ID: 1030079848

View in Genome Browser
Species Human (GRCh38)
Location 7:105767854-105767876
Sequence GGTGGACTGGAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1079
Summary {0: 1, 1: 1, 2: 9, 3: 95, 4: 973}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030079848_1030079858 3 Left 1030079848 7:105767854-105767876 CCTTCCTCCTTCTCCAGTCCACC 0: 1
1: 1
2: 9
3: 95
4: 973
Right 1030079858 7:105767880-105767902 CTGGAGTTCGACTGGTACTCAGG No data
1030079848_1030079860 8 Left 1030079848 7:105767854-105767876 CCTTCCTCCTTCTCCAGTCCACC 0: 1
1: 1
2: 9
3: 95
4: 973
Right 1030079860 7:105767885-105767907 GTTCGACTGGTACTCAGGGCTGG No data
1030079848_1030079854 -5 Left 1030079848 7:105767854-105767876 CCTTCCTCCTTCTCCAGTCCACC 0: 1
1: 1
2: 9
3: 95
4: 973
Right 1030079854 7:105767872-105767894 CCACCCCTCTGGAGTTCGACTGG No data
1030079848_1030079859 4 Left 1030079848 7:105767854-105767876 CCTTCCTCCTTCTCCAGTCCACC 0: 1
1: 1
2: 9
3: 95
4: 973
Right 1030079859 7:105767881-105767903 TGGAGTTCGACTGGTACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030079848 Original CRISPR GGTGGACTGGAGAAGGAGGA AGG (reversed) Intronic
900299699 1:1970439-1970461 CGTGGACTGGAGTAGGGGCAGGG + Intronic
900327112 1:2113812-2113834 GGTGGTGTGGCCAAGGAGGAGGG + Intronic
900339841 1:2182818-2182840 GGTGGGCTAGAGAACGAGCAAGG + Intronic
900427051 1:2585705-2585727 GGCGGGCTGGAGAAGGAAGGGGG - Intergenic
900431690 1:2605812-2605834 GCTGGACTGGAGAGGGTGGCGGG + Intronic
900708200 1:4093921-4093943 GCTGGAAAGAAGAAGGAGGAGGG - Intergenic
900947081 1:5837136-5837158 GGTGGGCAGGAGGAGGGGGAGGG - Intergenic
900977146 1:6025059-6025081 GGGAGAAGGGAGAAGGAGGAAGG - Intronic
901006618 1:6174800-6174822 GGTGGATGGAAGATGGAGGATGG + Intronic
901207498 1:7505437-7505459 GGTGGGCTGGAGCTGGGGGAGGG - Intronic
901381277 1:8876486-8876508 GGTGGCCTGGAGATGGGGCAGGG - Intronic
901540275 1:9910672-9910694 GGTGGCCTGGAGGAGGAGCCGGG + Intergenic
901904945 1:12400330-12400352 GGTGGGCTGGTGGAGGAGGCTGG + Exonic
902374763 1:16025177-16025199 GCTGGCCTGGAGCTGGAGGAAGG - Intronic
902379717 1:16046971-16046993 GCTGGCCTGGAGCAGGAGGCAGG - Intronic
902556618 1:17250609-17250631 GGTGGGCAGTAGGAGGAGGAAGG + Intronic
902630207 1:17700375-17700397 TGTGCTCTGGAGAAGGGGGATGG + Intergenic
902679489 1:18033062-18033084 GGGGGACTGGAGAGGTAGGTTGG - Intergenic
902771456 1:18647495-18647517 GGGGGAGAGGAGAAGGAGGCAGG + Intronic
902922834 1:19677440-19677462 AGTGGACAGGAAGAGGAGGAAGG - Intronic
903184075 1:21619660-21619682 GGTGGAATGGAACTGGAGGAGGG - Intronic
903293389 1:22328807-22328829 GATGGACGGGGGAAGGGGGAGGG + Intergenic
903778002 1:25805520-25805542 GGTAGACTGCAGGATGAGGAGGG + Intronic
904118361 1:28178620-28178642 GGGGGGCTGGAGGTGGAGGAGGG - Intronic
904131802 1:28281050-28281072 TGTGGGCAGGGGAAGGAGGAAGG - Exonic
904265971 1:29318779-29318801 GCTGGCCTGGAAAAAGAGGAAGG + Intronic
904295747 1:29518784-29518806 GGAGAAAAGGAGAAGGAGGAAGG - Intergenic
904400329 1:30252539-30252561 GGTCGCCTGGAGAAGGAGGAGGG + Intergenic
904521755 1:31101271-31101293 GGTGGGGTAGAGAGGGAGGAAGG + Intergenic
904557356 1:31373809-31373831 GGTGGGGTGGGGACGGAGGAGGG - Intronic
904814203 1:33182815-33182837 GGTGGGGTGGAGAAGGAGCCTGG + Intergenic
904941731 1:34168393-34168415 GGGGGCCAGGAGGAGGAGGATGG + Intronic
905119763 1:35672674-35672696 GGTGGGTGGGAGTAGGAGGAGGG - Intergenic
905189692 1:36224192-36224214 GGTGGCCTGGAGATGGAGGAGGG - Intergenic
905282969 1:36860688-36860710 GGTGGGCTGGTGAAGGAAGGAGG + Intronic
905503043 1:38454508-38454530 GGTCTACTGGACAAGGAGAAAGG + Intergenic
905562748 1:38940501-38940523 GGTGGAGTGGTGAAGGGAGAGGG - Intronic
905628517 1:39505126-39505148 GGAGGACTAGTGAAAGAGGAAGG - Intronic
906214935 1:44033213-44033235 GCTGGAAGGGAGAAGGAGGGAGG - Intergenic
