ID: 1030079846

View in Genome Browser
Species Human (GRCh38)
Location 7:105767829-105767851
Sequence TGAGCAAGCCAGTGCCCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 182}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030079846_1030079851 9 Left 1030079846 7:105767829-105767851 CCATGTGGGCACTGGCTTGCTCA 0: 1
1: 0
2: 0
3: 22
4: 182
Right 1030079851 7:105767861-105767883 CCTTCTCCAGTCCACCCCTCTGG 0: 1
1: 0
2: 2
3: 26
4: 269
1030079846_1030079859 29 Left 1030079846 7:105767829-105767851 CCATGTGGGCACTGGCTTGCTCA 0: 1
1: 0
2: 0
3: 22
4: 182
Right 1030079859 7:105767881-105767903 TGGAGTTCGACTGGTACTCAGGG No data
1030079846_1030079858 28 Left 1030079846 7:105767829-105767851 CCATGTGGGCACTGGCTTGCTCA 0: 1
1: 0
2: 0
3: 22
4: 182
Right 1030079858 7:105767880-105767902 CTGGAGTTCGACTGGTACTCAGG No data
1030079846_1030079854 20 Left 1030079846 7:105767829-105767851 CCATGTGGGCACTGGCTTGCTCA 0: 1
1: 0
2: 0
3: 22
4: 182
Right 1030079854 7:105767872-105767894 CCACCCCTCTGGAGTTCGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030079846 Original CRISPR TGAGCAAGCCAGTGCCCACA TGG (reversed) Intronic
900595172 1:3477161-3477183 TGGGGAAGCCGGGGCCCACAGGG + Intronic
901404375 1:9036503-9036525 TGACCAAGCCCCTGCCCTCAAGG + Exonic
901666979 1:10831654-10831676 TGAGCACCCCAGGGCCCACTGGG - Intergenic
902837268 1:19054986-19055008 TGAGCTGGCCAGCGCCCCCAGGG - Intergenic
903349511 1:22709848-22709870 AGAGCAGGGCAGGGCCCACAGGG + Intergenic
904161019 1:28522056-28522078 TGAGTTAGCCGGTGCCCCCAGGG + Intronic
904610914 1:31725890-31725912 AGAGCAAGCCTGTGCCATCAAGG + Intergenic
904616505 1:31752961-31752983 GGGGCAGGCCAGTGCCCACAGGG + Intronic
906108304 1:43307551-43307573 AGAGGAAGCCAGTGCCAAGAAGG + Exonic
906243732 1:44258570-44258592 AGACCAAGCCACTGCCCTCAAGG + Intronic
907837655 1:58126297-58126319 TGAGGAAGCCAATTCCCCCAGGG + Intronic
918216976 1:182400300-182400322 TGAGGAAGCAAGTGCCATCAAGG - Exonic
920344240 1:205295644-205295666 GGAGAAAGCCAGTCCCCACCAGG + Intergenic
922184321 1:223260564-223260586 ACAGCAAGCCAGGGCCCACAGGG + Intronic
923099016 1:230797644-230797666 TGAGCAAGTCACTGCCCTCTTGG - Intronic
923113804 1:230915224-230915246 TGAGAAAGCCAGAGCCCAAGAGG + Intronic
1064230219 10:13523238-13523260 TGAGAAAGTCAATGTCCACAGGG + Intronic
1067549343 10:47222640-47222662 TGAGCATGCCACTGTCTACACGG - Intergenic
1069599468 10:69694097-69694119 TGGCCAACCCAGTGCCCATAGGG + Intergenic
1070195329 10:74151384-74151406 CAAGCAAGCCAGGGCCCACGTGG + Intronic
1072532199 10:96330059-96330081 TGGGGAAGCCAGAGCCCAGAGGG + Intronic
