ID: 1030076722

View in Genome Browser
Species Human (GRCh38)
Location 7:105743267-105743289
Sequence CTGTGCCAAGAACTGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 326}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030076718_1030076722 -5 Left 1030076718 7:105743249-105743271 CCAAGAATGATTACATATCTGTG 0: 1
1: 0
2: 4
3: 37
4: 439
Right 1030076722 7:105743267-105743289 CTGTGCCAAGAACTGGGGCCAGG 0: 1
1: 0
2: 4
3: 35
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030076722 Original CRISPR CTGTGCCAAGAACTGGGGCC AGG Intronic
900234756 1:1582925-1582947 CTGGGCCTGGAACTGGGGCTGGG - Intergenic
900312027 1:2038199-2038221 CTATGCCAAGCACAGGGCCCTGG - Intergenic
900339391 1:2180901-2180923 CATTGCCAAGAACTGGCTCCAGG + Intronic
901053373 1:6437136-6437158 CCGTGCCAGGAACTTGGGCTGGG + Intronic
901863485 1:12089270-12089292 ATGTGCCAAGCCCTGGGGTCAGG - Intronic
901895467 1:12308128-12308150 CTGTGACAACAACTGAGGCTGGG - Intronic
901924180 1:12555459-12555481 TTGTGCCAAGCCTTGGGGCCTGG + Intergenic
902247153 1:15128600-15128622 CTGTGGCATGACCAGGGGCCTGG + Intergenic
902330977 1:15731138-15731160 CTGTCCCAGGAACTGGGGCCAGG - Intronic
902480903 1:16711027-16711049 CCGTGCCAGGAACTTGGGCTGGG - Intergenic
902631167 1:17705533-17705555 CTGGGCCATGAGCTGGGGCTGGG + Intergenic
902660180 1:17895582-17895604 CCGTGCCAATCACTGTGGCCAGG + Intergenic
902691065 1:18110330-18110352 CTGTGCCCAGAATGGGGGGCGGG + Intronic
904296213 1:29521344-29521366 CTGTGCCAAGCCCTGGGAGCTGG + Intergenic
904410118 1:30320102-30320124 CTGTGCCAAGGCCTGGGAGCCGG - Intergenic
905067926 1:35199233-35199255 CTGTGCAAAGAGCCGGGGCGGGG - Intergenic
905276697 1:36823049-36823071 CAGTTCCAAGAAATGGGGCCTGG - Intronic
905352974 1:37360248-37360270 CTGTGACAAGAACGGGGGACTGG + Intergenic
905473249 1:38208362-38208384 TTGTGACCAGAGCTGGGGCCTGG + Intergenic
906590491 1:47020576-47020598 ATGTGCCCAGCACAGGGGCCTGG + Intergenic
906962606 1:50427496-50427518 CTATGCCACGACCTGGGACCGGG + Intergenic
907456838 1:54581612-54581634 CTGTGCCAAGTGCTGGCCCCAGG - Intronic
907830921 1:58063467-58063489 CTGTGCCAAGTGTGGGGGCCCGG - Intronic
908985045 1:70007283-70007305 CTGTGCCAAGAACTGGATGAAGG + Intronic
909394874 1:75159223-75159245 CTTTACCAATAAATGGGGCCAGG - Intronic
909445231 1:75742164-75742186 TTGAGCCAAGAAGTGAGGCCTGG - Intronic
910413666 1:86973967-86973989 CTGTGTCAGGAACTGGGGGTAGG - Intronic
910552043 1:88486320-88486342 CTGTGTCAAGACCTGGTACCAGG - Intergenic
912485450 1:110023919-110023941 CTGTGCCAAGCACCGGGCCTGGG + Intergenic
913087942 1:115456531-115456553 CTGGGCCAAGCATTGGGGCTTGG - Intergenic
914750618 1:150532548-150532570 CTTTGCCTAGAATGGGGGCCAGG + Intergenic
914941603 1:152028204-152028226 CTTTACCAAGAAATCGGGCCGGG + Intergenic
915467027 1:156103931-156103953 ATGTCCCAGGAACTGAGGCCGGG - Intronic
915980158 1:160415431-160415453 CTGTGCCAAGGACTCAGGCATGG - Intronic
917689676 1:177455866-177455888 TTATCCCAATAACTGGGGCCAGG - Intergenic
920057739 1:203205181-203205203 CTTGGCCAAGCACAGGGGCCTGG - Intergenic
920081948 1:203381346-203381368 CAATGCCAAGAACTGGGGGAGGG + Intergenic
920258813 1:204674889-204674911 CTGTGCTAAGAACTGGGCAGAGG - Intronic
922480561 1:225937692-225937714 GTGGGCCAAGAACTGGGTGCTGG - Exonic
