ID: 1030079845

View in Genome Browser
Species Human (GRCh38)
Location 7:105767828-105767850
Sequence GAGCAAGCCAGTGCCCACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 154}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030079845_1030079854 21 Left 1030079845 7:105767828-105767850 CCCATGTGGGCACTGGCTTGCTC 0: 1
1: 0
2: 0
3: 9
4: 154
Right 1030079854 7:105767872-105767894 CCACCCCTCTGGAGTTCGACTGG No data
1030079845_1030079851 10 Left 1030079845 7:105767828-105767850 CCCATGTGGGCACTGGCTTGCTC 0: 1
1: 0
2: 0
3: 9
4: 154
Right 1030079851 7:105767861-105767883 CCTTCTCCAGTCCACCCCTCTGG 0: 1
1: 0
2: 2
3: 26
4: 269
1030079845_1030079859 30 Left 1030079845 7:105767828-105767850 CCCATGTGGGCACTGGCTTGCTC 0: 1
1: 0
2: 0
3: 9
4: 154
Right 1030079859 7:105767881-105767903 TGGAGTTCGACTGGTACTCAGGG No data
1030079845_1030079858 29 Left 1030079845 7:105767828-105767850 CCCATGTGGGCACTGGCTTGCTC 0: 1
1: 0
2: 0
3: 9
4: 154
Right 1030079858 7:105767880-105767902 CTGGAGTTCGACTGGTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030079845 Original CRISPR GAGCAAGCCAGTGCCCACAT GGG (reversed) Intronic
900218537 1:1495054-1495076 GAGGCAGCCACTGCCCACCTTGG - Intronic
900709821 1:4106778-4106800 GAGGAAGCCAGTGCTCAGAGAGG + Intergenic
902812688 1:18897846-18897868 GGGCAAGTCACTGCCCACCTTGG - Intronic
904616506 1:31752962-31752984 GGGCAGGCCAGTGCCCACAGGGG + Intronic
904616792 1:31754300-31754322 GAGCAAGGCTCTGCCCTCATGGG - Intronic
904801345 1:33094877-33094899 GAGCAAGCCAAGGCTCACAGAGG + Intronic
904829258 1:33296197-33296219 GTGCAGGCCAGCGCCCACAGTGG - Intronic
906518328 1:46452618-46452640 TAGCAGGTCAGTGACCACATGGG - Intergenic
912493721 1:110077757-110077779 GAGAAAGCCAGGGCACACCTTGG - Intergenic
916822144 1:168410066-168410088 TAACAAGCCAGTGCCAAGATGGG + Intergenic
917596702 1:176536561-176536583 GATCTAGCCAATGCCCACACAGG - Intronic
920877852 1:209854158-209854180 CAGCAAGCAAGTGCCTATATAGG + Exonic
921123815 1:212159412-212159434 AGACAAGGCAGTGCCCACATAGG + Intergenic
922882098 1:228988855-228988877 GAGCATGCCTGTGGCCACACTGG - Intergenic
923099015 1:230797643-230797665 GAGCAAGTCACTGCCCTCTTGGG - Intronic
923545577 1:234920812-234920834 AAGCAAGGCAGTGGCCACACTGG + Intergenic
1063543720 10:6960482-6960504 GACCAAGCCAGTCCCCAGAGAGG + Intergenic
1067830354 10:49608271-49608293 GGCCAGGCCTGTGCCCACATTGG + Intergenic
1067839533 10:49664986-49665008 GAGCAAGCCATTGGCAACAAAGG + Exonic
1070195330 10:74151385-74151407 AAGCAAGCCAGGGCCCACGTGGG + Intronic
1070436737 10:76401252-76401274 GAGCAAGCCAGTGTGCCCACAGG + Intronic
1073281633 10:102358766-102358788 GATCAAGCCATTTCCCACAGTGG - Intronic
1073355437 10:102850140-102850162 GAGTAAGCGAGTGGCCACGTTGG - Intergenic
1075213455 10:120511329-120511351 CAGAAAGTCACTGCCCACATAGG - Intronic
1075424644 10:122332111-122332133 GAGCAAGCAAGGCCCCTCATGGG - Intronic
1075792167 10:125092776-125092798 ACGTAAGCCAGTGCCCACATTGG - Intronic
1078619327 11:12893021-12893043 GAGGAAGCCAGGGCCCAGAAAGG + Intronic
1080822366 11:35819513-35819535 GAGACAGCCGGTGACCACATGGG - Intergenic
1084477836 11:69398935-69398957 GAGCAAGACAGAGGCCACAGTGG + Intergenic
