ID: 1030077881

View in Genome Browser
Species Human (GRCh38)
Location 7:105752063-105752085
Sequence CTGGTTAAGCAGCTTCTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030077879_1030077881 -4 Left 1030077879 7:105752044-105752066 CCTTTTGCAATAGTAAGAGCTGG 0: 1
1: 0
2: 1
3: 16
4: 249
Right 1030077881 7:105752063-105752085 CTGGTTAAGCAGCTTCTACAAGG 0: 1
1: 0
2: 1
3: 17
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030077881 Original CRISPR CTGGTTAAGCAGCTTCTACA AGG Intronic
900240348 1:1614358-1614380 CTAGATAAGCAGCTTGCACAAGG + Intergenic
900876063 1:5343417-5343439 CTGGGAAAGCAGCTTGTAAAGGG - Intergenic
901759381 1:11460768-11460790 GTGGTTAAGCAACTTGTTCAAGG + Intergenic
901882562 1:12202790-12202812 GAGGTTAAACAGCTTCTTCAAGG + Intronic
902839376 1:19065556-19065578 CTGGGGAAGCAGCTTGTCCAAGG + Intergenic
902846675 1:19116252-19116274 GAGGTTAAGCAGCTTCTCTAAGG + Intronic
904879387 1:33683947-33683969 CAGGTTCAGCAGCTTCCAGAGGG - Intronic
907280476 1:53344005-53344027 GTGGTTAAGCAGCTTGGCCAGGG + Intergenic
908740207 1:67319662-67319684 CAGGTTAAGCAACTTGCACATGG + Intronic
910262231 1:85303808-85303830 CTGGTAAAGCAGCTTCAGCCAGG - Intergenic
911233189 1:95382207-95382229 CTGGTTAACCAGCTTCCCCGGGG + Intergenic
912128552 1:106571534-106571556 TTGGTTAAGAAGCGACTACAGGG + Intergenic
917623690 1:176824289-176824311 CTGGTTAACCAGCTTCTAGTTGG + Intronic
918433152 1:184483295-184483317 CTGGTTAAGCAAGTTCTAGAAGG + Intronic
919253700 1:195095182-195095204 CTAATTAAAGAGCTTCTACACGG - Intergenic
920403554 1:205692527-205692549 CTGGTGCTGCAGCTTCTCCAGGG - Intergenic
1062848552 10:726266-726288 CAGGGTAAGCAGCTTCACCAGGG - Intergenic
1063879703 10:10518441-10518463 CAGGTTAAGCAGCTTATTAAAGG - Intergenic
1065767826 10:29048091-29048113 GTGGTTAAGTATCTTCTGCAAGG + Intergenic
1068257376 10:54530645-54530667 GTAGTTAAGCAGCTTCTTCTGGG - Intronic
1068756851 10:60665108-60665130 ATCGTTAAGCTACTTCTACAGGG - Intronic
1069866687 10:71508076-71508098 GAGGTGAAGCAGCTTCTCCAAGG - Intronic
1071100954 10:82037166-82037188 CTGGTTGAGAAGCTTCTGGATGG + Intronic
1071721918 10:88155348-88155370 TTGGTTATGCTGCTTCTATAGGG + Intergenic
1071816277 10:89235189-89235211 CTGGTCAGGCAGCTCCTCCAAGG + Intronic
1072056984 10:91768141-91768163 CTGGTAAAACAGCCTCTATAAGG - Intergenic
1073702861 10:105949418-105949440 CTGGTTAACCAACTTCTGTAAGG - Intergenic
1073909101 10:108320038-108320060 CTGGTTAACCAGCTTCCTCATGG - Intergenic
1075614173 10:123879397-123879419 AGGGTTATGCAGCTTCTACGTGG - Intronic
1077659615 11:4055987-4056009 CTGGTTAAGTAACTTATCCAAGG + Intronic