922483728 1:225957375-225957397 CTCTCCCTAGAACTGGGCCCAGG - Intergenic
922792409 1:228317613-228317635 CTGTGCCACGAGCTGGTGCCTGG + Exonic
923704553 1:236333363-236333385 CTGTCCTAAGAACTGGCACCTGG - Intergenic
923791644 1:237116324-237116346 CTGTGCCAGAAACTGTGGTCAGG + Intronic
924135994 1:240967555-240967577 TTGTGCCAAGAAGTGGGGGGGGG + Intronic
924376423 1:243414022-243414044 GTGTGCCAAGCACTGAGGCTGGG + Intronic
1063216772 10:3932385-3932407 CTGTGGCAAGGGCTGGGGGCAGG + Intergenic
1068976569 10:63016491-63016513 CTGTGGCCAGGACTGGGGCATGG - Intergenic
1070829971 10:79412102-79412124 CTGTGCCCTGAACTGGGCCTGGG + Intronic
1071509022 10:86249829-86249851 CTGTACCAGGAACTGGGGATTGG - Intronic
1072301795 10:94068957-94068979 CTGTGCTAAGCACAGGGGCAGGG - Intronic
1072669177 10:97416762-97416784 CTGTGACAGGAAATGGGGCTGGG - Intronic
1073208548 10:101781170-101781192 CTGGGCTAGGACCTGGGGCCTGG - Intergenic
1073364105 10:102923305-102923327 CTGTGCCAGGTACAGGGGCTGGG + Intronic
1073971673 10:109051042-109051064 CTCTGCCAATTTCTGGGGCCAGG + Intergenic
1074190062 10:111127946-111127968 GAGTGCCAAGCACTGGGGCTAGG + Intergenic
1074901346 10:117818701-117818723 CTGTGCCAAGCCATGGGCCCAGG - Intergenic
1075479725 10:122769505-122769527 CTGTGCCAAGCACTGGGGATGGG + Intergenic
1075931447 10:126300199-126300221 CCTGGCCAAGAACTGGGGTCAGG + Intronic
1076604163 10:131678416-131678438 CTGTGCCCTGAACTGTGTCCCGG - Intergenic
1076888178 10:133272021-133272043 CTGTGCCAAGTCCTGGGCCCTGG - Intronic
1077659677 11:4056434-4056456 CTGTGCCAAGCACTTGTGCTGGG + Intronic
1077919324 11:6631199-6631221 CTGAGCCAGGACCTGGGGACAGG + Exonic
1078436274 11:11328335-11328357 CTCTGCCTAGAACAGGGGACTGG + Intronic
1078641151 11:13098089-13098111 CTGAGCCAAGAAAGGGGCCCAGG + Intergenic
1078901766 11:15649219-15649241 ATGTGCCAAGCACTGTGCCCTGG - Intergenic
1081555635 11:44157997-44158019 GTGTGTCTAGAACTAGGGCCTGG + Intronic
1082270819 11:50167488-50167510 CTGTGGCTAGAACTGGGCCATGG + Intergenic
1083257940 11:61508252-61508274 CGGAGCCAAGCCCTGGGGCCCGG + Intergenic
1083271692 11:61576089-61576111 CTGTGCCCAGAGCTTTGGCCTGG - Intronic
1083357549 11:62078164-62078186 CTGTGTTAAGAGGTGGGGCCTGG - Intergenic
1085530393 11:77189167-77189189 CTGAGCCAAGGGCTGGGGTCTGG - Intronic
1085530973 11:77191841-77191863 CCGTGCCCAGAACTGAGGCTAGG + Intronic
1085646253 11:78224973-78224995 CTGAGACAAGAACTTGGGCAGGG + Intronic
1086152268 11:83625134-83625156 CTGTGCCAAGTACTGGGCAGGGG + Intronic
1086643502 11:89189643-89189665 CTGTGCCAAGTGCTGAGGCTGGG - Intronic
1087170334 11:95043351-95043373 CTGAGCCCAGCACAGGGGCCTGG - Intergenic
1088013753 11:105035072-105035094 CTGTTCCAAGAACAGGTCCCTGG - Intronic
1088014762 11:105045256-105045278 CTGTTCCAAGAACAGGTCCCTGG - Intronic
1088200166 11:107323635-107323657 CTGTGCCACTATCTGGGCCCAGG + Intergenic
1088442532 11:109887749-109887771 TTGTACCTACAACTGGGGCCAGG + Intergenic
1089780475 11:120870110-120870132 ATGAGCCATGAACTGAGGCCTGG - Intronic
1089925873 11:122256749-122256771 ATGTGCCAAGCACTGTGTCCAGG - Intergenic
1090736481 11:129615872-129615894 CTGTGGCAAGAACTTGGACTCGG - Intergenic
1090839062 11:130473680-130473702 CTGCTCCAAGAGCTGCGGCCGGG + Exonic
1090900896 11:131030097-131030119 CTGTGGTAAGAACTTGGCCCAGG + Intergenic
1093663618 12:21786262-21786284 ATGTGCCAAGCACTTGGCCCAGG - Intergenic
