508 TCCGGGAGCACGTGGGGCTGGGG - Intronic
1086455258 11:86954647-86954669 TCCCTGAGAAAGTGGGGGTGGGG + Intronic
1089287863 11:117419388-117419410 TCCAAGAGGAAATGGGGCTGAGG - Intergenic
1090351825 11:126112853-126112875 TCCCCGAGAGGCTGGGGCTGCGG + Intergenic
1090406538 11:126479140-126479162 TCCCAGAGCCCCTGGGTCTGCGG - Intronic
1091361137 11:134979105-134979127 TCAGGGAGAAATTGGGGCTGAGG - Intergenic
1091671995 12:2458444-2458466 CCCAGGAGCACCTTGGGCTGGGG - Intronic
1091929379 12:4382638-4382660 TCCTGGAGCGACTGGGGAAGGGG + Intergenic
1094526717 12:31235936-31235958 TCCTGGAGTAAGTGGGGCTGTGG - Intergenic
1095770463 12:45949684-45949706 TCCATTAACAACTGGGGCTGGGG + Intronic
1099589610 12:84570567-84570589 TTCAGGAGAAACTGGGGCTTTGG + Intergenic
1101720823 12:107349205-107349227 GCCAGGAACAGCTGGGGCTGAGG - Intronic
1103593199 12:122006754-122006776 TCCCGGAGCAACTCCTGCGGTGG + Intergenic
1104601433 12:130156454-130156476 GAGAGGAGCAACTGGGGCTGGGG - Intergenic
1106693023 13:32139363-32139385 TCCTGAAGCATCTGTGGCTGGGG - Intronic
1107480101 13:40779219-40779241 TCCGGGAGCTACAGGGGCTCTGG - Intergenic
1112328129 13:98457406-98457428 TCCCGGACACCCTGGGGCTGGGG - Intronic
1113746188 13:112746436-112746458 TCCCCGGGTAACTGGGGCTCTGG + Intronic
1117547589 14:56805732-56805754 TTCCAGAGCAGCTGGGGGTGGGG - Intronic
1118436990 14:65780503-65780525 TGCAGGAGCCACTGGTGCTGAGG - Intergenic
1121324417 14:93011679-93011701 TGCAGGGGCACCTGGGGCTGAGG + Intronic
1122534365 14:102451917-102451939 TCCCGGACCTTCTGGGGATGGGG - Intronic
1124591650 15:31059122-31059144 TCCAGGAGGAACAGGGGCAGTGG + Intronic
1124609323 15:31197505-31197527 ACCTGGAGCAGCTGGGTCTGAGG + Intergenic
1124999072 15:34753044-34753066 TCCTGGAGGAACTGGGGGTGGGG - Exonic
1127995588 15:64151748-64151770 GCGCGGAGCAGCTGGGGCCGGGG + Exonic
1130965775 15:88696452-88696474 TCCCATAGCGACTGGGCCTGAGG - Intergenic
1131306892 15:91252842-91252864 CCCCTGAGCAACTTGGGCTTTGG + Intronic
1132498046 16:273120-273142 GCCGGGAGCAGCTGGGGCTGTGG - Intronic
1132751335 16:1459245-1459267 TCCTGGGGCTCCTGGGGCTGAGG - Intronic
1132867257 16:2099633-2099655 TCCCGGAGCAAGGTGGGCTGGGG - Exonic
1132971545 16:2691651-2691673 TCCTGGAGGCACTGGGGCGGCGG + Intronic
1133024425 16:2981705-2981727 TCGCGGAGCAAGTCGGGCTAGGG + Intergenic
1133090674 16:3401430-3401452 GGCCGGAGCCACTGGGCCTGCGG + Exonic
1134524517 16:14933482-14933504 TCCCGGAGCAAGGTGGGCTGGGG + Intronic
1134548384 16:15127459-15127481 TCCCGGAGCAAGGTGGGCTGGGG - Intronic
1134712106 16:16331969-16331991 TCCCGGAGCAAGGTGGGCTGGGG + Intergenic
1134719963 16:16375262-16375284 TCCCGGAGCAAGGTGGGCTGGGG + Intergenic
1134896251 16:17889435-17889457 GCCCAGAGAAACAGGGGCTGGGG + Intergenic
1134947463 16:18336623-18336645 TCCCGGAGCAAGGTGGGCTGGGG - Exonic
1134954723 16:18376725-18376747 TCCCGGAGCAAGGTGGGCTGGGG - Intergenic