1078240092 11:9523369-9523391 CTGGCAAAGCAGCATCTAGAAGG - Intronic
1085544735 11:77306896-77306918 AGGGTTAAGTAGCTTCTCCAAGG + Intergenic
1089050191 11:115539066-115539088 CTGGTTCAGCTTCTTCTCCAAGG + Intergenic
1090203469 11:124872122-124872144 CAGGTTAAACAGCTTGTTCAGGG + Intronic
1092658990 12:10718740-10718762 CTGGTTAAGCAGCTTTCCTAAGG - Intronic
1093756729 12:22861127-22861149 CTGCTTAAGCAGCTGCTAGCAGG + Intergenic
1094431096 12:30369933-30369955 CAGGTTAAGAACCTTGTACAGGG + Intergenic
1101030877 12:100658449-100658471 CTGGTTATTGTGCTTCTACAAGG + Intergenic
1101080269 12:101174244-101174266 CTAGTTAACCAGCTTCCCCAGGG + Intronic
1101747599 12:107555314-107555336 CTTGTCAAACAGCTTCTACTCGG + Intronic
1105320328 13:19314064-19314086 CTGGTTAAGCAGCATTGCCAGGG + Intergenic
1106891725 13:34253423-34253445 CTGGTTAAACAGTTATTACAGGG + Intergenic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1110949769 13:81471199-81471221 CAAGTTAAGAAGCTTCTGCATGG + Intergenic
1111467236 13:88630586-88630608 CTGGTTAAGCAGGTTACATATGG + Intergenic
1112226968 13:97549250-97549272 CTGCTTAAGCAGCCTCTGGATGG - Intergenic
1118745805 14:68772263-68772285 CTGGTTAAGAAGCTTGCCCAAGG - Intergenic
1119154041 14:72392240-72392262 CTGGTTAAGCAGCCTCTGTGAGG + Intronic
1120510770 14:85411569-85411591 CAGGTTAAGCAACTTGTCCAAGG + Intergenic
1128536469 15:68494468-68494490 CTTGATAAGCAGATTCTACATGG - Intergenic
1132521446 16:391771-391793 CTTTTTGAGCACCTTCTACAAGG + Intergenic
1133632107 16:7631044-7631066 CTGGTTAAGCATCTTTTACTAGG - Intronic
1133998936 16:10767672-10767694 CTGATTCAGCAGCTTCCACATGG - Exonic
1136067294 16:27767779-27767801 CTGGCTAAGCTCCTGCTACACGG - Intronic
1136451986 16:30358702-30358724 CAGGTTACGCAGCTGCTCCATGG + Exonic
1137323035 16:47405591-47405613 GAGGTTCAGCAGCTTCTCCATGG - Intronic
1138896442 16:61211108-61211130 GTGGGTCATCAGCTTCTACATGG + Intergenic
1143109370 17:4544817-4544839 CTGGATACGCAGCTTCTGCTCGG + Exonic
1144006238 17:11102246-11102268 CTGCTTATGTAGCCTCTACAAGG - Intergenic
1144313101 17:14032280-14032302 TTGGTTAAGCAGCTTGTCCAAGG - Intergenic
1145989467 17:29070218-29070240 CAGGTTAAGCCCCTTCTCCAAGG + Intergenic
1146400048 17:32494819-32494841 CTGGTTGAGCCGCGTCTCCACGG + Exonic
1146569473 17:33940299-33940321 CTGGCCAACCAGCTTCTACAGGG - Intronic
1147603872 17:41763007-41763029 CTGGTTGAGCAGCTTCACGATGG + Exonic
1152120424 17:78415005-78415027 CTGGTGAAGCTGCTGCTGCAGGG - Exonic
1152757040 17:82091394-82091416 CTGCTCCAGCAGCTTCTGCACGG + Exonic
1156018538 18:32574206-32574228 GTGGCTAAGCAGCTTGTCCATGG - Intergenic