1096153447 12:49329058-49329080 TTGTGTCAACAACTGGGGGCTGG + Intronic
1098490564 12:71071622-71071644 CAGTGCCTAGCACTGGCGCCCGG - Intronic
1098725948 12:73966904-73966926 CTTTGCCCAAATCTGGGGCCGGG - Intergenic
1100011201 12:89955565-89955587 GTGTGCCAAGAACTGGGGGAAGG - Intergenic
1101755441 12:107617559-107617581 CTCTGGCCAGACCTGGGGCCTGG - Intronic
1101970102 12:109307059-109307081 CTGTGTGCAGAGCTGGGGCCAGG - Intronic
1102977486 12:117217003-117217025 CTGTGGCAGGGACTGGGGCGGGG + Intronic
1103459128 12:121089878-121089900 CTGTGACAGGAGCTGGGGACGGG - Intergenic
1103947550 12:124535040-124535062 CTGTGCTGGGCACTGGGGCCAGG - Intronic
1104946871 12:132418971-132418993 CTGTTCCATGAAGTGGGCCCTGG + Intergenic
1104989631 12:132618553-132618575 CTGGACCAAGAGCTGGGGCTGGG + Intergenic
1105746718 13:23383897-23383919 CTGTGCCAGGCACTGGGGTTGGG - Intronic
1106196993 13:27502455-27502477 CTGTGCCAGGTACTTGGGCTGGG + Intergenic
1106240427 13:27907867-27907889 CTGTGCCAGGCACTGTTGCCAGG - Intergenic
1106396402 13:29385100-29385122 TTGTACCAACAACTGGAGCCTGG - Intronic
1109163911 13:59009949-59009971 CTGTTCCAAAGAATGGGGCCTGG - Intergenic
1116603824 14:46964027-46964049 CTGTGCCAATTTCTGGGACCAGG + Intronic
1117043778 14:51791909-51791931 CTGTGGCAAGAACTGGGAGTTGG - Intergenic
1117490659 14:56243432-56243454 AAGTGCCAGGAACTGGGGCCAGG - Intronic
1118320120 14:64748048-64748070 CCCCGCCAAGACCTGGGGCCAGG + Exonic
1118845306 14:69543599-69543621 CAGCGCCTAGAACTGGGGACTGG + Intergenic
1120309168 14:82808232-82808254 CTTGGCGAAGAACTGGTGCCTGG - Intergenic
1121450440 14:94003839-94003861 CTCTGCCAAGAACCAGAGCCGGG + Intergenic
1121456553 14:94042414-94042436 CTGTGCCAGGCACTGGGGCACGG - Intronic
1121459542 14:94064233-94064255 CTGTGTCAAGAATTAGGGACAGG - Intronic
1122143789 14:99676998-99677020 CTGTGCCAAGTTCTGGGAGCTGG + Exonic
1122283700 14:100638781-100638803 GTGTGCCCAGGACTGGGGTCAGG - Intergenic
1122307839 14:100776845-100776867 CTGTGCCAAGGACTTGTGCTGGG + Intergenic
1122997876 14:105275381-105275403 CTGTCCCCAGAGCTGAGGCCTGG + Intronic
1125604098 15:40930325-40930347 GTGTCCCAAGAGCTGGGGACGGG - Intronic
1126494183 15:49272056-49272078 CTGTGCCCAAAATTGGGCCCTGG - Intronic
1126525931 15:49654275-49654297 GTGAGACAAGAACTGTGGCCGGG + Exonic
1127247396 15:57192167-57192189 CTGAGACAAGATCTGGGGCTTGG + Exonic
1127389180 15:58491593-58491615 CTCTGCCAAATACTGGTGCCAGG + Intronic
1128756446 15:70186770-70186792 CAGTGTCAAGAACTGGGGGGAGG - Intergenic
1128906407 15:71471636-71471658 CTGGGCCAGGAAGTGGAGCCAGG - Intronic
1129678872 15:77646796-77646818 CTGTGCCCAGAAAGGAGGCCTGG + Intronic
1130393781 15:83483556-83483578 GTGTGACAAGTACTGGGGCTGGG - Intronic
1132517265 16:371565-371587 CTGAGCCCACCACTGGGGCCGGG - Exonic
1133278944 16:4654318-4654340 CTGTGTCAGGAACTGGGGCTGGG + Intronic
1133286142 16:4691813-4691835 CTGTGCAGAGGCCTGGGGCCGGG - Intergenic
1134052169 16:11144877-11144899 CTGTGCTAAGAACTGGGAAATGG + Intronic
1134098618 16:11436062-11436084 CTGGGCCAGGAGCTGGAGCCAGG - Intronic
1134365811 16:13578417-13578439 CTGTGCCTGGAACTGGGGTTTGG - Intergenic
1134829561 16:17312229-17312251 CTGTGCCCAGAGCTCAGGCCAGG + Intronic
1134897266 16:17899702-17899724 CAATACCAAGAACTGAGGCCGGG + Intergenic
