ID: 1030079795

View in Genome Browser
Species Human (GRCh38)
Location 7:105767410-105767432
Sequence TCATTCCCAGAGAGGACGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030079795_1030079798 13 Left 1030079795 7:105767410-105767432 CCATGCGTCCTCTCTGGGAATGA 0: 1
1: 0
2: 1
3: 17
4: 139
Right 1030079798 7:105767446-105767468 GGTTAACCCACTCAGTCCTCTGG 0: 1
1: 0
2: 1
3: 6
4: 67
1030079795_1030079797 -8 Left 1030079795 7:105767410-105767432 CCATGCGTCCTCTCTGGGAATGA 0: 1
1: 0
2: 1
3: 17
4: 139
Right 1030079797 7:105767425-105767447 GGGAATGACTATGTAATTCATGG No data
1030079795_1030079799 16 Left 1030079795 7:105767410-105767432 CCATGCGTCCTCTCTGGGAATGA 0: 1
1: 0
2: 1
3: 17
4: 139
Right 1030079799 7:105767449-105767471 TAACCCACTCAGTCCTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030079795 Original CRISPR TCATTCCCAGAGAGGACGCA TGG (reversed) Intronic
902962299 1:19973052-19973074 TCATTGCCACAGAGAACGTATGG - Intergenic
903376103 1:22867011-22867033 TCCTTCTCAGAGAGGCCACAAGG - Intronic
904143139 1:28369546-28369568 GCATGCCCAGAGAGGTCGTAAGG + Intergenic
904395317 1:30217284-30217306 TCAGCCCCAGAAAGGACTCAGGG + Intergenic
905378353 1:37540722-37540744 TCATCCCCGGAGAGGACGGGAGG - Exonic
905689087 1:39929403-39929425 TCATTCTGAGAGGGGAAGCATGG - Intergenic
906409558 1:45567872-45567894 CCAATCCCAGAGAGGACAAAGGG - Intronic
906916545 1:50017293-50017315 TGAGTCCCAGAGAGGACCCAAGG + Intronic
908083926 1:60610289-60610311 GCACTCCCAGAGAGGACAGAAGG - Intergenic
913509467 1:119548888-119548910 CCATTCCCACAGGGGACTCATGG + Intergenic
916660694 1:166920577-166920599 TCCTTGCCGGAGAGGCCGCAGGG - Intronic
920957821 1:210635263-210635285 TCATAGCCAGAGAGAATGCAAGG + Intronic
921266083 1:213421635-213421657 TCATTTCCACTGAGGAAGCAGGG - Intergenic
922034804 1:221838044-221838066 TCATACTCAGAGAGGCAGCATGG - Intergenic
924037647 1:239953412-239953434 TCATTTCCAGTGAGGACTGAAGG + Intergenic
1065774561 10:29107398-29107420 TCAGTGCCAGAGAGGAAGCTGGG + Intergenic
1066099437 10:32104723-32104745 TCAGTCCTAGAGATGACTCATGG + Intergenic
1067329380 10:45300981-45301003 TCTTTCCCAGTCAGGAGGCATGG + Intergenic
1069579490 10:69555734-69555756 TCATTCCCAGGGAAGGCTCATGG + Intergenic
1069941813 10:71961926-71961948 TACTTCCCAGAGAGGAAGCAAGG + Intergenic
1070649160 10:78222510-78222532 TGAGTCCCTGAGAGGATGCATGG + Intergenic
1073322115 10:102621702-102621724 TCCTTCCCTGAGAGGAGGAAAGG + Intronic
1074366687 10:112863142-112863164 ACTTTCCCAGAGAGGAATCAAGG - Intergenic
1074768822 10:116720208-116720230 CCATTCCCAGAGACGAGGCTGGG - Intronic
1082935686 11:58654307-58654329 TCAGTCCCCTAGAGGAAGCATGG - Intronic
1083244422 11:61415278-61415300 TCATTCCTAAAGAAGACCCAGGG + Intronic
1088745614 11:112801642-112801664 TCACTCCCAGGGAGAACTCAGGG + Intergenic
1091084890 11:132712101-132712123 CCATTCCCAGAGAGGAGGAAGGG + Intronic
1091972107 12:4796374-4796396 TGATTCTCAGAGGGGACGCGGGG - Intronic
1096358913 12:50966670-50966692 TCATTCTCAGACAGGATGGAAGG + Intronic
