ID: 1030068257

View in Genome Browser
Species Human (GRCh38)
Location 7:105677029-105677051
Sequence GATCCTCCCTCCACGGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030068257_1030068265 0 Left 1030068257 7:105677029-105677051 CCAGGCCCCGTGGAGGGAGGATC 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1030068265 7:105677052-105677074 CTGGCTGCAGGAGGCAGAGCAGG No data
1030068257_1030068263 -9 Left 1030068257 7:105677029-105677051 CCAGGCCCCGTGGAGGGAGGATC 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1030068263 7:105677043-105677065 GGGAGGATCCTGGCTGCAGGAGG 0: 1
1: 0
2: 4
3: 61
4: 466
1030068257_1030068266 7 Left 1030068257 7:105677029-105677051 CCAGGCCCCGTGGAGGGAGGATC 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1030068266 7:105677059-105677081 CAGGAGGCAGAGCAGGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030068257 Original CRISPR GATCCTCCCTCCACGGGGCC TGG (reversed) Intronic
900032676 1:382177-382199 GATCTTCCGTCCACCAGGCCAGG + Intergenic
900053434 1:611239-611261 GATCTTCCGTCCACCAGGCCAGG + Intergenic
900160736 1:1222317-1222339 GGGCCACCCTGCACGGGGCCAGG - Intronic
900339160 1:2179722-2179744 GCTCCTCCCACCCCGGGCCCAGG + Intronic
900548387 1:3241389-3241411 GATCCTCTGGGCACGGGGCCTGG - Intronic
901026039 1:6279254-6279276 TGTCCTCCCTCCACGTCGCCTGG - Intronic
902581551 1:17410771-17410793 GATGTTCCCTCCAAGGTGCCAGG + Intronic
902741665 1:18442713-18442735 GATCCTCCCACCTCGGCCCCTGG - Intergenic
904533882 1:31186572-31186594 GATCCTGCCTCCACCTGCCCTGG - Intronic
906216465 1:44043802-44043824 GCTCCTCCCTCCACGGACTCAGG - Intergenic
906280078 1:44547050-44547072 GATGCTTCCTCCAGGGTGCCTGG + Intronic
907524066 1:55043821-55043843 GTTCCTCCTTGCATGGGGCCAGG + Exonic
908581873 1:65525421-65525443 GGTCCTCCCTCCCCAGCGCCGGG + Intronic
909320578 1:74280609-74280631 AATGCTCCCTCCATGGGGGCTGG - Intronic
909604825 1:77497691-77497713 GATCCTCCCACCTCGGCCCCCGG + Intronic
909973319 1:82017026-82017048 GCTCCTCCCACCACGGAGCTGGG - Intergenic
910251111 1:85200619-85200641 CATCCTGCCTCCACGTGGCGGGG + Exonic
913170546 1:116228398-116228420 GATCCTCCCTTCAGAAGGCCAGG + Intergenic
914260712 1:145996860-145996882 GATCCTCCTTCCACTGGACCCGG - Intergenic
915646233 1:157274683-157274705 GAGCCTTCCTCCAGGGGGACTGG - Intergenic
917428082 1:174936486-174936508 GATCCTCCCACCACAGGAGCTGG - Intronic
919230220 1:194764013-194764035 GATCCTTCCTCAACGGGACTTGG + Intergenic
924771990 1:247087345-247087367 GTTCCTGCCTGCAGGGGGCCTGG + Intergenic
1062906607 10:1183830-1183852 GATACCCCCACCACGGGGCAGGG + Intronic
1063418088 10:5889815-5889837 GAGCCACCCTGCACGGCGCCGGG - Exonic
1063908378 10:10803875-10803897 TATACTCACTCCATGGGGCCAGG + Intergenic