1136276795 16:29183583-29183605 TCCAGGAGCTGCTGGGGGTGCGG - Intergenic
1136500820 16:30669013-30669035 TCCAGGGGCAGCAGGGGCTGAGG - Intronic
1136716681 16:32287971-32287993 GCCCAGAGCATCTGGGGCCGTGG + Intergenic
1136835059 16:33494216-33494238 GCCCAGAGCATCTGGGGCCGTGG + Intergenic
1138229071 16:55324599-55324621 TCCCGGAGCAAGTGTGAGTGTGG + Exonic
1139349424 16:66325952-66325974 TCCCAGATCTGCTGGGGCTGGGG + Intergenic
1139654183 16:68377365-68377387 ACCAGGAGCGGCTGGGGCTGTGG - Intronic
1141589924 16:85061677-85061699 TCCCGGAACAACCAGAGCTGTGG - Intronic
1141638783 16:85329416-85329438 GCCCGCAGCCCCTGGGGCTGGGG - Intergenic
1141684303 16:85561670-85561692 TCCGGGGGCAGCTGGGGCCGGGG - Intergenic
1141961667 16:87413150-87413172 TCCCGGGGCAGCTGGTGATGGGG + Exonic
1142081174 16:88149643-88149665 TCCAGGAGCTGCTGGGGGTGCGG - Intergenic
1142214947 16:88825568-88825590 TTCCTGGGCAGCTGGGGCTGGGG + Intronic
1142309276 16:89302878-89302900 TCCAGGAGCACCCAGGGCTGTGG + Intronic
1203009744 16_KI270728v1_random:229816-229838 GCCCAGAGCATCTGGGGCCGTGG - Intergenic
1203145230 16_KI270728v1_random:1794537-1794559 GCCCAGAGCATCTGGGGCCGTGG + Intergenic
1143148260 17:4790176-4790198 TCCCGGAGCCACCGAGGCGGAGG + Exonic
1143166430 17:4899374-4899396 TCCAGGAGAACCTGGGGCAGGGG + Exonic
1143518175 17:7430289-7430311 TCCGGGAGGAGCTGGGGCAGAGG - Intergenic
1143765515 17:9135119-9135141 GCCGGGAGCATCAGGGGCTGGGG - Intronic
1144707621 17:17380047-17380069 TACTGGAGAAACTGAGGCTGAGG - Intergenic
1146255953 17:31391671-31391693 CTCCGGAGCGGCTGGGGCTGCGG + Exonic
1146679698 17:34798113-34798135 TCCCTGAGGAAGTGAGGCTGAGG - Intergenic
1148050461 17:44767654-44767676 TGCCGGGGCAGCTGGGGCTGGGG - Intronic
1149303768 17:55329025-55329047 TACCTGAATAACTGGGGCTGGGG - Intergenic
1149544959 17:57496604-57496626 TCCCGGAGCACACGGGGATGTGG - Intronic
1150310911 17:64129335-64129357 TCCTTGAGCAAGTGGAGCTGTGG - Intronic
1151258543 17:72898857-72898879 TCCCTGAGCAACTGCTGCAGGGG - Intronic
1152231429 17:79115794-79115816 TCCCGGAGCCCCTGAGGATGGGG + Intronic
1152713982 17:81889497-81889519 TCCAAGAGCACCTGGGTCTGAGG + Intronic
1152855752 17:82663935-82663957 CCCTGGTGCAGCTGGGGCTGGGG + Intronic
1203170098 17_GL000205v2_random:140633-140655 TCACAGGGCAACAGGGGCTGTGG + Intergenic
1154494168 18:14943843-14943865 TCAGGGAGAAATTGGGGCTGAGG + Intergenic
1158357548 18:56638207-56638229 TCCGGCAGCTCCTGGGGCTGCGG + Intronic
1158725678 18:59969577-59969599 TCCCGGAGCAGCTGGCCCTCGGG - Intergenic
1158763663 18:60421789-60421811 TCCCTGAGGAAGCGGGGCTGAGG + Intergenic
1161003825 19:1924651-1924673 TCCCAGAGCTGCTGGCGCTGAGG + Exonic
1161628469 19:5339901-5339923 TGCCAGAGCCCCTGGGGCTGGGG + Intronic
1162698404 19:12495476-12495498 TCCCAGAGCGACAGAGGCTGCGG - Intronic
1162933740 19:13970159-13970181 TCCAGGAGCCACTGGACCTGGGG + Exonic