1073118805 10:101108680-101108702 TGAGCCAGCAGGTGCCAACAGGG + Intronic
1075162665 10:120038342-120038364 TGAGCAAGCCAGTGCATTTATGG + Intergenic
1077244375 11:1528986-1529008 TCAGCAAGACAGACCCCACAGGG - Intergenic
1077780550 11:5324168-5324190 GGAGCATGCCATTGCCCAGAAGG + Exonic
1078669921 11:13355522-13355544 TTAGCAAACCAGAGTCCACAAGG - Intronic
1078726850 11:13939666-13939688 TGAGCAAACCCGAGTCCACAGGG + Intergenic
1085593075 11:77782563-77782585 TTAGCAAACTACTGCCCACAAGG + Intronic
1088754138 11:112872006-112872028 AGAGCAACTCTGTGCCCACACGG + Intergenic
1089760861 11:120722145-120722167 TGAGCAAGCCAGCACACAAAGGG + Intronic
1092674389 12:10900230-10900252 TGAGCAACCCAGTGCTCAGAGGG + Intronic
1093296769 12:17400912-17400934 TGAGGAAGCCACTGCCACCATGG + Intergenic
1094100494 12:26757153-26757175 TGGGCAAGCAACAGCCCACAGGG + Intronic
1095606195 12:44070634-44070656 TGAGAAAGCCAAGGCCCAGAGGG + Intronic
1096846700 12:54411425-54411447 TGACTAAGCCACTGCCCTCAAGG - Intronic
1097137574 12:56871534-56871556 TGAGCAAGGCACTGCCCTCACGG + Intergenic
1099993577 12:89752918-89752940 AGTGCAGGTCAGTGCCCACAGGG - Intergenic
1102823107 12:115924774-115924796 TGAGGAAGCCAGCGCCCCCTGGG + Intergenic
1102952463 12:117039934-117039956 TTAGCAAGTCAGGGCCCACGGGG + Intronic
1103916894 12:124380428-124380450 TGCCCCTGCCAGTGCCCACAGGG + Intronic
1104652002 12:130541905-130541927 TGAGCAAGCTAATGCCCCCTTGG + Intronic
1105699853 13:22927350-22927372 TGCCTAAGCCACTGCCCACAAGG - Intergenic
1106075885 13:26460837-26460859 AGACCATGCCAGTGCCCCCAGGG + Intergenic
1106554707 13:30799501-30799523 TTAGAAAGCCAGGCCCCACAAGG + Intergenic
1107038735 13:35927061-35927083 TGAGGAAGCCAAAGCCCAGAGGG - Intronic
1108851066 13:54729830-54729852 TGATCTAGTCACTGCCCACAAGG - Intergenic
1110201266 13:72852418-72852440 TGAGCAAGTCAGTGAGTACAGGG - Intronic
1112254537 13:97817594-97817616 AGAGCAAGACAGGGCACACAGGG + Intergenic
1114484001 14:23052449-23052471 TGAGGACTCCAGGGCCCACAAGG - Intronic
1118870031 14:69733766-69733788 TTATCTACCCAGTGCCCACAGGG - Intronic
1120088739 14:80306479-80306501 TGAGTAGGCCAGAACCCACATGG + Intronic
1128694626 15:69751446-69751468 TGAGCAAGGCAGTGCCTATGGGG + Intergenic
1129600619 15:76996203-76996225 TAAGCAAGCCATTGCCCACCTGG - Intronic
1130680639 15:85993199-85993221 TGAGTAAGCCTGTGACCAGATGG + Intergenic
1131608222 15:93932316-93932338 TGAGCAAGGCACTCCCCATAGGG + Intergenic
1132153727 15:99480547-99480569 TGGGCAAGCCAGGGGCCAGATGG - Intergenic
1133641766 16:7724028-7724050 AGAGCCAGAGAGTGCCCACAAGG + Intergenic