1070802996 10:79254512-79254534 GATCCACCCACGATGGGGCCTGG + Intronic
1076414110 10:130272937-130272959 GAGCCTCCTCCCACGGGTCCAGG - Intergenic
1076488106 10:130837151-130837173 GTTTCTCCCTCCAAGGAGCCTGG + Intergenic
1076672405 10:132130569-132130591 GATCCTGGCTCCATGGGCCCTGG + Intronic
1076821128 10:132940115-132940137 GATCCTCTCTGCATGGGGACAGG - Intronic
1077444458 11:2583850-2583872 GATTCTGCCTCCATGGGGCGTGG - Intronic
1081981337 11:47269198-47269220 GACTCTCCCTCCTCTGGGCCTGG - Intronic
1083965600 11:66042140-66042162 GAGCCTCTCTCCATGGGGCCTGG + Exonic
1084275588 11:68049543-68049565 GCTCCTCCCTCCAGGGCCCCCGG - Intronic
1084463209 11:69307701-69307723 GAACCTCCCCCCAAGGGACCGGG - Intronic
1085970079 11:81578656-81578678 GATCCACCCTCAACGTGGGCAGG + Intergenic
1088470384 11:110183245-110183267 GCTCCTCCCTCCACGTAGACTGG - Intronic
1088819735 11:113447153-113447175 GCCCCACCCTCCCCGGGGCCTGG + Intronic
1089359730 11:117877707-117877729 GCTCCTCCCTCCACCCGGCTCGG - Intergenic
1089646121 11:119880244-119880266 GATCCTCCCTCCTCCAGGACAGG - Intergenic
1090237847 11:125162933-125162955 ACTCCTCCCTCCAGGGGTCCTGG + Intergenic
1090403972 11:126466378-126466400 GATACCCGCTGCACGGGGCCTGG - Intronic
1091700220 12:2654133-2654155 GAGCCTCCCTCCCCGAGGCCTGG + Intronic
1092280359 12:7093208-7093230 CCTCCTCCCTCCCAGGGGCCTGG - Intronic
1096137286 12:49212944-49212966 GATCCTTCCTGCACGGCGCTGGG + Intronic
1096386497 12:51198196-51198218 TATCCCCCCTCCCTGGGGCCAGG + Intronic
1098045800 12:66399196-66399218 CTTCCTCCCTCCACCGTGCCAGG + Intronic
1099859599 12:88210098-88210120 GGTCCTCCCTCAAGGGGACCTGG + Intergenic
1100083113 12:90876756-90876778 GGTCCTTCCTCAACGGGACCCGG - Intergenic
1102101620 12:110282161-110282183 GTCCCTCCCTCCACCGGGGCCGG - Intronic
1102370842 12:112381742-112381764 CTCCCTCCCTCCTCGGGGCCTGG - Intronic
1104676825 12:130716808-130716830 GATCTTCCCTGCAGGAGGCCGGG + Intergenic
1105914254 13:24897904-24897926 GAGACTCCGTCCACGGGGCGGGG - Intronic
1108572483 13:51765118-51765140 GTTCCTGCCTCCACAGGGCCAGG - Exonic
1111738862 13:92176693-92176715 GAACCTCCCTCCAGAGTGCCTGG + Intronic
1117978642 14:61321495-61321517 GATCCACCCACCGCAGGGCCGGG + Intronic
1119059902 14:71463620-71463642 GATCCTTCCTCAAGGGGACCCGG + Intronic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1119226232 14:72946538-72946560 GACCGTCCCTCCAGGGGTCCAGG + Intronic
1119322699 14:73741036-73741058 GATCCTGCCTCCACCCTGCCAGG - Intronic
1122507102 14:102238644-102238666 GAGCCTTCCTCCAGGGGGACTGG + Intronic
1125546726 15:40511674-40511696 GACGCTCCCTCCCCAGGGCCCGG + Intergenic
1125879956 15:43185328-43185350 CCTCCTCCCGCCACGAGGCCCGG - Exonic
1126997577 15:54462564-54462586 GCCCCTCACTCCCCGGGGCCGGG - Intronic