1098256134 12:68617663-68617685 TCATTCTCACTGAGGAGGCAAGG - Intronic
1102077668 12:110073100-110073122 GGATTCCCAGGGAGGAGGCAAGG - Intronic
1104730813 12:131104365-131104387 CCATTCCCACAGTGGCCGCAAGG - Intronic
1107055701 13:36101098-36101120 TCATTCCCACAGAAGACACCCGG + Intronic
1109209604 13:59519622-59519644 TCCCTCCCAGTGATGACGCAAGG - Intergenic
1109602598 13:64651275-64651297 TCATTCCAAGATAGAAAGCATGG - Intergenic
1112610291 13:100948701-100948723 TCATTCCCACAGAAGAAGCAGGG - Intergenic
1113856083 13:113446138-113446160 TCCCCCCCAGAGAGCACGCAGGG + Intronic
1113871580 13:113563105-113563127 TCATTCCCTGAGATGACATAGGG + Intergenic
1117200301 14:53383196-53383218 TCAGTGCCAGACAGGAGGCATGG - Intergenic
1120199157 14:81517906-81517928 TCAGTCCCAGAGGGTACACATGG - Intronic
1122700315 14:103583996-103584018 GCATGCCCAGAGAGGGCGCAGGG - Intronic
1125287303 15:38107563-38107585 TTATTTCCAGAGAGCACACATGG - Intergenic
1125754110 15:42050704-42050726 TGAGTCCCAGAGAGGAGGCTGGG - Exonic
1128316321 15:66661598-66661620 TCATTCCCAGGAAGTCCGCATGG - Intronic
1131435145 15:92416305-92416327 CCATTCCCTGAGAGGACACCGGG + Intronic
1133857080 16:9559602-9559624 TCAGACCCAGAGAGTAAGCATGG + Intergenic
1137613513 16:49834530-49834552 TGCTTCCCAGAGGGGACGCAGGG - Intronic
1147303624 17:39548783-39548805 TCAGTCCCATAGAGGCCCCAGGG - Intronic
1148509031 17:48153287-48153309 CCATTCCAAGAGAGGACAAAAGG - Intronic
1149442255 17:56684590-56684612 TCATTCACAGAGGGTACCCAGGG + Intergenic
1151429674 17:74053796-74053818 TCATTCCCAGTGAGGCCCGAGGG - Intergenic
1157556097 18:48613760-48613782 TGCTTCCCAGAGAGGACCCAGGG - Intronic
1160148001 18:76379665-76379687 CCTTTCCCGGAGCGGACGCACGG - Exonic
1161287830 19:3477903-3477925 GGATTCCCACAGAGGACTCAGGG - Intronic
1163166170 19:15499654-15499676 TAATTCCCAGGGAGGAAGCAGGG + Intergenic
1167154563 19:47730204-47730226 GCTTTTCCAGAGAGGAAGCAGGG - Intronic
1167732293 19:51267219-51267241 TAATTCCCAGAGAGGATGTGTGG + Intronic
926008905 2:9393306-9393328 CCATTCACAGGGAGGAAGCAGGG - Intronic
926727277 2:16008449-16008471 TCATTCCCAGACGGGACTTAGGG + Intergenic
926958260 2:18326069-18326091 TCATTCCCAGTGAGGGTGGAGGG - Intronic
927249700 2:20986617-20986639 TTTTTCCCAGGGAGGACGAAAGG + Intergenic
928176836 2:29039702-29039724 CCAATCCCAGAGAGGCCTCAAGG - Intronic
929213511 2:39385288-39385310 TCATTCCCAGAAGCAACGCATGG + Intronic
933814502 2:86054879-86054901 ACATTCCCAGAGATGAAGCAGGG + Intronic
933915207 2:86984402-86984424 TCAGTCACAGAAAGGACGTAAGG - Intronic
934007786 2:87785498-87785520 TCAGTCACAGAAAGGACGTAAGG + Intronic
935047496 2:99495179-99495201 TCATTCCAAGAGAGGAAGCAAGG + Intergenic
935771423 2:106426416-106426438 TCAGTCACAGAAAGGACGTAAGG + Intronic
935824436 2:106930517-106930539 TCCTTGCCAGAGAGGAGGTAAGG - Intergenic
935908651 2:107869532-107869554 TCAGTCACAGAAAGGACGTAAGG - Intronic
935995054 2:108761747-108761769 TCAGTCACAGAAAGGACGTAAGG - Intronic
936130434 2:109834650-109834672 TCAGTCACAGAAAGGACGTAAGG - Intronic