1156112501 18:33745093-33745115 CTGGTGACGCAGTTACTACAGGG + Exonic
1156526320 18:37770828-37770850 CTGGTTAAGCAGTCTCTGTAAGG + Intergenic
1161082330 19:2317495-2317517 GAGGTTAAGCAGCTTGCACAGGG - Intronic
1161950907 19:7467368-7467390 CTGGCTCTGCAGCTTCTCCAGGG - Exonic
1165546475 19:36541135-36541157 TTGGTTAAGCAGTCTCTATAAGG + Intronic
1168522505 19:57063544-57063566 CTGGTTAAGAAGATTCTGCAAGG - Intergenic
926850388 2:17190775-17190797 CTGATTAAGCAGCTTGTACAAGG + Intergenic
927889301 2:26738479-26738501 CTGCTTCAGCAGCTTCTGGAAGG + Intergenic
930335271 2:50037807-50037829 CTGCTGAAGCAGTTTCTACTTGG - Intronic
933548482 2:83743708-83743730 CTGGTTAGGCAGCAACTGCAGGG - Intergenic
935473289 2:103485593-103485615 CTGCTTAAAAATCTTCTACAAGG - Intergenic
936281786 2:111147704-111147726 GTGGTTTAGAAGCTTCCACATGG - Intronic
936839735 2:116754765-116754787 CTGGTAAAACATCTTCTAAAAGG - Intergenic
936960635 2:118070417-118070439 CTGGATTATCAGCTTCTCCAAGG - Intergenic
937255410 2:120552051-120552073 ATGGTTAAGTAGCTCCTCCAAGG + Intergenic
937382004 2:121386797-121386819 ATGGGTAATGAGCTTCTACATGG + Intronic
939272170 2:139954072-139954094 CTGCTTAAGCAGCTTCATCTAGG + Intergenic
941242198 2:163053387-163053409 CATGTTAAACAGCTTCTGCAGGG - Intergenic
943240010 2:185371245-185371267 CTGGTTCTCCAGCTTGTACATGG + Intergenic
945204799 2:207320110-207320132 GTGTTTAAGCCCCTTCTACATGG - Intergenic
947078597 2:226370537-226370559 CTGGTTACACATCTTCTACGGGG - Intergenic
1174595628 20:51681122-51681144 CAGGTTAAGCAACTTGTTCAAGG - Intronic
1177188239 21:17821004-17821026 CTGGTCAAGCTCCTTCAACATGG + Intergenic
1178685505 21:34707600-34707622 CTGGAGAAGCAGGTTCTTCACGG - Intronic
1181512868 22:23396564-23396586 CAGGTTCAGCAGCCCCTACAGGG + Intergenic
1181876565 22:25945215-25945237 CTGGTTAAGAAACTTCCACTTGG + Intronic
1183105206 22:35610515-35610537 GAGGTTAAGCAGCTTGTCCACGG - Intronic
949301949 3:2594376-2594398 CTGGTTAACCAGTTACTCCAGGG - Intronic
950406627 3:12809046-12809068 CTGGTTAAGAGGCTGCTATAGGG + Intronic
953148356 3:40300693-40300715 TTGGTTAAGCAGCTTCTGTAAGG + Intergenic
954445149 3:50542402-50542424 CTGCCCCAGCAGCTTCTACAGGG + Intergenic
954930077 3:54273519-54273541 CTAGTTAACCAGCTTTCACAGGG + Intronic
956770354 3:72520657-72520679 CTGCTGAAGCAGCTCCTACCTGG + Intergenic
956824150 3:72982089-72982111 GAGGTTAAGCTACTTCTACAAGG - Intronic
957738663 3:84234064-84234086 CTGTCTTGGCAGCTTCTACATGG - Intergenic
958188457 3:90153791-90153813 CTAGTTAGGCAGCTGCTAAATGG - Intergenic
958450252 3:94264614-94264636 ATGGTTAATCAGCCTCTGCAAGG + Intergenic