1128130313 15:65222958-65222980 GATCTTCCCTCCAGGGTGCCAGG + Intergenic
1128732994 15:70033663-70033685 GATGCCCCCTCCCCGGGGCAGGG + Intergenic
1131399799 15:92115243-92115265 GCTCCTACCTCCAGAGGGCCAGG - Intronic
1133232524 16:4373291-4373313 CATCCTCCCTCCCCAGGCCCAGG - Intronic
1135937696 16:26795227-26795249 GACCCTCCCGCCACTGGCCCAGG + Intergenic
1139548838 16:67662399-67662421 GGTCCTCCCTCTGCAGGGCCTGG + Exonic
1139782874 16:69366229-69366251 GATCCTCCCTCCAGGCAGACTGG - Intronic
1139968830 16:70761237-70761259 GAGCCTCACTCCATGGGGACTGG + Intronic
1141437527 16:84008870-84008892 CATCCACCCTCCACGGGGCATGG + Intergenic
1141607130 16:85160407-85160429 GGTCCTGACTCCACCGGGCCTGG - Intergenic
1142197682 16:88746261-88746283 GGGCCTCCCTGCACGGGGCATGG + Intronic
1142412442 16:89923484-89923506 CCTCCTCCCGCCCCGGGGCCCGG - Intronic
1142413122 16:89926163-89926185 GCTCCTCCCTCCCCGGGGCGGGG + Intronic
1142698278 17:1645284-1645306 GATCCACCTTCCTCAGGGCCAGG - Intronic
1143237672 17:5417360-5417382 GATCCTCCCACCTCAGCGCCTGG - Intronic
1143452534 17:7044059-7044081 GCTCCCCCCTCCCCCGGGCCTGG - Intergenic
1143804857 17:9417872-9417894 CATGCTCACTCCACGGGGACAGG + Intronic
1143896627 17:10141548-10141570 GTTACTCCCTCCACAGAGCCCGG + Intronic
1144375499 17:14635925-14635947 TACCCCCACTCCACGGGGCCAGG - Intergenic
1144495067 17:15740829-15740851 CATGCTCCCTCCCCTGGGCCAGG - Intronic
1144848596 17:18232825-18232847 GATCCTCCCTGCCCGGTGGCTGG - Intronic
1150326529 17:64262862-64262884 GTGCCTCCCTGCCCGGGGCCGGG + Intronic
1152897615 17:82922118-82922140 GATCCACCCGCCACTGCGCCGGG - Intronic
1152947264 17:83205008-83205030 GATCTTCCGTCCACCAGGCCAGG - Intergenic
1153772290 18:8425786-8425808 AATGCTCCCTCCAGGTGGCCGGG - Intergenic
1158642734 18:59217637-59217659 GATACTGCCTCCACAGTGCCTGG - Intergenic
1159915238 18:74182523-74182545 GAGCCGTCCTCCCCGGGGCCGGG + Intergenic
1160354632 18:78216536-78216558 GATCCTGTCCCCACTGGGCCAGG + Intergenic
1161152695 19:2717931-2717953 CCTCCTCCCTCCCCGGGGCGTGG - Intronic
1161512524 19:4679546-4679568 GTTCCTCCCTCCATTAGGCCCGG + Intronic
1161664311 19:5565669-5565691 GATCTTCCCTCAAGAGGGCCTGG + Intergenic
1162555532 19:11383636-11383658 CTCCCTCCCTCCACCGGGCCGGG + Intronic
1163311053 19:16514800-16514822 GAGGCTCCCTCCACAGGGACAGG - Intronic
1163458146 19:17420664-17420686 GCTCCTCCCTGCAAGGGACCCGG - Intronic
1165145520 19:33727653-33727675 GTTCCTCCTTCCGGGGGGCCTGG - Intronic
1166337142 19:42115222-42115244 GAACTTCCTTCCACTGGGCCTGG - Intronic
1166354067 19:42216965-42216987 CCTCCTCCCAGCACGGGGCCGGG + Exonic
1166727482 19:45037674-45037696 GTGCCTCCATCCCCGGGGCCCGG - Exonic
1166962130 19:46503623-46503645 GATCTTACGTGCACGGGGCCTGG + Intronic
1168177081 19:54633781-54633803 GAGCTTCCCTCCAGGGAGCCGGG + Intronic