1088754139 11:112872007-112872029 GAGCAACTCTGTGCCCACACGGG + Intergenic
1089920276 11:122203130-122203152 TAGCAAGGCAGTGCCCAGTTGGG + Intergenic
1091589235 12:1833607-1833629 GAGCAATCCAATGGCCCCATCGG - Intronic
1091589289 12:1833919-1833941 GAGTAAGGCAGTGCTAACATGGG - Intronic
1093296770 12:17400913-17400935 GAGGAAGCCACTGCCACCATGGG + Intergenic
1093366139 12:18302137-18302159 GCTAAATCCAGTGCCCACATAGG - Intronic
1094497365 12:30996718-30996740 GAGTAAACCATTGGCCACATTGG + Intergenic
1098610066 12:72445913-72445935 TAACCAACCAGTGCCCACATGGG - Intronic
1104609182 12:130214601-130214623 GAGATAGCAAGTGCACACATAGG + Intergenic
1104773132 12:131376945-131376967 GACTAAGACAGTGCTCACATGGG - Intergenic
1106674248 13:31941059-31941081 GAGCAATCCTGTGCCAACACAGG - Intergenic
1108229164 13:48319192-48319214 GAGGAAGCCAGTGGCCACCAAGG - Intronic
1109855799 13:68126385-68126407 GAGCAAGTCACTGCCCTCAGTGG - Intergenic
1113666242 13:112143628-112143650 GAGCAGGCCAGGCCCCACTTAGG + Intergenic
1113680484 13:112240268-112240290 CAGCTAGCCAGTTCCCACACAGG - Intergenic
1116949000 14:50861671-50861693 GTTAAAGTCAGTGCCCACATAGG + Intronic
1116982687 14:51188390-51188412 GAGCATGCCTGTGCACACCTGGG + Intergenic
1117144371 14:52822299-52822321 GAGGAAGCCATTGCTAACATTGG + Intergenic
1118324879 14:64773980-64774002 GTGGAAACCTGTGCCCACATGGG - Intronic
1119207026 14:72802102-72802124 GAGCAAGCAAATGCTCACACAGG + Intronic
1119758810 14:77137316-77137338 GAGCCAGTGAGTGCCCACCTTGG - Intronic
1121287690 14:92748908-92748930 GAGCAAACCTGTCCGCACATTGG + Intergenic
1122647070 14:103201938-103201960 GAGCAGGCTACCGCCCACATGGG + Intergenic
1124807979 15:32905590-32905612 TAGAAAGCCATTGCCCACAGAGG - Intronic
1124925045 15:34062848-34062870 GACCAAGACATTGCCCACAATGG - Exonic
1126459017 15:48895616-48895638 GAGCCAGGCTGTGCCCACCTGGG + Intronic
1126534290 15:49743714-49743736 GAGCAAACCAGACCCCAAATTGG + Intergenic
1128772720 15:70294393-70294415 GAGCAACCCAGTGGACACAATGG + Intergenic
1129262020 15:74373961-74373983 GAGCCAGCCACAGCCCACAGTGG + Intergenic
1129287461 15:74537534-74537556 GAGCGAGCCAGTGAGCACAGTGG - Intergenic
1132328845 15:100996296-100996318 GGGAATGCCAGTGCCCACGTTGG - Intronic
1134196224 16:12161363-12161385 GAGCTTCCCAGTGACCACATGGG - Intronic
1135584556 16:23658897-23658919 GAGCAAGCCAGGCCTCACAAGGG + Intronic
1135665396 16:24331431-24331453 GATCAAGCCAGAGTCCACAGAGG - Intronic
1136654178 16:31699889-31699911 GCGGAAGCCACTGCCCACGTGGG + Intergenic
1138500107 16:57436157-57436179 GAACAAGCCCCAGCCCACATGGG + Intronic
1141027470 16:80561732-80561754 GAGCAAGATACTGCCCTCATAGG - Intergenic
1141680286 16:85539847-85539869 GAGCAATGCCCTGCCCACATGGG - Intergenic
1143493782 17:7298993-7299015 GCTCAAGCCATTGCCCACCTTGG + Intergenic
1144764893 17:17727272-17727294 GAGGAAGCCAGAGCCCAGAGAGG + Intronic
1145070834 17:19806147-19806169 CTGCAAGCCAGTGCACTCATAGG + Intronic
1151806381 17:76408081-76408103 GAGAAAGCCAGTGCCCAGTATGG - Intronic
1152253317 17:79223024-79223046 GAGGAAGCCACTGGCCATATGGG - Intronic
1157379678 18:47202175-47202197 GGGAGAGCCAATGCCCACATGGG + Intergenic