1135452590 16:22571318-22571340 TCAGCAATCCTGGGCCCACATGG - Intergenic
1135584555 16:23658896-23658918 GGAGCAAGCCAGGCCTCACAAGG + Intronic
1135977996 16:27123844-27123866 TTACCAAGCCCGTGCCCACACGG + Intergenic
1136654177 16:31699888-31699910 TGCGGAAGCCACTGCCCACGTGG + Intergenic
1137802495 16:51274215-51274237 TGAGAAAGCCAGTGGGGACAAGG - Intergenic
1138436494 16:57003545-57003567 TGAGCAAGGCAATGCCCACCAGG - Intronic
1139121556 16:64024640-64024662 TGAGCAAGTCACGGCCCAGAAGG - Intergenic
1140986272 16:80160791-80160813 AGATCAAGCCATTGCCCACCTGG + Intergenic
1141217535 16:82039011-82039033 TTTGCCAGCCAGTGTCCACATGG - Intronic
1141705194 16:85661016-85661038 TTAGAGAGCCAGTGCCAACAGGG - Intronic
1141792523 16:86246283-86246305 GGAGCAAGTCAATGTCCACAGGG + Intergenic
1142324124 16:89403027-89403049 TGAGCGAGGCAGTGCCCATGTGG - Intronic
1143012407 17:3873091-3873113 TGAGCAAGGGAGTGAACACATGG + Intronic
1143693535 17:8591353-8591375 TTATCTTGCCAGTGCCCACATGG - Intronic
1146644633 17:34568882-34568904 GGAGCAACCCAGGTCCCACACGG + Intergenic
1148632585 17:49122875-49122897 TGAGTAAAGCAGTTCCCACAGGG + Intergenic
1148789394 17:50164923-50164945 TAAGCAAACCTCTGCCCACATGG - Intronic
1148847905 17:50539985-50540007 TGAGCCAGCCAGCGCACAGAGGG - Intronic
1152253318 17:79223025-79223047 TGAGGAAGCCACTGGCCATATGG - Intronic
1152366403 17:79859145-79859167 TGAGCAGGCCAGGGCCCATAAGG - Intergenic
1152744700 17:82033361-82033383 TGAGCAAGTCACGGCCCTCAGGG - Intronic
1153924498 18:9823929-9823951 TCAACAAGCCGGTGCCCACTAGG - Intronic
1154019234 18:10648063-10648085 TGAGCCCGCCAGTGCCCCCAAGG + Intergenic
1154184981 18:12175161-12175183 TGAGCCCGCCAGTGCTCCCAAGG - Intergenic
1157379677 18:47202174-47202196 TGGGAGAGCCAATGCCCACATGG + Intergenic
1157471293 18:47991113-47991135 TGAGCCGGTCAGTGGCCACAAGG + Intergenic
1158125344 18:54094556-54094578 TGAGAAAGCCACTATCCACAGGG + Intergenic
1158855907 18:61543124-61543146 TGAGCAACACAGTGTCCAAAAGG + Intronic
1161324604 19:3657483-3657505 GGAGCAAGCCAGGCCCCCCAGGG + Intronic
1162792325 19:13069514-13069536 TGAGTGAGCCCCTGCCCACAAGG - Intronic
1162965855 19:14155665-14155687 TGGGCAGGCCACTGCCCCCAAGG - Intronic
1163424488 19:17233847-17233869 TGAGGAAGACAGAGCCCAGAAGG + Intronic
1163437783 19:17305631-17305653 TGAGCAAGCGCGTGCGCACAAGG - Intronic
1164583198 19:29447907-29447929 ATAGCAATCCAGTGTCCACAGGG - Intergenic
1164674652 19:30093196-30093218 TGAGCATGCCAGGACTCACAGGG + Intergenic
1165636097 19:37341446-37341468 TGACCAAGCCCAAGCCCACATGG - Intronic
1165902807 19:39176624-39176646 TGAGCAAGGAAGTGCCCCGAAGG + Exonic