1162971254 19:14182707-14182729 TCCCGGCCCAGCTGGGGCTATGG + Intronic
1163991328 19:21001736-21001758 ACCAGGAAGAACTGGGGCTGGGG - Intergenic
1164580622 19:29432879-29432901 TACCGTGGCACCTGGGGCTGGGG - Intergenic
1164654868 19:29913183-29913205 AGCCTGAGCAATTGGGGCTGTGG - Intergenic
1164738253 19:30558372-30558394 GCCCAGAGGAACTGTGGCTGGGG + Intronic
1164750973 19:30654423-30654445 TCCAGGAGAGACTGGGGATGGGG - Intronic
1165658002 19:37550488-37550510 TCACGGAGCAAAAGGGACTGGGG + Intergenic
1166684010 19:44784361-44784383 TCCAGGAGCACCTGGGACAGGGG - Exonic
1166773667 19:45299696-45299718 GCCCGGAGGGACTGGGGTTGAGG + Intronic
1167043371 19:47036022-47036044 TGCTGGAGCAACTGGGGCTGCGG + Exonic
1167501638 19:49851576-49851598 CCCCGGAGCGGCGGGGGCTGCGG - Intronic
1167547911 19:50140300-50140322 ACCCGGAGCCACTGTGGCTCCGG - Intergenic
1202713663 1_KI270714v1_random:30640-30662 TCCCGGTGCAGAGGGGGCTGTGG + Intergenic
927053379 2:19350406-19350428 TCCCGGAGGAGGTGGGGATGGGG + Intergenic
928206663 2:29289496-29289518 TCCCGAAGCTACAGGGGCTGGGG - Intronic
929571161 2:43024020-43024042 ACCTGGTGCAACTGAGGCTGAGG + Intergenic
932403106 2:71495782-71495804 GCCCGGAGTCACTGGGGCAGGGG + Intronic
932921033 2:75915993-75916015 TCTCTGTGCAACTGGGGGTGTGG + Intergenic
933078164 2:77955006-77955028 ACCCGGAGCCACTGTGGCTCCGG - Intergenic
937224159 2:120358638-120358660 TGCTGGAGCAACTGAGGCTGAGG + Intergenic
937356247 2:121199887-121199909 TCCAGGAGAACCTGGAGCTGGGG + Intergenic
937907982 2:127061623-127061645 TCCCGGAGGGGCTGAGGCTGAGG + Intronic
941890870 2:170579900-170579922 TCCCAGAGCAGCCTGGGCTGTGG - Intronic
943946724 2:194074579-194074601 TCCCTGTGCAGCTGGGTCTGGGG - Intergenic
945063941 2:205932471-205932493 TCCCGGAGTAGCTGGGACTACGG + Intergenic
946065811 2:216986201-216986223 TCCAGGAGCTACTGGGGCAGGGG - Intergenic
947257505 2:228181878-228181900 TCCTCGAGCAACTGAGACTGGGG - Intergenic
947461005 2:230305508-230305530 TCCCAGGGCAACTGGCTCTGGGG - Intronic
947635883 2:231680683-231680705 TCCTGGAGCTGCTGGGGCTCCGG + Intergenic
947846910 2:233251877-233251899 TCTCGGAGCAACTGAGGCGCCGG + Exonic
948207934 2:236172782-236172804 CCCCGGAGCCCCTGGGGCGGCGG + Intergenic
948633584 2:239318421-239318443 TCCCGGAGCAAAGGGGACTGGGG + Intronic
1169717013 20:8631172-8631194 TCCCAGACCTGCTGGGGCTGGGG - Intronic
1170205409 20:13792669-13792691 TCCCGGAGAAAAGAGGGCTGAGG + Intronic
1170536465 20:17345855-17345877 TAAAGGAGCAGCTGGGGCTGGGG + Intronic
1171420493 20:25014265-25014287 TGCCAGAGCTCCTGGGGCTGAGG - Intronic
1172176772 20:32977254-32977276 TTCCTGAGCAACTGTGACTGTGG - Intergenic
1172612730 20:36263875-36263897 TCCTGGAGCAGGTGGGGCTGAGG - Intronic
1175216068 20:57392130-57392152 TCCTGGAGCAGCGGGGGGTGAGG + Intronic
1175316850 20:58054713-58054735 TCCCGGAGCCTGTGGTGCTGTGG - Intergenic