1159405608 18:67998729-67998751 GAGCAAACCTGTGCCCCTATTGG + Intergenic
1160153981 18:76418978-76419000 GAGCAAGCTGGTGCCCAGCTGGG + Intronic
1160234330 18:77074155-77074177 GAGGTAGACAGTGCCCACGTGGG + Intronic
1161797692 19:6396639-6396661 CAGCAAGGCAATGGCCACATGGG - Intergenic
1161983638 19:7642921-7642943 AAGCCAGGCAGTGCCCACCTGGG - Intronic
1162955130 19:14093089-14093111 GGGCATGCCTGTGCCCCCATGGG - Exonic
1164583197 19:29447906-29447928 TAGCAATCCAGTGTCCACAGGGG - Intergenic
925713092 2:6760668-6760690 GAACAAGACAGTGCCCAAAAAGG + Intergenic
926168810 2:10537921-10537943 GAGCAGGCCAGGTCCCACATGGG - Intergenic
926617498 2:15011656-15011678 GAGCAATCCAGACCCCATATTGG + Intergenic
929198061 2:39206505-39206527 GAGTAAGCCCGCGCGCACATGGG + Intronic
931521582 2:63103526-63103548 GAACAAGCCAATCCCCAAATTGG - Intergenic
933394974 2:81719509-81719531 GAGAATACCAGTGCTCACATTGG + Intergenic
935130477 2:100257557-100257579 GGCCAGGCCAGTGCCCACCTTGG + Intergenic
938240555 2:129739438-129739460 GGACAACCCTGTGCCCACATAGG + Intergenic
939855542 2:147354552-147354574 GGGGAAGCCAGTGCAAACATGGG + Intergenic
940910524 2:159206116-159206138 GAGTAAGCCAGTACCCTCAAGGG + Intronic
940941273 2:159564288-159564310 GAGCAAGGCAGAGACCACAGAGG + Intronic
941431109 2:165415602-165415624 GAGCAAAAAAGAGCCCACATAGG - Intergenic
941642149 2:167999926-167999948 GAGGACACCAGTGCCCACAAGGG - Intronic
943378920 2:187118640-187118662 AAGGAAGGCACTGCCCACATAGG - Intergenic
1170718077 20:18849184-18849206 GAGCCAGCCAGTCCCCAAATGGG - Intergenic
1170981513 20:21218734-21218756 GAGGAAACTGGTGCCCACATTGG - Intronic
1178705463 21:34869155-34869177 GAGCAAGCCAGAGGCAGCATGGG - Intronic
1179924809 21:44528613-44528635 CAGCAAGCCAGTGCCCCCAAAGG + Intronic
1181731083 22:24847318-24847340 GAGCAAACCAGTGCTCTCAGGGG - Intronic
1183319948 22:37159017-37159039 AAGAAAGCCAGTACCCACAACGG + Intronic
1184155109 22:42662304-42662326 GACCCAGCCCGTGCCCACCTTGG + Intergenic
1184460425 22:44634711-44634733 GAGCCAGCCAGTGCGCCCCTTGG - Intergenic
1184538591 22:45104443-45104465 GCTCAGGCCAGTGTCCACATGGG - Intergenic
1185202898 22:49518790-49518812 GAGAAAGGCAGGGCCCTCATCGG - Intronic
1185233949 22:49700227-49700249 GAGGAAGCTGCTGCCCACATCGG + Intergenic
949524337 3:4888499-4888521 CTGCAAGCCAGTGCCTGCATTGG - Intergenic
950674284 3:14545262-14545284 GAGGAAGCCAGGGCCCAGAAAGG + Intergenic
953412162 3:42696770-42696792 GAGCAGGGCAGTGCCAAGATGGG - Intronic
954412564 3:50377409-50377431 GAGCCTGCCTGTGTCCACATGGG + Intronic
954662016 3:52231350-52231372 GAGCAAGCTAGTGCCAGCTTCGG - Intronic
960607623 3:119523870-119523892 GAGCAAGCCACTGCCACCACAGG - Exonic
962828232 3:139118417-139118439 GACCCAGCCAGTTCCCACAAGGG - Intronic
964697944 3:159530802-159530824 GAGCAGGGCAGTGCCTACAGGGG - Intronic
966460232 3:180168494-180168516 CAGCAAGCCAGACCCCAAATTGG - Intergenic
967074347 3:185988752-185988774 GTTCAAGCCAGAGCCCAAATTGG - Intergenic
967387787 3:188928029-188928051 GGGCAAGACTGTGCCTACATAGG - Intergenic
967942682 3:194778294-194778316 GACCAAGCCACTGCCCTGATGGG - Intergenic
969058814 4:4419127-4419149 AAGCATCCCAGCGCCCACATGGG - Exonic
969590819 4:8121093-8121115 GAGCCAGCCAGTCCCCAGCTGGG - Intronic