906324925 1:44839608-44839630 TGGGGAATGGAGAGGGAGGAAGG + Intronic
906548825 1:46643805-46643827 GGTGAAGGGGAGAAGAAGGATGG + Intronic
906566147 1:46802587-46802609 GGTTGATTTGAGAAGAAGGAAGG - Intronic
906805533 1:48776474-48776496 AGAGGACGGGAGAAGGAGGCAGG + Intronic
906822968 1:48948559-48948581 GATGGCCTGGAGATGGATGAAGG - Intronic
907411641 1:54287564-54287586 GGTGGCCTGGGGAAGGAGGGAGG + Intronic
907679552 1:56550709-56550731 GGTGGGTGGGAGGAGGAGGATGG - Intronic
907787648 1:57628405-57628427 GTTGGACAGGAAAAGGTGGAAGG - Intronic
907861144 1:58354660-58354682 GGAGGAAGGGAGAGGGAGGAGGG + Intronic
907918955 1:58895522-58895544 GGAGGAGTGGAGGAGGAGGAAGG + Intergenic
908711580 1:67021552-67021574 GGTGAACTGCAGAAGAAAGAGGG + Exonic
909296365 1:73954290-73954312 GATGGACGGGAGACAGAGGAAGG - Intergenic
909310135 1:74135830-74135852 GGTGGAGTGTGGAAGGAGGGAGG + Intronic
909323722 1:74322781-74322803 GTTGGCCTGGAGATGGAGAATGG - Intronic
909543313 1:76815319-76815341 GGTGGAGTGGAGAAAGGGGCTGG - Intergenic
909561825 1:77016158-77016180 GGAGGACAGGAGGAGGAGGAGGG - Intronic
909608312 1:77528768-77528790 GCTGGAGTGGGGAATGAGGATGG - Intronic
909666137 1:78135176-78135198 GGGGGACTGGTGGAGGAGGGAGG + Intronic
910615549 1:89194088-89194110 TGTGGACTTGTGAAGAAGGACGG + Intronic
910630701 1:89350930-89350952 GGAGGAAAGGAGAAGCAGGAGGG - Intergenic
911383127 1:97140615-97140637 GGAGAAGTGGAGAAGAAGGATGG + Intronic
911873456 1:103128956-103128978 GGTGGAGGGTGGAAGGAGGAAGG + Intergenic
912410582 1:109478230-109478252 GGCAGAGTGCAGAAGGAGGAAGG - Intronic
912410999 1:109480642-109480664 GAAGGACTAGAGAAGGAGCAGGG - Exonic
912565942 1:110587475-110587497 GGAGGAATGAAGAAGGAGGCTGG + Intergenic
912750601 1:112284036-112284058 GGTTGAAGGGAGAGGGAGGAAGG - Intergenic
914859261 1:151372747-151372769 GGTGGGGCAGAGAAGGAGGAGGG + Intergenic
915167442 1:153956242-153956264 GGAAGCCTGGAGAAGGAGGGTGG + Intronic
915274014 1:154775717-154775739 GCTGCACTGGGGAAGGAGGAGGG - Intronic
915288519 1:154867948-154867970 GAGGGAGTGGAGATGGAGGAAGG - Intronic
915333817 1:155129273-155129295 TGTTGACTGGAGGAGGAGGAGGG + Intronic
915356007 1:155255457-155255479 CGGGGACTAGAGAAGGGGGATGG + Intronic
915471706 1:156129706-156129728 AGTGGACTGGAGAAATAGAAAGG - Intronic
915475778 1:156152010-156152032 TGTGGACTGGGGCAGGAGGGAGG + Intronic
915507018 1:156364224-156364246 GGTGGAGTGGAGAGGGAGGGAGG + Intronic
915515369 1:156409566-156409588 GGTGGAATGGGGCTGGAGGAAGG - Intronic
915932071 1:160067105-160067127 TGTGGCATGGAGAAGGAGGTTGG - Intronic
916289135 1:163144629-163144651 CGTGGAGAGGAGGAGGAGGAGGG + Intronic
916314116 1:163428436-163428458 TCTCAACTGGAGAAGGAGGAGGG + Intergenic
916611360 1:166395148-166395170 GGGGGAAAGGGGAAGGAGGAGGG + Intergenic
916792697 1:168137333-168137355 GCGGGACTGGAGGAGGAGAATGG - Exonic
917194348 1:172449983-172450005 GCTGGAGTGGAGAATGGGGAAGG + Intronic
917218854 1:172706241-172706263 GGTGGTAGGGAGGAGGAGGAGGG - Intergenic
917416239 1:174812933-174812955 GGTGGGCTTGAGAAACAGGAAGG + Intronic
917921588 1:179755220-179755242 GGTAGAATGGGGATGGAGGATGG + Intronic
917992416 1:180395226-180395248 GGTGGACTGTTGAAGGATGCTGG + Intronic
918542913 1:185650658-185650680 GGTGGAGTTTGGAAGGAGGAAGG + Intergenic
918569301 1:185969813-185969835 GATGCCCTGGAGGAGGAGGAGGG + Intronic
918961077 1:191278774-191278796 GGTTGTCAGGAGATGGAGGAGGG - Intergenic
920089939 1:203445267-203445289 GTTGGAGTGAAGACGGAGGATGG + Intergenic
920301185 1:204990053-204990075 GGTGGGCTGGGGAAGGATGTGGG - Intronic
920311276 1:205049874-205049896 GCTGGAGTGGAGAAGGAGTCTGG + Intronic
920436743 1:205951821-205951843 TGTGGAATGGAGAATGAGGCCGG + Intergenic
920439022 1:205966288-205966310 GGTGGAATGGTGGAGGAGGGAGG - Intergenic
920500075 1:206480243-206480265 GGTGGGCAGGAGAGGGAGGTGGG + Intronic