1175973785 20:62700043-62700065 TCCGGGGGCAAGAGGGGCTGAGG - Intergenic
1176012740 20:62908351-62908373 TCACGGTGCAGCGGGGGCTGTGG - Intronic
1176238260 20:64064135-64064157 GCCCGCAGCAACTTGGGTTGTGG + Intronic
1178280292 21:31276751-31276773 TCTTGGAGCAAGTTGGGCTGGGG - Exonic
1179630461 21:42674665-42674687 TCCTGGAGGAAATGGGGCAGTGG - Intronic
1179840033 21:44066295-44066317 TCCAGGGGCGACGGGGGCTGAGG + Intronic
1180744487 22:18078310-18078332 TCCCGGAGCCTCTGGGGAGGCGG + Exonic
1181061509 22:20284198-20284220 TCCCAGAGGAAGTTGGGCTGGGG - Intergenic
1183419272 22:37701227-37701249 AACTGGGGCAACTGGGGCTGGGG + Intronic
1184757659 22:46526066-46526088 TCCCCGGGCAGCTGGTGCTGAGG + Intronic
1185400013 22:50610812-50610834 TCCAGGCGCAGCTGGGGCTGAGG + Exonic
1203292940 22_KI270736v1_random:13282-13304 TCTGGGAACAACTGTGGCTGGGG - Intergenic
949301519 3:2589678-2589700 TCCAGTATCAGCTGGGGCTGCGG + Intronic
950471062 3:13186737-13186759 TCCCTGAGGCACAGGGGCTGGGG + Intergenic
952834908 3:37594262-37594284 ACCAGGAGCAAGTGGAGCTGGGG + Intronic
953989768 3:47475482-47475504 TCCCGGAGCAACTAGGCCAGGGG + Intronic
954601590 3:51874766-51874788 TCCCGGACCATATAGGGCTGGGG - Intronic
955531371 3:59876462-59876484 TCCCACAGCAGCAGGGGCTGGGG - Intronic
958977257 3:100682274-100682296 CCCAGGAGGAACTGGGTCTGGGG + Intronic
959744040 3:109755765-109755787 TACCAGAGGAACTGGGGCAGGGG - Intergenic
960614907 3:119587582-119587604 TCCCTGAGCTACTCTGGCTGGGG + Exonic
960801586 3:121545704-121545726 TCCTGGAGCACCTGCAGCTGCGG + Exonic
961359977 3:126360831-126360853 TCCAGAAGCAGCAGGGGCTGAGG + Intergenic
961543019 3:127613027-127613049 TCCTGGAGTAACTGGGTCAGCGG + Intronic
965112311 3:164443405-164443427 AACTGGAGCAACTGGGGCAGGGG + Intergenic
968482954 4:844886-844908 GCCCGGCACACCTGGGGCTGGGG + Intergenic
968660495 4:1796837-1796859 TCCCTGAGCTCCTGGGCCTGTGG + Intronic
974448543 4:62018739-62018761 TCCTGCTGGAACTGGGGCTGAGG + Intronic
978945464 4:114490638-114490660 TCCTGGACATACTGGGGCTGGGG - Intergenic
981175435 4:141677532-141677554 TCCTTGAACAACTCGGGCTGGGG - Intronic
981757784 4:148160219-148160241 TCCCCGAGGAACTGGCACTGGGG + Intronic
985423315 4:189805485-189805507 TCCGGGATCAACTAGAGCTGAGG + Intergenic
985789198 5:1916223-1916245 TCCCGGAGCAGGGAGGGCTGTGG - Intergenic
987414550 5:17649227-17649249 TGCAGGAGGAACTGAGGCTGAGG - Intergenic
993443184 5:87980486-87980508 ACGCAGAGAAACTGGGGCTGAGG - Intergenic
999348518 5:150845473-150845495 ACGGGCAGCAACTGGGGCTGCGG + Intergenic
1001010595 5:168094414-168094436 TCACTGAGCATCTGGGTCTGGGG - Intronic
1001051943 5:168420747-168420769 TGCAGGAGCAGCTGAGGCTGAGG - Intronic
1002076990 5:176714216-176714238 GCCTGGATCAACTAGGGCTGTGG - Intergenic
1002474100 5:179454196-179454218 GCCTGGAGCAGGTGGGGCTGGGG - Intergenic
1003325893 6:5090534-5090556 TTCAGGAGCAACTGGGAATGGGG + Intergenic