925898103 2:8488632-8488654 GATTCTGCATCCTCGGGGCCTGG - Intergenic
926121235 2:10242234-10242256 GATGCCCCCTCCCCGGAGCCGGG + Intergenic
926701354 2:15806167-15806189 GATGCTCCATCCCCAGGGCCTGG + Intergenic
926784664 2:16508085-16508107 GATCCCCCCACCGCGAGGCCTGG + Intergenic
927886315 2:26720938-26720960 AATCCCCCCTGCACTGGGCCTGG - Intronic
929720376 2:44361888-44361910 CACCCTCCCTCCACCGGACCAGG - Intergenic
931446729 2:62333009-62333031 GTTCCTCCCTCCACAGTGTCAGG - Intergenic
931559291 2:63540857-63540879 GATCCTCCCTCCAAGTAGCTGGG + Intronic
934576815 2:95407136-95407158 GGTCCTCCCACCACAGAGCCAGG + Exonic
934639034 2:96015304-96015326 GGTCCTCCCACCACAGAGCCAGG + Intergenic
934794614 2:97090108-97090130 GGTCCTCCCACCACAGAGCCAGG - Exonic
935676234 2:105597047-105597069 TATCGTCCCTGCACAGGGCCCGG + Intergenic
937307688 2:120882209-120882231 CATCCTCCTTCCAGGAGGCCAGG + Intronic
937677424 2:124607516-124607538 CATCCTCCCTCCAAGTGGGCTGG - Intronic
937917636 2:127106769-127106791 TATCCTCCGACCCCGGGGCCTGG - Intronic
941422688 2:165302754-165302776 CATCCTCGCTCCACGGAGACAGG + Intronic
943318048 2:186413133-186413155 GATCCTTCCTCAAGGGGACCTGG + Intergenic
946518971 2:220445936-220445958 GATCCTCCCTGCACGGTGGGTGG - Intergenic
946903746 2:224396467-224396489 GACCATCCCTCCACATGGCCAGG - Intronic
947541456 2:230982636-230982658 GATCCTCCCACCACAGTGCTGGG - Intergenic
948468270 2:238162449-238162471 CTTCTTCCCTCCACGAGGCCTGG + Intronic
948479409 2:238240549-238240571 GACCCTGCCTCCCCGGGGCTTGG - Intronic
948577798 2:238965460-238965482 CCTCCTGCCTCCACCGGGCCCGG + Intergenic
1170683033 20:18543840-18543862 AATCCACCCTCCAGGGTGCCAGG + Intronic
1173243414 20:41317563-41317585 GGGCCTCCCTCCCCGCGGCCGGG + Intronic
1178669499 21:34578466-34578488 TATCATCTCTCCACTGGGCCTGG + Intronic
1179225790 21:39451880-39451902 GCTCCTCCCTCCATTGGCCCAGG - Exonic
1180783673 22:18535379-18535401 GACCCTCCTCCCACTGGGCCAGG - Intergenic
1180855776 22:19043829-19043851 TGTCCTCCTCCCACGGGGCCAGG + Intronic
1181127243 22:20709430-20709452 GACCCTCCTCCCACTGGGCCAGG - Intronic
1181240576 22:21474731-21474753 GACCCTCCTCCCACTGGGCCAGG - Intergenic
1181776152 22:25161409-25161431 GATGCTGCCTCCACGGGCCCAGG - Intronic
1181857654 22:25793567-25793589 GAGCCTCCATGCACGGGGCAAGG + Intronic
1182488058 22:30651028-30651050 GCTACTCCTTCCAGGGGGCCAGG - Intronic
1184295185 22:43518896-43518918 GTTCCTCCCTCCAGGGGGAGAGG - Intergenic
1184593838 22:45502756-45502778 GACCCTCCCTCCCCGGACCCCGG - Intronic
1184679422 22:46062082-46062104 GCACCTCCCGCCCCGGGGCCGGG + Intronic
1185095396 22:48803585-48803607 GATCCTCACTGCTCAGGGCCAGG + Intronic
1185342339 22:50297256-50297278 GCTCCAGCCTCCACGGGCCCAGG + Intronic