920819673 1:209368562-209368584 GGTGGTCTGTAGTAGAAGGAAGG + Intergenic
921331218 1:214038479-214038501 GGTGGGATGGTGAAGGATGAGGG + Exonic
921667565 1:217890954-217890976 GGTTGCCAGGAGATGGAGGAAGG + Intergenic
921693896 1:218184826-218184848 GGAGAACAGGAGAAGGTGGATGG - Intergenic
922130418 1:222771978-222772000 GCTGGAGTGGAGCAGAAGGAGGG - Intergenic
922764275 1:228149426-228149448 GGAGCACTGGGGAAGGAGGGAGG - Intergenic
922934273 1:229411472-229411494 GGGGGAGGGGAGAGGGAGGAAGG - Intergenic
922964541 1:229677781-229677803 GGGAGACTGCAGTAGGAGGATGG - Intergenic
923756695 1:236797364-236797386 TGTGCCCTGGGGAAGGAGGATGG + Intronic
924105355 1:240644011-240644033 TGTAGACTGGAGAATGAGGCAGG - Intergenic
924434908 1:244030688-244030710 TGTGGCTTAGAGAAGGAGGAGGG - Intergenic
924908737 1:248485796-248485818 TGTAGACTGCAGAGGGAGGATGG + Intergenic
924915371 1:248562266-248562288 TGTAGACTGCAGAGGGAGGATGG - Intergenic
1062849736 10:735117-735139 TGAGGACTTGAGAAGGGGGAGGG + Intergenic
1062881118 10:979180-979202 GAAGGACAGGAGAAGGAGCAAGG - Intergenic
1062933983 10:1372298-1372320 TGAGGACTTGAGAAGGGGGAGGG + Intronic
1063113084 10:3053515-3053537 GGTGGACTGGAGGGGAAGGGTGG - Intergenic
1063113129 10:3053623-3053645 GGTGGACTGGAGGGGAAGGGTGG - Intergenic
1063113166 10:3053713-3053735 GGTGGACTGGAGGGGAAGGGTGG - Intergenic
1063113179 10:3053749-3053771 GGTGGACTGGAGGGGAAGGGTGG - Intergenic
1063222047 10:3978066-3978088 TGAGGACTGGAGAAGGAGAGAGG - Intergenic
1063372262 10:5529515-5529537 TGGGGGCTGGAGCAGGAGGAAGG + Intergenic
1064553309 10:16523228-16523250 GGTGGACTGGAGTAGGCTGGGGG - Intergenic
1064627241 10:17273841-17273863 GGAGGAGGGAAGAAGGAGGAAGG - Intergenic
1064680894 10:17809701-17809723 GGAGGCCTGGAGTTGGAGGAGGG + Intronic
1065425268 10:25596352-25596374 GGGAGGCTGGAGCAGGAGGATGG + Intronic
1066439891 10:35428368-35428390 GGTGTTCTGGAGTAGAAGGAAGG + Intronic
1066440558 10:35434990-35435012 GATGGACTGGTGAAGAAGGCAGG + Intronic
1066602764 10:37125686-37125708 CGTGGACTGAAGAAGGGCGAGGG + Intergenic
1066651922 10:37664504-37664526 GCTGGCTTGGAGATGGAGGAAGG - Intergenic
1067035697 10:42914815-42914837 GCTGGCTTGGAGATGGAGGAAGG - Intergenic
1067213507 10:44281397-44281419 GGTGGAATGGGGAGGGAGGTGGG + Intergenic
1067224922 10:44369385-44369407 GATGGACTGGGGAAGGAAGAAGG - Intergenic
1067337898 10:45379279-45379301 GAGGGGCTGGAGAGGGAGGAAGG - Intronic
1067831250 10:49612343-49612365 GGTGGGCTGGAGGAGGAGTGGGG - Exonic
1068281576 10:54878065-54878087 GGGGGACTGAGGAAGGAGGATGG - Intronic
1068827682 10:61457317-61457339 GGTGGAATGAGGAAGGAAGAAGG - Intergenic
1069033831 10:63627937-63627959 GGTGGAAAGGAGAGGAAGGAAGG - Intergenic
1069303441 10:66937785-66937807 GGAGGACTTGGGAGGGAGGAAGG - Intronic
1069601540 10:69711161-69711183 GGAGAACTGGGGAAGTAGGAAGG + Intergenic
1069604472 10:69730981-69731003 AGTGGCCTGGAGAAGGGGGACGG - Intergenic
1069844901 10:71364159-71364181 AGTGGCCTGGAGAAGCAGGAAGG + Intergenic
1069901951 10:71711373-71711395 GCTGGCCTGGGGAAGAAGGATGG + Intronic
1070171748 10:73938177-73938199 GGTGGCCTGGACCATGAGGATGG + Intergenic
1070342929 10:75514267-75514289 GGAGGAAGGAAGAAGGAGGAGGG - Intronic
1070520025 10:77244507-77244529 TGTGGAAGGGAGAAGGAGGAAGG + Intronic
1070658240 10:78285894-78285916 GGAGGAGTGGAGAGGGAGGAAGG - Intergenic
1070690239 10:78518943-78518965 GGTGGCTTGGACCAGGAGGATGG + Intergenic
1071268262 10:83983614-83983636 GCTGGAATGGAGAAGGAGGAGGG - Intergenic
1071747353 10:88437258-88437280 GTTGGACTGGAGAGGCAGGCAGG - Intronic
1071995418 10:91143453-91143475 GGTGGACTGGATTAGGGGGTTGG + Intergenic
1072039113 10:91590796-91590818 TGTGGGCTGGAGACGGGGGATGG - Intergenic
1072191754 10:93081592-93081614 GGAGGACTGGGGAAGGAAGCAGG - Intergenic
1072197681 10:93130627-93130649 GGAGGAATGGAGAAGGGGAAAGG - Intergenic