1135494010 16:22935901-22935923 AAGTGACAAGCACTGGGGCCTGG + Intergenic
1137364575 16:47849524-47849546 CTGTTCCAAGAAATGGGCCAGGG + Intergenic
1138332661 16:56227423-56227445 CTGAGCCAGTCACTGGGGCCTGG + Intronic
1138399223 16:56731814-56731836 CTGTGCAAAAAACAGGGGCCAGG - Intronic
1138497888 16:57419327-57419349 CAGTGCCAAGAGCTGTGGGCTGG + Intergenic
1138509658 16:57501001-57501023 CTGTGCCAGGCACTGGGCACTGG + Intergenic
1138615748 16:58164681-58164703 CTGTGCCAGACACTGGGGCGGGG + Intronic
1139490297 16:67282362-67282384 CTGGGGCAAGATCTGGGGGCCGG - Intronic
1140871674 16:79112405-79112427 CTGGACCAAGAACTGTTGCCAGG + Intronic
1140903370 16:79390793-79390815 CTGGACCAAGCACTGTGGCCCGG - Intergenic
1141781927 16:86168287-86168309 CTGAGACAAGAATTGGGTCCAGG - Intergenic
1141944004 16:87297491-87297513 ATGTGCCAAGACTTGAGGCCTGG - Intronic
1142149123 16:88504986-88505008 CTCTGCCATTAGCTGGGGCCAGG + Intronic
1142279799 16:89141867-89141889 CTGTGCCCAGAACTTGTGCGTGG - Intronic
1142286626 16:89174071-89174093 CTGTGGGAAGAACAGTGGCCTGG - Intronic
1142715957 17:1747102-1747124 CTCTGCCAGGACCTGGGCCCCGG + Exonic
1144836765 17:18160598-18160620 CTGGGCCAATCACTGTGGCCAGG + Intronic
1144840519 17:18183167-18183189 CTGGGTTCAGAACTGGGGCCGGG + Intronic
1145249568 17:21289816-21289838 ATGTGCCCAGGACTGGGGTCAGG - Intronic
1145827085 17:27885123-27885145 CTGGGCCAAGACCTGGGGAGGGG - Intronic
1147261601 17:39212321-39212343 CAGTGGCAAGAAGCGGGGCCTGG - Exonic
1147453281 17:40519321-40519343 CTGTGACTGGAAATGGGGCCGGG + Intergenic
1147696853 17:42361645-42361667 CTGGGCTAAGAACTGGCACCTGG - Intronic
1148073094 17:44920043-44920065 CTGTGCCAGGCACTGGGCCAGGG - Intergenic
1149322374 17:55494418-55494440 CTTTGCCAAGAACTTGATCCAGG - Intergenic
1149434304 17:56620068-56620090 CCCTGCCCAGATCTGGGGCCTGG - Intergenic
1149658171 17:58320947-58320969 CTGGGCCCAGCACTGGGTCCAGG - Intronic
1150131590 17:62672131-62672153 CTGTGTCACCATCTGGGGCCCGG + Exonic
1150174262 17:63033556-63033578 CTGTGTCAGGAACTGGGGGTGGG + Intronic
1151447351 17:74175917-74175939 CTGTGCCAGGAATAAGGGCCAGG + Intergenic
1152659229 17:81534785-81534807 CTGTGCCAAGCAGAAGGGCCTGG + Intronic
1152891167 17:82882406-82882428 CTGTGCCCAGCACTGGAGGCTGG + Intronic
1155154997 18:23150568-23150590 CTGTGCCAAGCACTGGGATATGG + Intronic
1157487526 18:48099158-48099180 CTCTGCAAAGAACTGTTGCCAGG + Intronic
1159558457 18:69969058-69969080 CTGTGCCAAGCACTAGGGCTTGG - Intergenic
1162061333 19:8097253-8097275 CTGTTCCCAGCCCTGGGGCCTGG - Intronic
1162396972 19:10422902-10422924 CCTTGCAAAGAAATGGGGCCTGG - Intronic
1162418537 19:10552732-10552754 CTGAGCCAATCACTGTGGCCAGG + Intronic
1162532058 19:11241797-11241819 CTGTGCTCAGAAGTGGGGCCCGG - Exonic
1162998382 19:14350687-14350709 CAGTCCCCAGAACTGAGGCCAGG - Intergenic
1163517838 19:17775531-17775553 CTGTGCCAACAACTGCCCCCAGG - Intronic
1165152812 19:33770962-33770984 CAGTGGCCAGAACTGGGGCATGG + Intronic
1165708548 19:37993268-37993290 CTGTGCCAAGAGCTGGTTCAAGG - Intronic
1167267789 19:48492055-48492077 CAAGGCCAAGAACTGGGGCCTGG - Intronic
1168712733 19:58511287-58511309 CTGTGCTGAGCTCTGGGGCCCGG - Exonic
1202714940 1_KI270714v1_random:36932-36954 CCGTGCCAGGAACTTGGGCTGGG - Intergenic
926009108 2:9394457-9394479 AAGAGCCACGAACTGGGGCCTGG - Intronic