1003624150 6:7727259-7727281 TGCCGGAGCGCCGGGGGCTGCGG - Exonic
1006171359 6:32095247-32095269 TCCCTGAGTAAAAGGGGCTGTGG - Intronic
1006512720 6:34530315-34530337 TGCCGGGGCCACTGGTGCTGCGG - Exonic
1007179150 6:39915827-39915849 TCCTGGGCAAACTGGGGCTGGGG + Intronic
1012694127 6:102355912-102355934 TCCAGGAGCAACAGGGGTGGGGG + Intergenic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1019557229 7:1638673-1638695 TCCCAAAGCCACTGGGGCTGCGG + Intergenic
1021670826 7:23033230-23033252 TCCCAGATCCACTGTGGCTGGGG - Intergenic
1021992684 7:26152757-26152779 TCCCGGAGCAGCTGGCCCTCGGG - Exonic
1022394018 7:29969623-29969645 TCCAGGAGCAGCTGGGGAGGTGG - Intronic
1022446353 7:30473792-30473814 TCACTGAGCAGCTGGGGCAGTGG + Intronic
1025191558 7:56899463-56899485 TGCTGGAGCATGTGGGGCTGAGG - Intergenic
1025680389 7:63677471-63677493 TGCTGGAGCATGTGGGGCTGAGG + Intergenic
1025993503 7:66513368-66513390 TCCCGAAGCAGTTGGGTCTGCGG - Intergenic
1026034911 7:66824056-66824078 TCCCGAAGCAGTTGGGCCTGCGG + Intergenic
1026984675 7:74547206-74547228 TCCCGAAGCAGTTGGGCCTGCGG - Exonic
1027214834 7:76177047-76177069 TCCCGAAGCAGTTGGGCCTGTGG - Intergenic
1029609895 7:101621278-101621300 TGCTGGAGCATCTGGGGCAGGGG + Intronic
1030065460 7:105655780-105655802 TCCCGGAGCAACTGGGGCTGAGG - Intronic
1034264477 7:149774211-149774233 CCCCTGAGGAGCTGGGGCTGAGG - Intergenic
1035013298 7:155740003-155740025 TGCCGGAGCCCCTGGCGCTGGGG - Exonic
1037549710 8:19958391-19958413 ACCCTGAGCAAATGGGCCTGGGG - Intronic
1037919082 8:22791217-22791239 TCCTGGAGAAGCTCGGGCTGAGG + Intronic
1040890716 8:52313798-52313820 TCCCGCAGCAATGGGAGCTGTGG + Intronic
1049192218 8:141294759-141294781 TCCCGCACCAACTGGGCCTGGGG - Intronic
1049415154 8:142491687-142491709 GCCAGGAGGGACTGGGGCTGAGG - Intronic
1049443510 8:142619698-142619720 TCCCGCAGCCCCAGGGGCTGGGG - Intergenic
1051278420 9:15418715-15418737 ACTTGGAGCTACTGGGGCTGAGG - Intergenic
1058637348 9:107049391-107049413 TCCCGGAGCAGCTGGGAATTGGG - Intergenic
1061084785 9:128392601-128392623 TCCGGGCGCAACAGGGGCGGGGG - Intergenic
1061193654 9:129095970-129095992 CCCCGGGGCACCTGGGGCAGTGG + Intronic
1062551835 9:137091309-137091331 TCCAGGAGCAGCTGGGGTGGTGG + Intronic
1062598156 9:137308334-137308356 TCAAGGAGGAGCTGGGGCTGGGG - Intronic
1185461005 X:332774-332796 GCCCGGGGCATCTGGGGTTGTGG + Intergenic
1186841918 X:13493091-13493113 TCCCCGAGCAGCTGGGACTAGGG + Intergenic
1188030693 X:25260264-25260286 TCCCAGAGCTAGTGGGGGTGGGG + Intergenic
1188739821 X:33764294-33764316 GCCCAGAGGCACTGGGGCTGAGG - Intergenic
1191757422 X:64608911-64608933 TACCTGAGCAACTTGGGCAGTGG + Intergenic
1192226018 X:69228460-69228482 TCACGCAGCCACTGTGGCTGTGG - Intergenic
1196022299 X:111002973-111002995 CCCTGGACCAACTGGGGCTGGGG + Intronic
1196627525 X:117893640-117893662 TCCCCTAGCAACTGGGCCAGGGG + Intergenic