1073193124 10:101666443-101666465 TGTGGAAGGGAGTAGGAGGAGGG + Intronic
1073316956 10:102589025-102589047 GGGAGGCTGGAGCAGGAGGATGG - Intronic
1073767840 10:106702909-106702931 AGTAGACTTGAAAAGGAGGAAGG + Intronic
1074031031 10:109688316-109688338 AGTGGACTGCAGCAGGAGGCAGG + Intergenic
1074182378 10:111076521-111076543 GGGGTCCTGGAGAGGGAGGAAGG - Intergenic
1074963657 10:118470051-118470073 GGTGGCCTGGGGTAGGTGGAGGG - Intergenic
1075086798 10:119419114-119419136 GGTGGGCTGGAGAAGGGAGAGGG - Intronic
1075515847 10:123107559-123107581 GGTGAACTGGGGAAGGGGGAAGG - Intergenic
1075608353 10:123832402-123832424 TGTGCACTGGACAGGGAGGAGGG + Intronic
1075744653 10:124718390-124718412 GGTAGAAGGGAGAAGGCGGAAGG - Intronic
1076597394 10:131632574-131632596 GGTGGAGGGTGGAAGGAGGAAGG + Intergenic
1076614544 10:131747024-131747046 GGAGGATGGGAGAAGCAGGAGGG - Intergenic
1076663356 10:132069832-132069854 GGTGGAATGGATAAGCAGCAAGG - Intergenic
1076694803 10:132242310-132242332 GGGGGAGTGCAGCAGGAGGACGG + Intronic
1077009608 11:374346-374368 GATGGACGGGGGAAGGCGGAAGG + Intronic
1077239278 11:1502275-1502297 GGTGGGCTGGAGGAGGACGTGGG - Intergenic
1077325784 11:1963434-1963456 GAAGGAGTGGAGAAGCAGGAAGG - Intronic
1077894795 11:6446151-6446173 GGGTGACTGGAGAGGAAGGAGGG - Intergenic
1078534214 11:12160335-12160357 AGTGGACTGGAGGAGGAGGCTGG - Intronic
1078581732 11:12544185-12544207 GGAGGGCGGGAGGAGGAGGAAGG - Intergenic
1079252935 11:18800728-18800750 GGTTGCCTGGATTAGGAGGATGG + Intergenic
1079446509 11:20561596-20561618 GGAGGACTGGGGAAGGAAGAAGG + Intergenic
1080949703 11:37017579-37017601 GGTGGGCTGAGGAAGGAGAATGG - Intergenic
1081501185 11:43668289-43668311 GCTGGTCTGAAGATGGAGGACGG - Intronic
1081701552 11:45155640-45155662 GGAGGGGTGGAGAGGGAGGAAGG + Intronic
1081795010 11:45812913-45812935 AGGGGACTGGAGAGGGAGGGGGG - Exonic
1081827115 11:46066211-46066233 AGTGAACTGGGGAAGGACGAAGG + Intronic
1082800397 11:57410003-57410025 GAGGTACTGGAGAGGGAGGATGG + Exonic
1082809170 11:57468175-57468197 GGTGGCCTGGGGAGAGAGGAGGG - Intronic
1083277073 11:61602932-61602954 GGTTGACTGGAGAAGTGGGGAGG + Intergenic
1083385648 11:62307269-62307291 GGTGGACTGGATAAAGAAAATGG - Intergenic
1083477044 11:62921504-62921526 GGTGCCCTGGTGAAGGAGGGGGG - Exonic
1083729100 11:64643365-64643387 GGGGGGCGGGAGAAGGGGGAAGG + Intronic
1084177975 11:67433323-67433345 GGGCGGCTGGAGGAGGAGGAAGG - Exonic
1084354970 11:68632259-68632281 GGTGGAATGGAGAGAGAGAACGG - Intergenic
1084355966 11:68638896-68638918 GGTGGAATGGAGAGAGAGAATGG - Intergenic
1084404144 11:68961323-68961345 AGTGGTCTGGACAAGGAGCAGGG - Intergenic
1084412638 11:69013302-69013324 GGGGGAGGGGAGTAGGAGGAGGG + Exonic
1084554566 11:69868208-69868230 GGTGGACGGAAGAAGGGGCAAGG - Intergenic
1084736442 11:71108546-71108568 GGTGGCCTGGAGCAGGAGGCTGG - Intronic
1085310046 11:75510759-75510781 GGAGGCCCGGAGGAGGAGGAGGG - Intronic
1086513237 11:87583565-87583587 TGTGCAAGGGAGAAGGAGGAAGG - Intergenic
1086515024 11:87601833-87601855 GGTTAAATGGAGAAGGACGAGGG - Intergenic
1087533326 11:99411413-99411435 GGGAGACTGAGGAAGGAGGATGG + Intronic
1087990715 11:104743407-104743429 GATGAACTGGAGATGGAGGAAGG + Intergenic
1088064970 11:105706219-105706241 GGAGGAGTGGCGAAGGGGGATGG + Intronic
1088220227 11:107562844-107562866 GGGGGAGAGGAGAAAGAGGAAGG + Intronic
1088362931 11:109010063-109010085 GGAGGATTGGAGAGGGAGGAAGG + Intergenic
1088412887 11:109555015-109555037 TGAGGACAGGAGAAGGAAGAAGG + Intergenic
1088636539 11:111826450-111826472 GTTGGACTGGGGAATCAGGAGGG - Intronic
1088741332 11:112769772-112769794 GGTGGGCTGGAGAGGCAGGGAGG - Intergenic
1089289038 11:117426790-117426812 GAAGGGCTGGAGAAGGAGGGAGG - Intergenic
1089377797 11:118007090-118007112 TGGGGAGTGGAGAAGGAGGTGGG - Intergenic
1089380668 11:118028899-118028921 GGAGGACAGGAGGAGGAGGAGGG + Intergenic