926204326 2:10824435-10824457 CTGAGCCAATAACTGTGGCAAGG - Intronic
926451150 2:13005847-13005869 CAGTGCAAAGAACTGGAGACAGG - Intergenic
927435063 2:23059620-23059642 CTGTGACATGCACTGTGGCCAGG + Intergenic
927962740 2:27250810-27250832 CTGTGTAAAGAGCTGGGGCTGGG + Intergenic
930866064 2:56123219-56123241 CTTGGCCAAGAGCTGGGGCAAGG - Intergenic
932196222 2:69786368-69786390 CTGGGCCAAGATCTGGGGGTGGG - Intronic
932336783 2:70936138-70936160 CTGAGGCAAGAAGCGGGGCCCGG - Intronic
933518124 2:83331893-83331915 CTGAGACAAGAACTTGAGCCTGG - Intergenic
935482115 2:103603232-103603254 CTGGGTCAAGAAATGGAGCCAGG + Intergenic
936822760 2:116542812-116542834 CTGTGCAAAGCAGTGGGCCCTGG + Intergenic
936829011 2:116618097-116618119 CTGTGGCAATAACTGGGGTATGG - Intergenic
937280256 2:120712793-120712815 CTGTGCCAACACCTGGAGCCAGG + Intergenic
937436645 2:121886987-121887009 CTGTGTCAGGAACTGGGGCCAGG + Intergenic
941619290 2:167758366-167758388 CTGAGCCCAGGACTGGGGCAGGG - Intergenic
945252625 2:207777329-207777351 GTGAGCCAAGCACTGGTGCCAGG + Intergenic
946009803 2:216555388-216555410 CTGTGCCAACTTCTGGGCCCAGG + Intronic
946377866 2:219324635-219324657 CTGAGACAAGAACTTGGGCTGGG + Intergenic
946909379 2:224444451-224444473 CTGTGCCTAGACCTGGGGGCTGG + Intergenic
948291457 2:236828115-236828137 TTGTGCCAGGAACTGGGAGCTGG - Intergenic
948865342 2:240772158-240772180 CTGAGCCAAGAGCTGGGGACAGG + Intronic
949055230 2:241924487-241924509 CTGTGGGAAGGGCTGGGGCCAGG + Intergenic
1169264601 20:4160286-4160308 CTGTGCCAGGCACTTGGGGCTGG - Intronic
1170155025 20:13261619-13261641 CTGTGGAAAGGACTGGGGCCAGG - Intronic
1171117136 20:22534690-22534712 CTCTGCCAAGAACAAAGGCCAGG + Intergenic
1172222330 20:33282439-33282461 GTGAGCCAAGACCTGGGCCCAGG + Intronic
1172388529 20:34550309-34550331 CTGTGCCAAGCACTGCTGCTGGG - Intronic
1172629279 20:36367310-36367332 CTGTGCCAAGCATGGGGGGCTGG - Intronic
1172695435 20:36819479-36819501 CTATGTCAAGAACTGGTCCCAGG - Intronic
1174792993 20:53497665-53497687 CTATGCCAAGGAATGGGGGCAGG + Intergenic
1175725671 20:61316795-61316817 CGTTGCCCAGAGCTGGGGCCTGG + Intronic
1175811785 20:61862231-61862253 CTGTGCTCAGAACTGGAACCCGG - Intronic
1175943842 20:62549905-62549927 TTTTGCCTAGAATTGGGGCCAGG - Intergenic
1176282631 20:64322980-64323002 CTGGTCTAAGAAATGGGGCCAGG - Intergenic
1178931324 21:36821126-36821148 CTCAGCCAAGGACTGGGGACTGG + Intronic
1179034185 21:37745742-37745764 CTGTGCTAAGAGCTGGGTACAGG + Intronic
1179196249 21:39165265-39165287 TTGAACCATGAACTGGGGCCTGG - Intergenic
1179250562 21:39668022-39668044 CTGTGCCTAGCACTGGGTGCAGG + Exonic
1179976759 21:44872964-44872986 CTGTGCGTGGAACTGCGGCCGGG + Intronic
1181309585 22:21937403-21937425 ATTTGGCAAGAACTGGGGACTGG + Intronic
1181959563 22:26613084-26613106 CTGTGGCAGGTACTGGGGCTGGG - Intronic
1182880212 22:33726623-33726645 CTGTGCCAAGCACTGAGCCAGGG + Intronic
1183284135 22:36952038-36952060 CTCTGCCCACCACTGGGGCCTGG - Intergenic
1183420518 22:37709158-37709180 CAGTGCCAAGAAGTGGGGTTGGG - Intronic
1183664506 22:39239620-39239642 CTGTCCCAAGATCTCAGGCCCGG + Intronic
1183725907 22:39589690-39589712 CTGGCCCAAGAACTGGGATCTGG + Intronic
1183836654 22:40459747-40459769 CAGTGCCAGGCACTGGGGACGGG + Intronic
1184236502 22:43186076-43186098 CAGAGCCAAGAACAGGGACCCGG - Intronic