1167433091 19:49464420-49464442 TGATCCAGACAGTGCCCACCTGG - Exonic
1167804348 19:51769441-51769463 TGAGCCAGACGGTGCCCAGAAGG - Exonic
1168701699 19:58443746-58443768 TGACCATGTCAGTGCCCACTGGG - Intergenic
925770989 2:7283080-7283102 TGACAGAGACAGTGCCCACAAGG + Intergenic
926168811 2:10537922-10537944 GGAGCAGGCCAGGTCCCACATGG - Intergenic
929076082 2:38079984-38080006 AGAACAAGCCCTTGCCCACAGGG - Intronic
929198060 2:39206504-39206526 TGAGTAAGCCCGCGCGCACATGG + Intronic
931757822 2:65389490-65389512 TAAGCATCCCAGTCCCCACAAGG + Intronic
933652814 2:84862797-84862819 TGAGCAGGCCTGTGCCCAGGGGG + Intronic
934926782 2:98387759-98387781 TGAGAAAGCCAGTGAGCAGAAGG - Intronic
936550714 2:113437461-113437483 TGACCTAACCAGTTCCCACAGGG - Intergenic
939855541 2:147354551-147354573 TGGGGAAGCCAGTGCAAACATGG + Intergenic
940004499 2:148998614-148998636 TCACCAGGGCAGTGCCCACAGGG - Intronic
940910523 2:159206115-159206137 GGAGTAAGCCAGTACCCTCAAGG + Intronic
941642150 2:167999927-167999949 TGAGGACACCAGTGCCCACAAGG - Intronic
942417124 2:175771177-175771199 TGAGCCAGCCAGAGGCCACGGGG - Intergenic
943783898 2:191855174-191855196 AAGGAAAGCCAGTGCCCACAAGG - Intergenic
946224557 2:218257148-218257170 TCAGGAAGCCAGTGCCCCAAGGG + Intergenic
1168977429 20:1978039-1978061 TCAGAAAGCCAGTGTCCAAATGG + Intergenic
1169690520 20:8325786-8325808 TGGGCAAGCCAGTGATGACAGGG + Intronic
1170182404 20:13546723-13546745 TGAGTCAGGAAGTGCCCACAAGG - Intronic
1170718078 20:18849185-18849207 TGAGCCAGCCAGTCCCCAAATGG - Intergenic
1170783862 20:19450658-19450680 TCACTAAGCCAGTGCCCACAAGG - Intronic
1171038765 20:21740240-21740262 TGAGCAAGTCAGAGGCCAAAAGG - Intergenic
1173043482 20:39487961-39487983 TGAGTAAGGCAATTCCCACAAGG - Intergenic
1174105801 20:48161397-48161419 TGAGCAAGCCAGGACCCTCTGGG - Intergenic
1174207309 20:48850206-48850228 TGGGAAAGCCAGAGCCCACCCGG - Intergenic
1174330437 20:49813071-49813093 TGACCAAGCCGGTGCCTACGAGG + Intronic
1175532558 20:59684145-59684167 AGAGAAAGCCTGTGCCCAGAGGG - Intronic
1176105490 20:63383974-63383996 AGAGCAAGCCAGTGCCGCCCAGG + Intergenic
1180171772 21:46063034-46063056 TGAGAAAGGCAGTGTCCACCAGG - Intergenic
1180583007 22:16859346-16859368 TGTGTATGCCAGTTCCCACAGGG + Intergenic
1181731084 22:24847319-24847341 AGAGCAAACCAGTGCTCTCAGGG - Intronic
1182502706 22:30759023-30759045 TGTGCCAGCCAGTGGCCACAGGG - Intronic
950948845 3:16978699-16978721 TGAGCATGCCAGTGCCTCTATGG - Intronic
952509991 3:34043357-34043379 TGGGCAAGGCAGTTCCTACAGGG + Intergenic
953412163 3:42696771-42696793 TGAGCAGGGCAGTGCCAAGATGG - Intronic