1089696083 11:120217079-120217101 GGTGGAGGGGAGAAGGAGGCTGG + Intronic
1089770965 11:120802619-120802641 GGGAGGCTGGAGAAGGAGGAGGG + Intronic
1090074044 11:123568240-123568262 GGCGGAGTGCAGAAGGAGGTAGG + Intronic
1090203282 11:124870766-124870788 GTAGGAGGGGAGAAGGAGGATGG + Intronic
1090299954 11:125626429-125626451 GAACGACTGGGGAAGGAGGAGGG - Intronic
1090585376 11:128206314-128206336 GGTGGACTAGGGGAGAAGGAAGG + Intergenic
1090739682 11:129646134-129646156 GGAGGAGAGGAGGAGGAGGAAGG + Intergenic
1090744915 11:129697626-129697648 GGGGGGCTGGAGTGGGAGGACGG + Intergenic
1090765270 11:129870916-129870938 TGTGGAGTGGAGTAGGTGGAGGG - Intronic
1090887588 11:130892902-130892924 GGTGGGGTGGGGAAGGGGGAAGG + Intronic
1091030129 11:132179203-132179225 GGTGGAGTGGAGCTTGAGGAAGG + Intronic
1091070516 11:132558416-132558438 GGAGGAGGGGAGGAGGAGGAGGG - Intronic
1202808764 11_KI270721v1_random:18613-18635 GAAGGAGTGGAGAAGCAGGAAGG - Intergenic
1091440887 12:511308-511330 GGTGGAAGGCAGAAGGCGGAAGG - Intronic
1091441254 12:512820-512842 GGTGGAAGGCAGAAGGCGGAAGG - Intronic
1091441266 12:512866-512888 GGTGGAATGTGGAAGGTGGAAGG - Intronic
1091467473 12:697690-697712 GGTGGGCTGGAGCGAGAGGAAGG + Intergenic
1091687291 12:2572547-2572569 GGAGGAGAGGAGAAGGAGGAGGG - Intronic
1092145880 12:6214449-6214471 GGGGGGCTGAGGAAGGAGGATGG - Intronic
1092234509 12:6797927-6797949 GGAGGATTAGTGAAGGAGGAAGG - Intronic
1092246815 12:6868358-6868380 GGTGGAGGGAGGAAGGAGGATGG - Intronic
1092720165 12:11433259-11433281 GGGGGAAGGGAGAAGCAGGAAGG + Intronic
1092844292 12:12569596-12569618 GGGAGACTGAAGCAGGAGGATGG - Intergenic
1094636152 12:32228603-32228625 GGTGGATTGGACCAGGATGATGG + Intronic
1096492284 12:52019342-52019364 GGTGGATGGGAAAAGGAGCAGGG + Intergenic
1096559080 12:52423279-52423301 AGTGGACGGGAGAGGGAGGACGG - Intergenic
1096665417 12:53160904-53160926 GGGGACCTGGAAAAGGAGGAAGG - Intronic
1096873312 12:54608444-54608466 GGTGGAGGGGAGAGGGGGGAAGG - Intergenic
1097218028 12:57429606-57429628 GGGGGACTGAGGTAGGAGGACGG + Intronic
1097718904 12:62999334-62999356 GGTGAAAGAGAGAAGGAGGAGGG + Intergenic
1097964428 12:65563621-65563643 GGAGGAGGGGAGGAGGAGGAGGG + Intergenic
1098365936 12:69703240-69703262 GGTGGAATGCAGAGGAAGGATGG + Intergenic
1099354568 12:81618060-81618082 GGTGGACTGGAGAGAAAGCAAGG - Intronic
1099625836 12:85072367-85072389 GGTGTACTTGAAAAGGAGGCAGG + Intronic
1100409359 12:94299797-94299819 GGTAGGCTGAAGCAGGAGGATGG - Intronic
1100936622 12:99676914-99676936 GGAGGAATGGAGTAGGAAGAAGG + Intronic
1101815898 12:108146012-108146034 CCTCGACTGGAGAAGGAGGGGGG + Intronic
1102648345 12:114418474-114418496 GGTGGAATGGAGAGGCAGAAAGG - Intergenic
1103030085 12:117606266-117606288 GGAGGAGGGGAGAGGGAGGAAGG - Intronic
1103120809 12:118377680-118377702 GGAGGGATGGAGGAGGAGGAAGG + Intronic
1103140297 12:118542194-118542216 GAAGGACTGGGGATGGAGGAGGG + Intergenic
1103527603 12:121578629-121578651 GGTGGGGTGGTGAGGGAGGAGGG - Intronic
1103611334 12:122126003-122126025 GTGGGACTGGAGAAGGGGCAGGG + Intronic
1104047741 12:125174857-125174879 GGAAGACTGGAGAAGCAGAACGG + Intergenic
1104278417 12:127351957-127351979 GGTGGACTCGGGAACAAGGACGG + Intergenic
1104301745 12:127570686-127570708 GGAGGAAAGGAGAAGGAGGAAGG + Intergenic
1104450505 12:128864784-128864806 GGTGAGCTGGAGAAGGAGTGTGG + Intronic
1104512991 12:129398563-129398585 TGTGGACAGGCAAAGGAGGAGGG + Intronic
1104749901 12:131231765-131231787 GGCGGAGGGGAGGAGGAGGAGGG - Intergenic
1104842836 12:131832794-131832816 GGCGGGGTGGAGAAGGAGGTGGG - Intronic
1104905503 12:132211579-132211601 GGTGGACGAGAGAGGGTGGACGG - Intronic
1105536905 13:21274312-21274334 GGTGGACTGGATAAAGAAAATGG - Intergenic
1105606118 13:21927778-21927800 GGTGGAGTGGGGAGGGTGGACGG - Intergenic