1184280639 22:43435522-43435544 CTTTGCCAGGCACTGGGGCCTGG - Intronic
1184337600 22:43862844-43862866 CTGTGCCAGGCACTGGGCCAGGG + Intergenic
1184424336 22:44400413-44400435 CTGAGCCAAGGACTGGGGTGGGG - Intergenic
1184652832 22:45926940-45926962 CTGTGCCAAGACGTGGGACATGG + Intronic
1184996275 22:48209734-48209756 CTTTCCCAAGATCTGGGGCACGG + Intergenic
950285138 3:11738914-11738936 CTGTGCTAAGAACTTGGACTTGG - Intergenic
952828668 3:37545113-37545135 CTGGAGCAGGAACTGGGGCCTGG + Intronic
952953627 3:38543364-38543386 CTGTGCCAGGTGCTGGGGCAGGG + Intergenic
953665115 3:44920246-44920268 CTGTGCCAAGAAGGGAGGCCTGG - Intronic
953980705 3:47411584-47411606 CTGTGCCAGGCAGTGGGGCCTGG - Exonic
954014845 3:47679117-47679139 GTGTGCCAAGAACTGTTGCTAGG - Intronic
954419834 3:50412951-50412973 CTGTCCCAAGTCCTGGGCCCTGG - Intronic
954830899 3:53420567-53420589 CTGTGACTAGGACTTGGGCCAGG + Intergenic
955047901 3:55377158-55377180 CTGAGCCAATTACTGAGGCCAGG + Intergenic
956028182 3:65006530-65006552 CTGTACCAAGAACTATGGCAGGG - Intergenic
956516788 3:70058509-70058531 CTGAGACTAGAACTGGGTCCAGG - Intergenic
956864526 3:73356197-73356219 CGGTTACAAGAACTGGGGCAGGG - Intergenic
958847640 3:99284440-99284462 GTGTACCAAAGACTGGGGCCAGG - Intergenic
959824135 3:110772821-110772843 CTTTGCCAAGACCTGGAGCTAGG + Intergenic
959919892 3:111859042-111859064 CTGAGCTAAGGACTGGGGTCAGG - Intronic
961345968 3:126263628-126263650 CTGTGCCCAGCACTGGGGCTAGG - Intergenic
961500254 3:127327217-127327239 CTGTGCCAAGAACCAGGACTTGG + Intergenic
961532377 3:127547503-127547525 CTGGGGCAAGGACTGGGTCCGGG + Intergenic
962848978 3:139293856-139293878 CTGTGCCAAGAACTGTGCTAGGG - Intronic
963146828 3:142002773-142002795 TAGTGCCAAGAACTGGGGTGTGG - Intronic
964063569 3:152555217-152555239 GTATGCCAAGAACTGGTGCTGGG + Intergenic
966857825 3:184207650-184207672 TTTAGCCAAGATCTGGGGCCGGG - Intronic
967188264 3:186963885-186963907 CTGTCCCAAGCCCTGGTGCCAGG + Exonic
967887503 3:194343070-194343092 CTGTGCAAAGAGCAGGTGCCAGG - Intronic
968049025 3:195641503-195641525 CTGTTCCAGGAACTGGGGAGAGG + Intergenic
968098375 3:195948123-195948145 CTGTTCCAGGAACTGGGGAGAGG - Intergenic
969184511 4:5465402-5465424 CTTTGCCATGACCTGGGGGCAGG - Intronic
972848094 4:43014220-43014242 CTGTGCCAAACACTTAGGCCTGG - Intronic
974794130 4:66726950-66726972 CTGTGCCAAGCACTGTGCCAAGG + Intergenic
975488057 4:74957012-74957034 ATGTGCCAAGAACTTGGGTTTGG + Intronic
977301767 4:95275258-95275280 CAGTGCCAAGAAGAGGGGCAAGG + Intronic
980805889 4:137812726-137812748 CTGTGCCATTTTCTGGGGCCAGG + Intergenic
982277966 4:153656214-153656236 CTGTGCCAGGAACTGGTACAGGG - Intergenic
989277544 5:39607467-39607489 CAGTGCCAGGAACTCAGGCCAGG - Intergenic
992223831 5:74599247-74599269 CAGTACCAAGAACAGGAGCCTGG - Intergenic
992611482 5:78511887-78511909 CTGTGCCAAGCACTGGGTAAGGG + Intronic
995242744 5:109903397-109903419 CAGGGCCATCAACTGGGGCCAGG - Intergenic
995657759 5:114446061-114446083 CTGTACCAAGTACTGGGGCCAGG - Intronic
998132079 5:139656277-139656299 CTGTGGCAAGAGCAGGGGCCAGG - Intronic
998254028 5:140571319-140571341 CTGGGCCAAGAAGAGCGGCCGGG + Intronic
998383323 5:141741467-141741489 CAGGGTCCAGAACTGGGGCCAGG - Intergenic
998388390 5:141771733-141771755 CTGGGCCCAGGACTTGGGCCAGG - Intergenic