936214263 2:110536835-110536857 TCAGTCACAGAAAGGACGTAAGG + Intronic
936247184 2:110838577-110838599 TCATTCCTACAGAGAAAGCAGGG - Intronic
936423400 2:112391398-112391420 TCAGTCACAGAAAGGACGTAAGG + Intronic
938568038 2:132538501-132538523 TCTTTCCCAGTCAGGAGGCATGG + Intronic
940001416 2:148969938-148969960 TCCTGCCCAGAGAGGAACCAAGG - Intronic
941716583 2:168769805-168769827 TCATTCACAGACAGGACACATGG - Exonic
943575428 2:189625958-189625980 TCATCCCCAGAGAGGAGAGAGGG - Intergenic
944108186 2:196102068-196102090 TCAGTCTCAGAGAGGAGTCATGG + Intergenic
944206247 2:197161558-197161580 TCAACACCAGAGAGGACACAGGG + Intronic
945915615 2:215701207-215701229 TCTTTCCCAGAAAGGCCACATGG - Intergenic
948466415 2:238153868-238153890 TCTTTCCCATAGAGGATGCTGGG + Intergenic
1169224537 20:3847721-3847743 TCAAGCCCAAAGAGGACCCAAGG - Intronic
1171152632 20:22841265-22841287 TCATCCTCAGAAAGGAAGCAAGG + Intergenic
1175806459 20:61831851-61831873 TCATTCCCACAGAGGCCGAGAGG + Intronic
1177766556 21:25464597-25464619 TCATTCTCAGAGAGAAAGAAGGG - Intergenic
1177848733 21:26321665-26321687 CTATTGCCAGAGAGGAAGCAAGG + Intergenic
1178906718 21:36642732-36642754 TCACTGCAAGAGAGGCCGCAAGG + Intergenic
1179145162 21:38761612-38761634 TCATTCCCAGAGCGGCTGCAGGG + Intergenic
1179330413 21:40395789-40395811 CCATTCCCTGAGAGGACTCCAGG - Intronic
1181235171 22:21444217-21444239 CCCTTCCTAGAGAGGACGGAGGG + Intronic
1182096136 22:27627247-27627269 TCACTCCCCAAGAGGACACATGG + Intergenic
1183192566 22:36331175-36331197 TCATTCCCAGAGAGGTCAAGGGG - Intronic
1184856991 22:47151738-47151760 TCAACCCCAGAGCAGACGCAGGG - Intronic
949163549 3:910459-910481 TCATTCTCATAGAAGAAGCAAGG - Intergenic
949343005 3:3049727-3049749 ACATTCCCAGAGAGGTGCCAAGG - Intronic
953566671 3:44037847-44037869 TACTTCCCAGAGAGGACAAAAGG - Intergenic
961200795 3:125043765-125043787 TCACACCCAGAGAGGAAGCTGGG + Intronic
962712485 3:138099741-138099763 TCATTGCAAGAGAGGAAGTAAGG - Intronic
963074640 3:141334516-141334538 TCCTTCCCAGAGAGAAAGGAAGG - Intronic
963112911 3:141701532-141701554 TACTTCCCAGAGAGGAAGCAAGG + Intergenic
969613622 4:8240235-8240257 AGATTCCCAGAGAGGACACCTGG + Intronic
970869336 4:20797466-20797488 ACATTCCCAGAGATTATGCAGGG - Intronic
971469174 4:27001547-27001569 TCATCCGCAGAGGGGACACAGGG + Intronic
977774175 4:100897672-100897694 TAATTCCCAGAGAAGACTAATGG + Intergenic
979295368 4:119026882-119026904 TGACTCCCAAAGAGGACGCGTGG + Exonic
980151602 4:129055217-129055239 TCTTTCCCAGTCAGGAGGCATGG + Intronic
984492773 4:180456788-180456810 TAATTCCCAGAGACAAAGCAGGG + Intergenic
985349315 4:189040603-189040625 TCATTGCCAGAGAGGCCACCTGG - Intergenic
985826481 5:2195412-2195434 CCCTTCCCAGACAGGATGCAGGG - Intergenic
985954308 5:3251934-3251956 TCCTTCCCAGAGGGGACACAGGG - Intergenic
986298359 5:6457884-6457906 TCAATCCACGAGAGGACGGATGG + Intronic
994042271 5:95272743-95272765 TGATTCCCACAGAGAAAGCAAGG + Intronic