1106323051 13:28659772-28659794 GGTGGGGAGGAGAAGGAGGGAGG - Intronic
1106543709 13:30713111-30713133 GGTGAACTGGTGGTGGAGGAGGG + Intergenic
1106676998 13:31971053-31971075 GGTGGAACAGGGAAGGAGGAAGG - Intergenic
1106720752 13:32432376-32432398 GGGGGAAGGGGGAAGGAGGAAGG + Intergenic
1106976906 13:35229269-35229291 GGAAGACTGAAGAAGGAGAATGG - Intronic
1107016181 13:35709468-35709490 GGTGGCCTGGCCAAGGAGTAAGG - Intergenic
1107359483 13:39603236-39603258 AGGGGACTGGAGAAAGAGGAGGG - Intronic
1107435436 13:40376951-40376973 GGTGGAATGATGAAGAAGGAAGG - Intergenic
1107476692 13:40743965-40743987 GGTGGACTGGATAAAGAAAATGG + Intronic
1107761940 13:43688748-43688770 GGGGCACAGGAGAAGGAGCAGGG + Intronic
1108156326 13:47589017-47589039 GGGAGACTGAGGAAGGAGGATGG + Intergenic
1108671199 13:52690807-52690829 AATGGAATGGAGAAAGAGGATGG + Intronic
1109074191 13:57812325-57812347 GGTGAAAGGGAAAAGGAGGATGG + Intergenic
1109767752 13:66927391-66927413 GGAGGATAGGAGGAGGAGGAGGG + Intronic
1111598951 13:90447175-90447197 GCTGGAGTGGAGAAGGAGGATGG - Intergenic
1112433534 13:99373883-99373905 GATGGACTGGACACAGAGGAGGG + Intronic
1112501587 13:99947215-99947237 GGTGCGGTGGAGAAGGATGAAGG - Intergenic
1113802869 13:113095592-113095614 GATGGCCTGGAGCAAGAGGACGG - Intronic
1113802878 13:113095639-113095661 GATGGCCTGGAGCAGGAGGACGG - Intronic
1114640469 14:24216222-24216244 GGTGGAGTGGAGAAGTAGGGAGG - Intronic
1114746318 14:25151708-25151730 GCTGCAGGGGAGAAGGAGGAGGG + Intergenic
1115163250 14:30419133-30419155 GCAGGCCTGGAGTAGGAGGAAGG - Intergenic
1116316367 14:43399644-43399666 AGTGGACTAGAGAAGAAAGAAGG + Intergenic
1116523418 14:45876194-45876216 AGTGGGCTGGAGAAGAAAGAAGG - Intergenic
1116647964 14:47553989-47554011 GGTGGACGGGGAAAGGAGGAAGG - Intronic
1116934662 14:50726790-50726812 GGTGGACTGCAGAGGGATGGGGG - Intronic
1117101784 14:52355944-52355966 GGGGAACTGGAGAAGTAAGATGG - Intergenic
1117231699 14:53725557-53725579 GGAGGAGTGTGGAAGGAGGACGG - Intergenic
1117341896 14:54798720-54798742 TGTGGAAGGGAGAGGGAGGAGGG + Intergenic
1117623972 14:57616912-57616934 GGGGGACTTGAGAAAGGGGATGG - Intronic
1118089614 14:62458844-62458866 GGGGGAGTGGAGAAGGGGAATGG - Intergenic
1118141621 14:63090216-63090238 GCTGGACTGGAGCAGCAAGAAGG - Intronic
1118169167 14:63369216-63369238 GGAGGACTGGAGAGGGAGGGAGG + Intergenic
1118717885 14:68573261-68573283 GGTGGGGTAGAGAAGGAGCAGGG - Intronic
1119180369 14:72601002-72601024 GGGGGAGAGGAGGAGGAGGAGGG + Intergenic
1119800216 14:77437715-77437737 GGTGGAATGGATAGGCAGGAAGG - Intronic
1119904967 14:78293448-78293470 GGTGGGATGGAGTAGGGGGATGG - Intronic
1119966545 14:78922699-78922721 GGTGGAGGGGAGCAGGGGGAGGG + Intronic
1120045363 14:79799666-79799688 GGTGGGCTGGAGAAGGAGAAGGG - Intronic
1120186470 14:81398446-81398468 GGTGGGCTGGAGTAGGGGTATGG + Exonic
1120353886 14:83402743-83402765 GGAGGAAGGGAGAAAGAGGAGGG + Intergenic
1121052748 14:90830153-90830175 GGTGGGGAGGAGACGGAGGACGG + Intergenic
1121808646 14:96857581-96857603 GATGGACTGCTGAAGGAGCAAGG + Intronic
1122546011 14:102523285-102523307 AGGGGAAGGGAGAAGGAGGAAGG + Intergenic
1122757030 14:103989825-103989847 GAGGGACTGGAGAAGGAGGCTGG + Intronic
1122880661 14:104689292-104689314 GGTGGACGGGAGGCGGTGGAGGG + Intergenic
1122890345 14:104729316-104729338 GGTGGACAGGAGCAGGACGATGG + Intronic
1122988322 14:105223627-105223649 GGTGGCCTGGGGCAGGAGGGGGG + Intronic
1122997619 14:105273913-105273935 GGTGGATTGGTAAAAGAGGAAGG + Intronic
1123066307 14:105621152-105621174 GGTGGACTGGAGTGGGTGGTAGG + Intergenic
1123070450 14:105640204-105640226 GGTGGACTGGAGTGGGTGGTAGG + Intergenic
1123075040 14:105663864-105663886 GGTGGACTGGAGTGGGTGGGAGG + Intergenic
1123077449 14:105675645-105675667 GGTGGATTGGTAAAAGAGGAAGG + Intergenic
1123089685 14:105736992-105737014 GGTGGACTGGAGTGGGTGGGAGG + Intergenic