950185073 3:10939774-10939796 GCTCCTCTCTCCGTGGGGCCTGG + Exonic
954838194 3:53489677-53489699 GTTCCTCCATCCACAGGCCCTGG - Intergenic
954901113 3:54020925-54020947 GGTCTTGCCTCCACTGGGCCTGG - Intergenic
957037640 3:75309752-75309774 CATCCTCCTTGCACAGGGCCAGG - Intergenic
959788870 3:110332894-110332916 GCTCCTCCCATCACAGGGCCAGG - Intergenic
959997425 3:112694521-112694543 GATCCTTCCTCAAGGGGACCAGG - Intergenic
961085671 3:124065288-124065310 CATCCTCCTTGCACAGGGCCGGG - Intergenic
961600769 3:128059964-128059986 GATACTACCTCCAAGGGGCTCGG - Intronic
961641985 3:128370568-128370590 TCTCCTCCCTCCACAGGCCCTGG - Intronic
962317744 3:134369282-134369304 GCTCCCCCCTGCACTGGGCCAGG + Intronic
963112519 3:141699184-141699206 GAGCCTTCCTCCAGGGGGGCTGG - Intergenic
964004448 3:151811446-151811468 GAGCCTCCCTTCAAGGGGACTGG + Intergenic
965079789 3:164021271-164021293 GAGCCTCCCTTCAAGGGGACTGG - Intergenic
968905575 4:3449194-3449216 GAGCCACCCTCCCAGGGGCCTGG - Intronic
976053144 4:81031510-81031532 GAGCCTCCCTCCAGGGAGCCCGG - Exonic
981558753 4:146024159-146024181 GATCTTCCCTCCACGCCTCCAGG + Intergenic
982298977 4:153859662-153859684 GATCCCACCCCCACGGAGCCAGG - Intergenic
988607199 5:32689115-32689137 GAACATCCCTCCCCAGGGCCAGG - Intronic
989097624 5:37795850-37795872 GATCCTTCCTCAAGGGGACCTGG - Intergenic
989456767 5:41653170-41653192 GATCCTGCAACCACAGGGCCTGG + Intergenic
990468588 5:56092281-56092303 GATCCTCCCACCTCGGCCCCTGG - Intergenic
998385162 5:141753311-141753333 GAACGTCCCTCCCCGGGGCGGGG + Intergenic
999103312 5:149046062-149046084 GAACATCCCTCCACCAGGCCAGG + Intronic
999316261 5:150585950-150585972 GCTCCTCCTTCCATGGGGCCTGG - Intergenic
1000833706 5:166131806-166131828 GAGCCTCCCTCCAAGGGGATTGG - Intergenic
1001318597 5:170662307-170662329 GCTCCTCCCTCAACAGTGCCAGG - Intronic
1002061679 5:176629446-176629468 GAACCCCCCTCCCCGGGACCCGG + Intronic
1002137651 5:177117702-177117724 GATCCTCCCTCCTCGGCCACCGG - Intergenic
1002741144 5:181436691-181436713 GATCTTCCGTCCACCAGGCCAGG - Intergenic
1003359024 6:5405785-5405807 GAACCTTGCTCCACTGGGCCGGG - Intronic
1003696111 6:8407627-8407649 GGTCCTTCCTCAAGGGGGCCTGG + Intergenic
1004022494 6:11788030-11788052 GAGCCTCCCTTCAAGGGGACTGG + Intronic
1004367168 6:15022106-15022128 GAGCCTCCATCCACCAGGCCTGG + Intergenic
1004619786 6:17322519-17322541 GAACCTCCCTTCAAGGGGACTGG - Intergenic
1005559073 6:27019705-27019727 GAGCATCCCTCCCCGGGACCTGG - Intergenic
1007777844 6:44233672-44233694 GAGGCTCCCTCCCCAGGGCCTGG - Exonic
1008642119 6:53474752-53474774 GATGCTCCCTCCATGGGCACTGG + Intergenic
1010830052 6:80516253-80516275 GATCCTCCCTCCAAGAAGCCAGG + Intergenic
1016359136 6:143249456-143249478 GTTCACCCCTCCACGAGGCCTGG - Intronic