961482861 3:127195355-127195377 CTGGTAGAGCAGCTTCTCAAAGG + Intronic
961778991 3:129310528-129310550 CTGATTAAGCAGTTTCTGTAAGG - Intergenic
963544653 3:146640993-146641015 CTGGTTTATCTGCATCTACATGG + Intergenic
965507696 3:169534594-169534616 CTGGAAATGCAGTTTCTACATGG - Intronic
969179980 4:5432937-5432959 GAGGTTAAGCAGCTTCCCCAAGG + Intronic
969456194 4:7301045-7301067 CTGGTTTAGCAGCATCTCCGTGG + Intronic
970548124 4:17150280-17150302 ATGTTTAAGCAGCTTCTGAAGGG + Intergenic
973637992 4:52877493-52877515 GTGGTTAAGCAACTTCTCCAGGG - Intronic
973838127 4:54831569-54831591 CTGGTTAAGAAGCCTCTGTAAGG + Intergenic
975876492 4:78844255-78844277 ATGGTTAAGCAGATTGTCCAAGG + Intronic
976542369 4:86293623-86293645 ATGGTTCTGCAGCTTGTACAGGG + Intronic
977705297 4:100064067-100064089 CTGGATAAGCAGGGTCCACATGG + Intergenic
978520983 4:109614788-109614810 CTGGTTAGGCAGTCTCTATAAGG - Intronic
980275179 4:130641799-130641821 CTGGAGAAGCATATTCTACATGG - Intergenic
980512486 4:133812398-133812420 CTTGTTAGGCAGCTTCTCCCTGG - Intergenic
984623105 4:181975644-181975666 CTGGTTAGGCAGCTACTGCAGGG + Intergenic
986905329 5:12488507-12488529 CTGGTAAATCAGGTTCTTCATGG - Intergenic
987149426 5:15023741-15023763 CTGGTTGAGCAGCCTCTGTAAGG + Intergenic
987789117 5:22541249-22541271 CTGGCTATGCAGCTGCTGCAGGG + Intronic
988901153 5:35733859-35733881 GAGGTTAAACAGCTTGTACAAGG - Intronic
989514991 5:42332129-42332151 CTGGTTAAGGAGTTTTTACTAGG - Intergenic
989807849 5:45633027-45633049 CTGGTTAAGAGTCTCCTACAAGG + Intronic
992099999 5:73397891-73397913 CTGGTTAAGCAGTCTCTGTAAGG - Intergenic
994359668 5:98836082-98836104 CTGGTTAAGCAGTCTCTGTAAGG + Intergenic
994360646 5:98845429-98845451 CTGGTGAAACATCTTCTAAAAGG + Intergenic
994475839 5:100267861-100267883 TTGGTTAAACAGCTTGTGCATGG + Intergenic
995470267 5:112494450-112494472 CTGTCTAAACAGCTTCTAGAAGG + Intergenic
1001084714 5:168692217-168692239 CTGGGGAAGCAGCGTCTAAAGGG - Intronic
1004411581 6:15386138-15386160 GGTGTTAAGCAGCTTGTACAAGG + Intronic
1004451744 6:15754091-15754113 CTGGCTAAGCAGCCTCCCCAAGG + Intergenic
1007887830 6:45252226-45252248 ATGGTTAAGCAGTTTGTCCAAGG + Intronic
1008516156 6:52321066-52321088 AAGGTTATGCAGCTTCTTCAAGG + Intergenic
1010156317 6:72797932-72797954 CTGGTTTAGCATCTTACACATGG - Intronic
1010480638 6:76348610-76348632 AAGGTCAAGCAGCTTCTAAATGG + Intergenic
1013599127 6:111687855-111687877 CAGGTTAAGCAACTTGTTCAAGG + Intronic
1014369206 6:120584072-120584094 CTGGGTAAGAAGCTCCAACAGGG - Intergenic