1123095476 14:105765152-105765174 GGTGGACTGGAGTGGGTGGGAGG + Intergenic
1202852581 14_GL000225v1_random:30708-30730 GCTGGGCTGGAGCAGGGGGACGG - Intergenic
1123434929 15:20247865-20247887 GGAGGAGAGGAGAGGGAGGAGGG + Intergenic
1123723725 15:23082247-23082269 GGAGGACTAGCGAAAGAGGAAGG - Intergenic
1123813685 15:23955080-23955102 GGAGGACTGCAGAGGGAGGCAGG + Intergenic
1123996056 15:25718735-25718757 GGTGGCCGGGAGAGGGAGGCAGG + Intronic
1125004321 15:34800139-34800161 GGAGGGCAGGGGAAGGAGGAAGG + Intergenic
1125249142 15:37679239-37679261 GGGGGAGTGGAGAGGGGGGAGGG + Intergenic
1125484935 15:40105324-40105346 GGGGAACTGGAGAAAGAGGTTGG - Intronic
1125721565 15:41847544-41847566 GGGGGACTGGGGCAGCAGGATGG - Intronic
1126592491 15:50354562-50354584 AGTGGGCGGGAGAAAGAGGAAGG - Intronic
1126693526 15:51306796-51306818 GGTGGAATTGCTAAGGAGGAGGG + Intronic
1127141462 15:55982082-55982104 GGGAGACAGGAGTAGGAGGAGGG + Intronic
1128454546 15:67825348-67825370 GGGGGTGAGGAGAAGGAGGAGGG - Intronic
1128567650 15:68711794-68711816 GATGCACTGGAGAAGGGGGCTGG - Intronic
1128809126 15:70557279-70557301 AATGGACTGGAGTAGGAGGGAGG - Intergenic
1128940897 15:71786828-71786850 GACGGACAGGAGGAGGAGGAAGG + Intergenic
1129247730 15:74289967-74289989 GGTAGATTGAAGAAGGGGGAGGG + Intronic
1129457861 15:75685259-75685281 GGAGCCCTGCAGAAGGAGGACGG - Exonic
1129684567 15:77677744-77677766 GGTGTAGTGAAGAATGAGGAAGG - Intronic
1129725945 15:77901755-77901777 GGAGCCCTGCAGAAGGAGGATGG + Intergenic
1130273946 15:82466812-82466834 GGGGCCCTGCAGAAGGAGGATGG + Intergenic
1130466294 15:84194186-84194208 GGGGCCCTGCAGAAGGAGGATGG + Intergenic
1130497970 15:84479350-84479372 GGGGCCCTGCAGAAGGAGGATGG - Intergenic
1130588588 15:85198779-85198801 GGGGCCCTGCAGAAGGAGGATGG + Intergenic
1131152225 15:90054298-90054320 GATGGGATGGAGAAGGCGGAGGG + Intronic
1131340022 15:91590323-91590345 GGTGGCCAGGGAAAGGAGGAAGG + Intergenic
1131668659 15:94596636-94596658 GTTGAACTGGAGGAGGTGGAGGG - Intergenic
1131676640 15:94676788-94676810 GGAGGGCAGGAGAAGGAGGTGGG - Intergenic
1132543193 16:521020-521042 GGTGGAGAGGAGAGGGAGAAAGG + Exonic
1132725787 16:1337870-1337892 GGTGGACAGTAGAAGGTGGGGGG - Intronic
1133002400 16:2857979-2858001 GGTGGAGGTGAGAGGGAGGAGGG + Intronic
1133068950 16:3232916-3232938 GATGCACTGGGGAAAGAGGAAGG + Exonic
1133391166 16:5411366-5411388 TGTTGGCTGGAGATGGAGGAAGG + Intergenic
1133417344 16:5616742-5616764 GGGGGACAGGAGAGGGAGAAGGG - Intergenic
1133520283 16:6549532-6549554 GGAGGAGGGGAGGAGGAGGATGG + Intronic
1133755350 16:8758482-8758504 GGAGGACTGGAGTAGCAGCAGGG + Intronic
1134048998 16:11123827-11123849 GGTGGCCTGGAGGATGGGGAAGG - Exonic
1134344756 16:13379459-13379481 GGCAGGCTGGAGCAGGAGGAGGG - Intergenic
1134570578 16:15287451-15287473 GGAGGATTGGTGAAGGAGGAGGG - Intergenic
1134692152 16:16197942-16197964 GGTGGGAGGGGGAAGGAGGAGGG + Intronic
1134731802 16:16468605-16468627 GGAGGATTGGTGAAGGAGGAGGG + Intergenic
1134935644 16:18243396-18243418 GGAGGATTGGTGAAGGAGGAGGG - Intergenic
1136036496 16:27544465-27544487 GGGGGAGGGGAGGAGGAGGAAGG + Intronic
1136062357 16:27735298-27735320 TCTGGACTGGGGAAGGAAGATGG + Intronic
1136071911 16:27792369-27792391 AGTGGACTGGACAAGGGGAAGGG + Intronic
1136081350 16:27854339-27854361 GGGGGACGGAAGGAGGAGGAGGG + Intronic
1136105385 16:28026423-28026445 GGTGGACTAGAGCAGGAAGCAGG + Intronic
1136221078 16:28829384-28829406 ATTGGACTGGGGAGGGAGGAAGG - Exonic
1136278442 16:29192876-29192898 CGAGGTCTGGGGAAGGAGGATGG - Intergenic
1137447758 16:48542219-48542241 GGTGGAAGGGGGAAGGAGGGTGG + Exonic
1137598816 16:49742639-49742661 GGTGGGCAGGGGAGGGAGGATGG + Intronic
1137776675 16:51060742-51060764 GGAGGAAGGGAGAAGGAGGGAGG + Intergenic
1138293864 16:55870337-55870359 AGAGGAAGGGAGAAGGAGGAAGG + Intronic