999850809 5:155536509-155536531 CCACTCCCAGAGAGGAGGGAAGG - Intergenic
1001698941 5:173692646-173692668 TCATTTCCAGAGAGGGCTCAAGG - Intergenic
1001880841 5:175242796-175242818 TCATTGCCAGAGAAGAGGAATGG + Intergenic
1003254911 6:4466528-4466550 CCATGTCCAGAAAGGACGCAGGG + Intergenic
1004002669 6:11609690-11609712 TCATTCCCAGACAGGATGTTGGG - Intergenic
1004060149 6:12187442-12187464 ACATGGCAAGAGAGGACGCAAGG - Intergenic
1004246811 6:13985855-13985877 ACATGGCCAGAGAGGAAGCAAGG - Intergenic
1010631107 6:78199383-78199405 TCATGGCCAGAGAGGAAACAAGG - Intergenic
1013617455 6:111858228-111858250 AGAGTCCCAGAGAGGAGGCAGGG + Intronic
1014512732 6:122344314-122344336 TCAATCCCAGAGATGATGCAGGG + Intergenic
1017889182 6:158625088-158625110 TCATTCCCTAGGAGGACACAAGG - Exonic
1017956260 6:159180262-159180284 TCTTTACAAGAGAAGACGCAGGG - Intronic
1018595052 6:165470185-165470207 ACATGACCAGAGAGGAAGCAAGG + Intronic
1020788148 7:12594073-12594095 TACTTCCCGGAGAGGAAGCAAGG + Intronic
1022652215 7:32287708-32287730 ACATTCCCAGGTAGGACCCATGG - Intronic
1025712917 7:63928077-63928099 TCAGACCCAGAGAGGATTCAGGG - Intergenic
1030079795 7:105767410-105767432 TCATTCCCAGAGAGGACGCATGG - Intronic
1032502010 7:132406782-132406804 TCATTCACAGAGAGGTTGCGTGG - Intronic
1037734519 8:21555635-21555657 TCAGTCCCAGAGAGCACTCTGGG - Intergenic
1038405388 8:27318612-27318634 TCAATGCCACAGAGGACACATGG - Intronic
1039411637 8:37359962-37359984 TCACTCCCAGAGAGGCAGCCAGG + Intergenic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1042962655 8:74320735-74320757 CCTTTCCCAGAGAGGGCGCTGGG - Intronic
1044290452 8:90462762-90462784 TGATTCTCAGAGAAGACACAAGG - Intergenic
1044998804 8:97862255-97862277 TCATTCCTATAGATGATGCAAGG + Intergenic
1045430762 8:102112846-102112868 ACATGGCCAGAGAGGAAGCAAGG - Intronic
1045732960 8:105263317-105263339 AAATTCCCAGAGAGGAGGGATGG + Intronic
1045846335 8:106641363-106641385 TCATTTACAGAGAAGATGCAGGG - Intronic
1048894878 8:138982856-138982878 TCATTCCCAGGGAGAAAGCATGG + Intergenic
1052239698 9:26256350-26256372 TCATTTCTAGAGAGGACATAAGG + Intergenic
1055102783 9:72482349-72482371 TCATTCACAGACAGGAAGTATGG + Intergenic
1056848450 9:90059993-90060015 TCATTCCCAGAGCTGCCCCAGGG - Intergenic
1061353302 9:130083277-130083299 TTATTGCCAGAGAGGCCACATGG - Intronic
1061817911 9:133207360-133207382 TCATTCCCAGAGAGAACACTCGG + Intronic
1062382879 9:136296022-136296044 CCATACCCAGAGAGGACACGCGG - Intronic
1186008664 X:5104570-5104592 TCATGCCCAGAGAAGGCTCAGGG + Intergenic
1187016554 X:15335116-15335138 TGATTCCCTGAGAGGTCGCTGGG + Intronic
1190167168 X:48082843-48082865 TAATTCCCAGAGAAGCCCCAGGG - Intergenic
1190417010 X:50190202-50190224 TTATTCCCAGAGAAGACACTGGG + Intergenic
1193010707 X:76671726-76671748 TGACTCCCAGTGAGGAGGCATGG - Intergenic
1196255905 X:113518307-113518329 TCATTCATAGAGAAGACACAAGG + Intergenic
1198687088 X:139238244-139238266 TCATGCCCAGTGAGGAGGAATGG - Intergenic
1201671654 Y:16528313-16528335 TGATGCCCAGAGAAGACACATGG - Intergenic