1016629711 6:146214098-146214120 GATCCACCCTCAAAGTGGCCAGG - Intronic
1018727050 6:166620997-166621019 AATCCTACCTCCACGGGGCAAGG + Intronic
1018900523 6:168049715-168049737 AATCTTCCCTCCTCGGGGCCTGG - Intergenic
1019246257 6:170712388-170712410 GATCTTCCGTCCACCAGGCCAGG - Intergenic
1019544591 7:1567597-1567619 GTTCCTCCCTCCACCGGGGAGGG + Exonic
1020396508 7:7724054-7724076 GATCCTTCCTCAAGGGGACCCGG - Intronic
1020994478 7:15245497-15245519 GATCCTCCCTCAACTTGGCAAGG + Intronic
1023879267 7:44309203-44309225 GCTCCTCCCTGCAGGGGGCTGGG + Intronic
1024825845 7:53388195-53388217 TTTCCTCCCTCCATGGGCCCAGG - Intergenic
1024884549 7:54126131-54126153 GATCCTTCCTCAAGGGGACCTGG + Intergenic
1025230479 7:57200785-57200807 GACCCTCCCTCAGCAGGGCCAGG - Intergenic
1027223921 7:76232330-76232352 GATCTGCCCTCCTCGTGGCCAGG - Intronic
1027668800 7:81071437-81071459 GTTCCCTGCTCCACGGGGCCGGG + Intergenic
1029461382 7:100695634-100695656 GATCCTCCTTCCAAAGTGCCGGG + Intergenic
1029461394 7:100695675-100695697 GATCCTCCTTCCAAGGTGCCGGG + Intergenic
1030068257 7:105677029-105677051 GATCCTCCCTCCACGGGGCCTGG - Intronic
1033535995 7:142312725-142312747 CACCCTCCCTCCACAGAGCCGGG + Intergenic
1035470255 7:159104828-159104850 TATCCTCCCTCCTCCTGGCCAGG + Intronic
1035501814 8:95301-95323 GATCTTCCGTCCACCAGGCCAGG + Intergenic
1038450521 8:27636329-27636351 GATCCTCCCTCCTCGGGCTCCGG - Intronic
1041153173 8:54957281-54957303 GATCCTTCTTCCTAGGGGCCTGG + Intergenic
1043438098 8:80253624-80253646 CACCCTCCCTCCAAGGGGCAGGG + Intergenic
1044082564 8:87903829-87903851 AATCTTCCCTCCAGTGGGCCTGG - Intergenic
1044468877 8:92541623-92541645 GATCCTCCCTCCATGTGACTGGG + Intergenic
1044815417 8:96107710-96107732 GAGACTCCCCCCAGGGGGCCAGG + Intergenic
1048102696 8:131371428-131371450 GTTCCTCCCTCCCCAGGGGCTGG + Intergenic
1049697351 8:143990640-143990662 GATCCCCCCACCCCGGAGCCAGG + Intronic
1051265588 9:15306464-15306486 CCCTCTCCCTCCACGGGGCCGGG - Intronic
1051881937 9:21849170-21849192 GGTCCTTCCTCAACGGGACCTGG - Intronic
1061451201 9:130667769-130667791 GATCCTCCCTCTCTGAGGCCTGG + Intronic
1062195821 9:135273392-135273414 GATGCCCCCTCCCCGGGCCCTGG - Intergenic
1062390742 9:136332758-136332780 GATCCTCTCACCTCAGGGCCAGG - Intronic
1203607022 Un_KI270748v1:67771-67793 GATCTTCCGTCCACCAGGCCAGG - Intergenic
1186534309 X:10330628-10330650 GAGCTTCCCTCCATGGGGCTTGG - Intergenic
1191946163 X:66537526-66537548 GATCCTTCCTCAAGGGGGCCTGG - Intergenic
1193699255 X:84742626-84742648 GAACCTTCCTCCAGGGGGACAGG + Intergenic
1196290116 X:113929984-113930006 GATGTTCCCTCCACGGGCACTGG + Intergenic
1197191080 X:123648523-123648545 GATCCCACCCCCACGGAGCCCGG + Intronic
1198083871 X:133264895-133264917 GATCCTCCGTCCTCGGTCCCCGG - Intergenic