953492803 3:43364654-43364676 TGGGCGAGCCAGTGGCCAGAAGG + Intronic
953508608 3:43511876-43511898 GGAGCAAGGCAGTGCCCTGAGGG - Intronic
954412563 3:50377408-50377430 TGAGCCTGCCTGTGTCCACATGG + Intronic
954647246 3:52139247-52139269 TGAGCCATCCAATGCCAACATGG + Intronic
955849438 3:63204076-63204098 AGAGCAGGCCAGGCCCCACAAGG - Intergenic
959647835 3:108723405-108723427 TGAGCCAGCCTGTGGCCCCAAGG + Intergenic
961363022 3:126380061-126380083 TGGGCAGCCCAGAGCCCACAGGG - Intergenic
962103578 3:132367903-132367925 TGAGGATGGCAATGCCCACATGG - Exonic
962386815 3:134938448-134938470 TGAGCTAACCAGCGCTCACAGGG + Intronic
962828233 3:139118418-139118440 GGACCCAGCCAGTTCCCACAAGG - Intronic
963073112 3:141321293-141321315 TAAGGAAGCCAGTGACCACAGGG - Intergenic
964697945 3:159530803-159530825 TGAGCAGGGCAGTGCCTACAGGG - Intronic
968699011 4:2046060-2046082 GGAGGAAGGCAGGGCCCACAGGG - Intergenic
971444058 4:26723465-26723487 TGACCAGGCCAGTGCTTACAGGG + Intronic
981750848 4:148091291-148091313 TGTGCAGGCCAGTGAGCACACGG - Intronic
983232787 4:165146445-165146467 TGAGCAAGACAGTCCCCATAAGG - Intronic
985385976 4:189448545-189448567 TGTGCAAGCCAGTGGTCAGACGG - Intergenic
986223103 5:5788135-5788157 TGACCAAGGCAGTGCACACAGGG + Intergenic
987051100 5:14146737-14146759 AGAGAAAGCCAGAGTCCACAGGG - Intronic
994071661 5:95609937-95609959 TGAGCAAACTATGGCCCACAAGG - Intergenic
999243721 5:150142087-150142109 TCAGCACGCCAGAGCCCTCAGGG + Intronic
1002306157 5:178285108-178285130 TGAGGAAGTCAGAGCCGACAAGG - Intronic
1008600046 6:53084208-53084230 TGAGTAGACCAGTGACCACAGGG + Intronic
1011803413 6:91044299-91044321 GGAGCAAGCCATTCCCCACCTGG - Intergenic
1014062286 6:117085524-117085546 TGATTAAGCCACTGTCCACATGG + Intergenic
1015685853 6:135858629-135858651 TGAGAAAGCTGGTGCCCAGAGGG - Intronic
1015750231 6:136551097-136551119 TGAGCAAGCCAGAAGTCACAAGG - Intergenic
1016447282 6:144147020-144147042 TGTGCAATCCAATGCACACATGG - Intergenic
1017004211 6:150018811-150018833 TGATCAAGACCGTGCTCACAGGG + Exonic
1019453637 7:1113288-1113310 TCAGCAAGCCAGTGCCATCAGGG - Intronic
1019636189 7:2077148-2077170 TGAGCCTGCCAGTGGCCTCAAGG + Intronic
1019698472 7:2460843-2460865 TGGGCAAGCCAGTGGCCAGATGG - Intergenic
1022227991 7:28383142-28383164 TGAGCATGCCAGTGGCTGCAAGG + Intronic
1023549817 7:41357530-41357552 TGAGGAAACCAATGCCCCCACGG - Intergenic
1024069980 7:45776940-45776962 GGAGCAGGACAGTGCTCACATGG - Intergenic
1024543672 7:50499796-50499818 TGAGGCAGCCCCTGCCCACAAGG - Intronic
1029316054 7:99715254-99715276 TTAGCAAACAAGTGCCCAGAGGG + Intronic