1014403413 6:121018850-121018872 CTGGTTAATAAGCTTTTTCAGGG - Intergenic
1015936726 6:138412122-138412144 CTGGAAAAGGGGCTTCTACAGGG + Intronic
1016445659 6:144129587-144129609 CTGGTTAAGCACACTCTATAAGG + Intergenic
1016709617 6:147154769-147154791 CTGGTTAAACATCTTGTATATGG + Intergenic
1018013778 6:159694032-159694054 GAGGTTAAGCAGCTTCTCCTGGG + Intronic
1021098768 7:16563997-16564019 TTGGTTAAGTAACTTCTATATGG - Intronic
1024653395 7:51428370-51428392 CTGGAAAAGCAGCTTCAACATGG - Intergenic
1027269093 7:76510555-76510577 CTGATTAACCAGCTTCTCCAGGG + Exonic
1027550376 7:79585736-79585758 GTGGCTAAACAGCTTCTGCATGG + Intergenic
1030077881 7:105752063-105752085 CTGGTTAAGCAGCTTCTACAAGG + Intronic
1031557081 7:123190759-123190781 CTAGTTAACCAGCTTCCCCAGGG - Intronic
1032900827 7:136305584-136305606 CTAGTTAACCAGCTTCCCCAGGG + Intergenic
1033483639 7:141766224-141766246 CTGGTTAAGAAGTTTCCCCAAGG - Intronic
1035275402 7:157745298-157745320 CTGGATGAGAAGCTTCTGCACGG + Intronic
1037193069 8:16151418-16151440 ATGGTTAAGCAGACTCTATATGG + Intronic
1037985975 8:23290657-23290679 AGGGTCAAGCAGCTCCTACATGG - Intronic
1040789556 8:51210017-51210039 ATGGTTATGGAGCTACTACAGGG + Intergenic
1047844200 8:128788435-128788457 CTGGTGAAGGAGTTTCTATAAGG + Intergenic
1047926307 8:129686264-129686286 ATGGTTAAGTAACTTGTACAAGG + Intergenic
1048417950 8:134247986-134248008 CAAGTTAAAAAGCTTCTACAGGG + Intergenic
1050317687 9:4419979-4420001 CAGGTTGAGCACCGTCTACAGGG + Intergenic
1050423447 9:5490521-5490543 CTGGTTTGGCAGAATCTACATGG - Intergenic
1052204528 9:25823147-25823169 CTGGTTAAAAAGCTTCTGCACGG - Intergenic
1052551265 9:29952217-29952239 CTGGTTAAGAAACTTCATCAGGG + Intergenic
1055672118 9:78618196-78618218 CTGGTTAAGCCACCTCTATAAGG - Intergenic
1055890161 9:81115671-81115693 CTGGTGAAGCAGGTCCTACCTGG - Intergenic
1056222269 9:84461884-84461906 CGGGTTAAGCAGCTTGCCCAAGG - Intergenic
1056285104 9:85079623-85079645 CTGGTTCAGCAGCCTCTGTATGG - Intergenic
1059396719 9:114039025-114039047 CTGGTTAAGTAACTTGTCCAAGG + Intronic
1059830915 9:118094875-118094897 CTGGTTAAACAGTTTCTATAAGG + Intergenic
1186943263 X:14536324-14536346 GTGCTCAAGCACCTTCTACAGGG - Intronic
1191730492 X:64329536-64329558 CTGGTTAAGCAGCCTCCCCATGG - Intronic
1191738185 X:64409280-64409302 CTAATTAAACAGCTTCTGCATGG + Intergenic
1194908391 X:99608075-99608097 GTGGTTAAGAAACTTGTACAAGG - Intergenic
1195512222 X:105729588-105729610 CAGATTAAGAAACTTCTACATGG - Intronic
1197903255 X:131395811-131395833 CTGGGACACCAGCTTCTACATGG - Intronic
1198438218 X:136637301-136637323 GTTGTTAAGCAGCTCCTCCAAGG - Intergenic