971352688 4:25867091-25867113 GAGTTAGCCAGTGGCCACTTAGG - Intronic
974116661 4:57587450-57587472 GAGCAAGCCACAGCCCATCTGGG + Intergenic
979718489 4:123870205-123870227 GAGAAAGTCAGTGCCAAGATGGG - Intergenic
981598902 4:146462417-146462439 GAGCAAGTCACTTCCCACACTGG - Intronic
981646167 4:147001185-147001207 GAGCAAGCCAATGGCAAAATAGG - Intergenic
982104020 4:151996196-151996218 GAGCAAGCCATTCCCCAGGTGGG - Intergenic
985687182 5:1288808-1288830 GAGCAAGCCAGGCCCAACAGAGG + Intronic
987100498 5:14587363-14587385 TGGCAAGCCAGTGCCAGCATGGG + Intronic
988478762 5:31611755-31611777 GAGTAAGCCACTGCCCAGGTTGG + Intergenic
989657813 5:43762794-43762816 AACTAAGCCAGTGCCCACAGAGG - Intergenic
992759438 5:79938571-79938593 GAGCAAACCTGTGCCCACTGAGG - Intergenic
994734140 5:103531553-103531575 GCGCAACCCAATCCCCACATTGG - Intergenic
999787051 5:154900534-154900556 CAGAAAGCCAGTGCCAAGATAGG - Intronic
1006814657 6:36841776-36841798 AAGGAAGCCAGTGCCCAGAGAGG + Intergenic
1011803412 6:91044298-91044320 GAGCAAGCCATTCCCCACCTGGG - Intergenic
1016921415 6:149298393-149298415 GCTCAAGCCATTGCCCACCTTGG - Intronic
1017995365 6:159527554-159527576 GAGGGAGCCACTGCACACATGGG + Intergenic
1019997390 7:4733676-4733698 AAGCTGCCCAGTGCCCACATGGG + Intronic
1026952946 7:74359804-74359826 GGGCAAGCCAGACCCCAGATGGG - Intronic
1030079845 7:105767828-105767850 GAGCAAGCCAGTGCCCACATGGG - Intronic
1032092735 7:128919465-128919487 GCATGAGCCAGTGCCCACATGGG + Intergenic
1034354532 7:150442368-150442390 GAGCCTGCTAGTGCCTACATGGG + Intergenic
1036655984 8:10677796-10677818 GATAAAGCCAGTGCACCCATCGG - Intronic
1037492542 8:19409805-19409827 AAGCCAGCCAGTGGTCACATTGG - Intronic
1039574985 8:38615922-38615944 CAGCAAGTCAGTGCCAACAATGG + Intergenic
1041006787 8:53503410-53503432 GAGCTAGCCTGTGCTCACCTGGG - Intergenic
1047586698 8:126281139-126281161 GAGCAAGGAAGTGCCCAGATTGG + Intergenic
1047739032 8:127792638-127792660 GAGGAAGCCAGTGTCCTCCTGGG - Intergenic
1052980402 9:34444219-34444241 GGGAAAGCCAGTAGCCACATTGG - Intronic
1053095825 9:35327485-35327507 GAGGAAGCAAATGTCCACATGGG + Intronic
1057906873 9:98990228-98990250 GAGCAAACCAAGGCCCAGATAGG + Intronic
1061841696 9:133362205-133362227 GAGCCAGCCTGTCCCCAGATAGG + Exonic
1062023353 9:134329452-134329474 TAGCAAGCCAGGGCCACCATCGG - Intronic
1062485622 9:136773823-136773845 CTGGATGCCAGTGCCCACATGGG - Intergenic
1187273531 X:17799846-17799868 GAGCAAGTCATTTCCCACTTTGG - Intergenic
1190274991 X:48893708-48893730 GAGGAAGCCACTGCCACCATGGG - Exonic
1193624128 X:83795187-83795209 CAGCAAGCCAGACCCCAAATTGG + Intergenic
1193822209 X:86179716-86179738 GAGCAAGCCAGCTCCTTCATTGG - Intronic
1195021185 X:100830563-100830585 GATCAAACCAGTGCCCCCATGGG + Intronic
1197999824 X:132421598-132421620 TAATAAGCCAGTGCCCACTTAGG + Intronic
1198118430 X:133567200-133567222 GAGCAAGACAGGGCTCACCTGGG - Intronic
1200845632 Y:7829339-7829361 GAGCTATCCAGTGCACACAGAGG - Intergenic
1201376806 Y:13331250-13331272 GATCAAGCCAGTGCCCCTCTGGG + Intronic
1201403800 Y:13630796-13630818 GAGCAAGCCAATCACCCCATAGG + Intergenic
1202086729 Y:21145756-21145778 GAGTAAGGCAGTTCCCACAAGGG - Intergenic