998448598 5:142217330-142217352 CTGTGCTCAGAACTGGGACGTGG - Intergenic
998509427 5:142699077-142699099 CTGTACCTAGAACCAGGGCCTGG - Intergenic
1000207026 5:159071554-159071576 CTGTTTCAAAAACAGGGGCCGGG + Intronic
1001566398 5:172702215-172702237 CTTGGCCAAGAACTGTGGCCCGG + Intergenic
1001696135 5:173671405-173671427 CTGTGCCTAGAACTCTGGACTGG + Intergenic
1001964788 5:175902598-175902620 CTGTGCCAAGGCCAGGGCCCTGG + Intergenic
1002154463 5:177265644-177265666 CAACGCCAAGAACTGGGACCGGG - Intronic
1002252162 5:177936590-177936612 CTGTGCCAAGGCCAGGGCCCTGG - Intergenic
1003635613 6:7828941-7828963 CTGTGCCAAGCCCTGGGACACGG - Intronic
1004643079 6:17534503-17534525 CGGTGCCAAGAACGAGGGCTAGG - Intronic
1005486008 6:26300117-26300139 CTGTGCTAGCCACTGGGGCCTGG - Intergenic
1006397775 6:33798311-33798333 CTGTTCCAGGCACTGGGGACAGG - Intronic
1006472935 6:34238160-34238182 CTCTGGCAGGAAGTGGGGCCGGG + Intronic
1007384813 6:41513338-41513360 GTGGGCAAAGGACTGGGGCCTGG - Intergenic
1009606042 6:65868234-65868256 CTGTGCAATAAACTTGGGCCAGG + Intergenic
1009770746 6:68140373-68140395 CTGGGCCAATAACTGGGGATAGG + Intergenic
1011133307 6:84073645-84073667 CTGTGCCAAGCACGGGGCTCTGG + Intronic
1011521219 6:88208991-88209013 CTGGGCCAATCACTGGGACCAGG - Intergenic
1013226272 6:108121182-108121204 CTGCGGAAAGAACTGGGGGCTGG - Intronic
1013506815 6:110808909-110808931 CTGTTCAAAGAAATGGGGCCAGG + Intronic
1013582063 6:111545423-111545445 CAGTGCAGAGTACTGGGGCCAGG - Intergenic
1016487437 6:144557160-144557182 CTGCTTCAAGAACTGGGTCCTGG + Exonic
1017057720 6:150453000-150453022 CTGACCCCAGCACTGGGGCCTGG - Intergenic
1019318934 7:406078-406100 CTTCGCCAAGAGCTGGGGGCGGG + Intergenic
1019643675 7:2117949-2117971 CTGTGCAAGGGACTGGGGCCAGG - Intronic
1022511703 7:30938825-30938847 GGGTGCCCAGACCTGGGGCCGGG - Intronic
1022908389 7:34877431-34877453 TTGTCCCAACATCTGGGGCCTGG - Intronic
1023224288 7:37952795-37952817 CTGTGCCAAGGAGTGAGGCTGGG - Intronic
1023931083 7:44707132-44707154 CTGTGCCAGGGACTGCTGCCAGG - Intronic
1024653077 7:51425388-51425410 CTGCACCAAGAACTTGGGACAGG - Intergenic
1026014546 7:66662676-66662698 CTGTGGCAAAATCTGGCGCCAGG + Intronic
1026484037 7:70802285-70802307 CTGTGGTATCAACTGGGGCCAGG - Intergenic
1026928598 7:74210475-74210497 CTGGGGCAAGACCTGGGCCCTGG - Intronic
1026972739 7:74477962-74477984 CGGTGCCAACCCCTGGGGCCAGG - Intronic
1027174191 7:75892983-75893005 CTGTGCACAGAACTGGGGCCAGG + Intergenic
1029551292 7:101238389-101238411 CTGTGGTGAGAACTGGGACCAGG + Exonic
1030076722 7:105743267-105743289 CTGTGCCAAGAACTGGGGCCAGG + Intronic
1031528470 7:122849925-122849947 CTGGGCCAGGAGCTGGGGCCTGG - Intronic
1031948710 7:127868916-127868938 CAGTGCAAAGAACTGGCGCCTGG - Intronic
1032000748 7:128263618-128263640 CTGAGCCAATCACTGGGACCAGG + Intergenic
1032743149 7:134759725-134759747 ATGTGCCAAGAACTAGTGCTGGG + Intronic
1032836378 7:135678998-135679020 CTGTGCCAGCAACTGCTGCCAGG - Intronic
1033652807 7:143355124-143355146 CTGTGCCAAGGGCTGGGGAGGGG + Exonic
1034480213 7:151314084-151314106 CTGTGCCAAGAACTGGGAGGCGG - Intergenic
1034523743 7:151641081-151641103 CTGTGCCAAGAAATGATGGCAGG + Intronic
1035368717 7:158364813-158364835 CCCTGCCAAGGACTGTGGCCTGG + Intronic