1029603445 7:101583689-101583711 TGAGGAAGTCAGTGTCCTCAAGG + Intergenic
1030079846 7:105767829-105767851 TGAGCAAGCCAGTGCCCACATGG - Intronic
1032047379 7:128621226-128621248 GGAGCAGGCCAGCGCTCACATGG - Intergenic
1032092734 7:128919464-128919486 TGCATGAGCCAGTGCCCACATGG + Intergenic
1033665574 7:143437610-143437632 TGAGCAAGACAGTGGACACTAGG - Intergenic
1036820495 8:11935839-11935861 TGAGCAATCTATTTCCCACAAGG + Intergenic
1037456499 8:19069297-19069319 TGAGTAAGGCAGTTTCCACAAGG + Intronic
1037914784 8:22766397-22766419 TGAGAAAGCCAGTGCACAGAGGG - Intronic
1038372335 8:27006772-27006794 TTAGCATCCCAGGGCCCACAGGG + Intergenic
1040072555 8:43200377-43200399 TGAGGAAGCCAAGGCCCAGACGG - Exonic
1041008673 8:53520337-53520359 TGAGCCATCTTGTGCCCACATGG + Intergenic
1044922941 8:97185180-97185202 TCAGCATGCCAGCTCCCACAGGG + Intergenic
1044973864 8:97644662-97644684 CGAGCGCGCCAGTGCCCACCAGG - Exonic
1047739033 8:127792639-127792661 TGAGGAAGCCAGTGTCCTCCTGG - Intergenic
1049656307 8:143799935-143799957 TGGGCAAACCGATGCCCACAGGG + Intronic
1049902220 9:179355-179377 TGACCTAACCAGTTCCCACAGGG + Intergenic
1051150192 9:14071661-14071683 TGACCAAGCCAGTCACCACCTGG + Intergenic
1053304010 9:36971127-36971149 TGAGCCAGCCATTGTCCTCATGG + Intronic
1053643562 9:40108785-40108807 AAAGCGAGGCAGTGCCCACAAGG - Intergenic
1053745250 9:41189644-41189666 TGACCTAACCAGTTCCCACAGGG + Intronic
1053762589 9:41356705-41356727 AAAGCGAGGCAGTGCCCACAAGG + Intergenic
1054482022 9:65675569-65675591 TGACCTAACCAGTTCCCACAGGG - Intronic
1054541189 9:66267819-66267841 AAAGCGAGGCAGTGCCCACAAGG + Intergenic
1054683097 9:68241624-68241646 TGACCTAACCAGTTCCCACAGGG - Exonic
1055511941 9:77003856-77003878 TGAACAAGCCCCAGCCCACAAGG + Intergenic
1061618833 9:131797655-131797677 TGAGTTAGCCAGTGGCCATATGG - Intergenic
1202781378 9_KI270718v1_random:428-450 TGACCTAACCAGTTCCCACAGGG + Intergenic
1187658651 X:21512163-21512185 TGAGCAAGTCACTGCCTTCAAGG + Intronic
1189165608 X:38857925-38857947 TTAGCATGCCAATGACCACAGGG - Intergenic
1190103620 X:47542637-47542659 TGAGGAAGGCAATGCCCAGAGGG - Intergenic
1190274992 X:48893709-48893731 TGAGGAAGCCACTGCCACCATGG - Exonic
1190283348 X:48946016-48946038 TGGGCAGGCCTGTGTCCACAAGG - Intronic
1192120122 X:68447602-68447624 TGATCGAGCCACTGCACACAAGG - Intergenic
1192744190 X:73922349-73922371 TGACCAAGCCACTTCCCACTAGG + Intergenic
1193338353 X:80317303-80317325 TGAGTAAAGCAGTTCCCACAAGG - Intergenic
1195021184 X:100830562-100830584 AGATCAAACCAGTGCCCCCATGG + Intronic
1202086730 Y:21145757-21145779 TGAGTAAGGCAGTTCCCACAAGG - Intergenic