1039406675 8:37318863-37318885 CTGTGGTAAGAACTGGGTGCAGG - Intergenic
1039444450 8:37619782-37619804 CAGTGCAAATTACTGGGGCCAGG - Intergenic
1040106901 8:43546580-43546602 CTCTGCCAAGATCTGGCGCAGGG + Intergenic
1040522356 8:48189170-48189192 CTGTGCCAAGACATGGTGCTGGG - Intergenic
1043930341 8:86083117-86083139 CTATGCCAGGAACTGGGGGCAGG + Intronic
1044359106 8:91260554-91260576 CTGTGCCAAATACTGGGGATAGG - Intronic
1045036045 8:98177169-98177191 CAGTGCCAAGTGCTGGGGCAGGG - Intergenic
1046868489 8:119177293-119177315 CTGTGCCAGGCACTAGGGCATGG + Intronic
1048138120 8:131766052-131766074 AGCTGCCAAGGACTGGGGCCTGG - Intergenic
1048345989 8:133574892-133574914 CTGTGCCAAGAAACGGGGGTAGG - Intergenic
1048570036 8:135644671-135644693 GTGTGCCAAGAGCTAGGGCTGGG - Intronic
1048868027 8:138775163-138775185 GTGTCCCAAGAGCTGGGGCTAGG - Intronic
1048967106 8:139623381-139623403 CTGTGCCAAGAGCAGGTCCCAGG - Intronic
1049598881 8:143498097-143498119 CTGGGCCACGCACCGGGGCCCGG + Intronic
1049894463 9:100681-100703 CTGTGGGCAGAACTGGGGCGTGG - Intergenic
1050506320 9:6352939-6352961 CTGAGCCAAGAAGAGGGACCTGG + Intergenic
1051920350 9:22257379-22257401 CTGTACCAAGATCTAGGTCCAGG + Intergenic
1051930119 9:22374900-22374922 CTGTGCCAGGAACTAGGCCAAGG + Intergenic
1052131466 9:24853698-24853720 TTGTGGCAAGACCTGGGGGCAGG - Intergenic
1053123647 9:35563033-35563055 CTTTGCCAAGAACTGCAGCCAGG - Exonic
1053475923 9:38382059-38382081 CTGGCCCAAGAAGTTGGGCCTGG + Intergenic
1054692707 9:68330727-68330749 CTGTGGGCAGAACTGGGGCGTGG + Intronic
1056690870 9:88807671-88807693 CTGTGCCAACACCTGTGGGCAGG + Intergenic
1057236427 9:93365570-93365592 CTCTGCCAAGTAATGGGGTCAGG - Intergenic
1057371776 9:94480150-94480172 ACGGGCCAGGAACTGGGGCCTGG - Intergenic
1059994259 9:119893639-119893661 GTGGGCAAAGAACTGGGGACAGG - Intergenic
1060785513 9:126449153-126449175 ATGTGCCCAGCCCTGGGGCCTGG + Intronic
1061222032 9:129257890-129257912 CAGTGCCAAGAGCTGGGGGCAGG - Intergenic
1061754045 9:132800264-132800286 CAGTGCCAGGACCTGGCGCCAGG + Intronic
1061852437 9:133424017-133424039 CTGTGCCCAGAGCAGGGTCCAGG + Intronic
1062287765 9:135780716-135780738 CTGAGCCGGGGACTGGGGCCAGG - Intronic
1062367555 9:136218471-136218493 CTGTTCCCAGCACTGGGGCTGGG - Intronic
1062452056 9:136619975-136619997 TTGTGCAACGAACTGGGGCCCGG + Intergenic
1062459537 9:136657143-136657165 CTGTGCCATGTACTGGCGCCAGG + Intergenic
1186240192 X:7557228-7557250 CTTTGCCAACAACTAGGGGCTGG + Intergenic
1187411339 X:19053148-19053170 CTGTGTCAGGAACAGGGGCAAGG - Intronic
1189849715 X:45166274-45166296 CCGTGCCAAGTACTGGGCCAGGG + Intronic
1190279617 X:48921043-48921065 ATGTGCCAAGCACTGTGCCCAGG + Intergenic
1190931548 X:54952871-54952893 GTGTGCCAAGCAGTGGGGCATGG + Intronic
1192151956 X:68718139-68718161 ATGTACCCAGACCTGGGGCCTGG + Exonic
1192226297 X:69230501-69230523 ATGTGGCAAGCACTGGGCCCTGG - Intergenic
1192587335 X:72329337-72329359 CTGTCCCAAGAACTTGGGCTAGG + Intergenic
1197073305 X:122326140-122326162 CTTTGGCAAGAACAGGGGACTGG + Intergenic
1197972045 X:132124859-132124881 CTGTTCCCAGAACTGGGCCTGGG + Intronic
1199503576 X:148536387-148536409 CTGTGCTGGGAACTGGGGCAAGG - Intronic
1199870543 X:151894464-151894486 CTGTGCAAAGCACTGGGGTCTGG - Intergenic
1200062134 X:153488394-153488416 CTCTGCCTAGGACCGGGGCCTGG + Intronic