1138350194 16:56342216-56342238 CCTGGAGTGGGGAAGGAGGAGGG + Intronic
1138667837 16:58586836-58586858 GGTGAACTGGTGAATGAGAAGGG - Intronic
1138937283 16:61743366-61743388 CGTGGAGTGGTGAGGGAGGAAGG + Intronic
1139424999 16:66873883-66873905 GGAGGAAGGGAGGAGGAGGAAGG - Intergenic
1139474617 16:67196846-67196868 GGTGGGCAGCAGAAGGAGGAGGG - Intronic
1139962795 16:70727677-70727699 AGTGCAATGGAGAAGCAGGAGGG + Intronic
1140130393 16:72155863-72155885 GGTTGCCTGGAGCTGGAGGAGGG - Intronic
1140622400 16:76751427-76751449 AGTGAACTGCAGAAGGAGAAGGG + Intergenic
1141100601 16:81195086-81195108 GGTGGACTAGAGAAGCAAGCTGG - Intergenic
1141364705 16:83432007-83432029 GATAGACTGGAGAAGGAGGAAGG + Intronic
1141405503 16:83789282-83789304 CAAGGATTGGAGAAGGAGGAGGG + Intronic
1141871460 16:86789317-86789339 GGTGGACTGGAGGACAAAGACGG + Intergenic
1142001292 16:87665760-87665782 GATGGGCTGGGGAAGGAGGCTGG - Intronic
1142376304 16:89708732-89708754 GCTGCACTGTAGAAGCAGGAGGG - Intronic
1203141663 16_KI270728v1_random:1771309-1771331 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1203141710 16_KI270728v1_random:1771452-1771474 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1142671814 17:1491190-1491212 GGGTGGCCGGAGAAGGAGGATGG - Intronic
1142720693 17:1773829-1773851 GGTGGCCTGGGGTAGGGGGAGGG + Intronic
1143243736 17:5465949-5465971 GCTGGTCTGGAAGAGGAGGAAGG - Intronic
1143249399 17:5511645-5511667 GGAGGTCTGCAGAAGGAGGCGGG + Intronic
1143305942 17:5946800-5946822 GGTGGAGAGGAGAAGGATGGAGG + Intronic
1143516853 17:7423749-7423771 GGTGAACTGGGGAAGGTGGGAGG - Intergenic
1143618513 17:8067838-8067860 GGAGGAGTGGAGGAGGAGGAGGG - Intergenic
1143714162 17:8755167-8755189 GGGAACCTGGAGAAGGAGGATGG + Intronic
1143861891 17:9897261-9897283 GCTGGAGGGTAGAAGGAGGAGGG - Exonic
1144045692 17:11452729-11452751 GGTAGAGTAGAGGAGGAGGAGGG - Intronic
1144201175 17:12943896-12943918 GGAGGACTGGAGGAGGGGGTGGG - Intronic
1144440698 17:15278549-15278571 GGCAGACTGGCGAAGGGGGAGGG - Intergenic
1144472776 17:15559581-15559603 GGGGGAGGGGAGAAGAAGGAGGG + Intronic
1144577248 17:16436864-16436886 GTTGGACTGGAGGAGCTGGACGG - Exonic
1144764112 17:17723696-17723718 GGGGGAAGGGAGGAGGAGGAGGG - Intronic
1144923704 17:18785120-18785142 GGGGGAGGGGAGAAGAAGGAGGG - Intronic
1145238951 17:21228390-21228412 GGAGGCCTGGAGCAGCAGGAAGG - Intergenic
1145757687 17:27404675-27404697 CCTGGTCTGGAGAGGGAGGAGGG - Intergenic
1145937496 17:28723494-28723516 GGAGGACTGGAGGAGGAAGGGGG + Intronic
1145999524 17:29122887-29122909 GGCGGCATGGAGAAGGAGCAGGG - Intronic
1146941381 17:36846434-36846456 GAGGGACTGGAAAAGGAGGGTGG - Intergenic
1147163627 17:38581895-38581917 GGGTGAGTGGAGGAGGAGGAAGG - Intronic
1147374954 17:40017821-40017843 GCTGGACTCAAGAAGGAGGAAGG - Intergenic
1147389173 17:40099028-40099050 GGCGGACCGGAAAAGGAGGCAGG + Intronic
1147896744 17:43756303-43756325 GGTGGACAGGGGATGGAGAAAGG + Intronic
1148208647 17:45795016-45795038 GGTGCACAGGAGATGCAGGAAGG - Intronic
1148290409 17:46443179-46443201 TGTGGACTGAGGGAGGAGGAAGG - Intergenic
1148312577 17:46660752-46660774 TGTGGACTGAGGGAGGAGGAAGG - Intronic
1148460024 17:47834344-47834366 GGAGGATGGGAGACGGAGGAGGG - Intronic
1148464426 17:47856492-47856514 GGTGGCCTGGAAAAGGGAGAAGG + Intergenic
1148695777 17:49557219-49557241 GGGGGACTGGAGAGGGAGAGAGG - Intergenic
1148774493 17:50087979-50088001 GGTGGAGAGGACAGGGAGGAAGG - Intronic
1149454462 17:56776783-56776805 GCTGGAATGGAGAAGGTGAATGG - Intergenic
1149540626 17:57465536-57465558 AGTGGAGTGGAGGATGAGGAAGG + Intronic
1150282123 17:63934775-63934797 CCTGGGCTGGAGAAGGAGGCAGG - Intergenic
1150364860 17:64573214-64573236 GGAGGAGGGGAGGAGGAGGAGGG + Intronic
1150370241 17:64631228-64631250 GGTGGGGTGGAGAGGGAGGGAGG + Intronic
1150439401 17:65179163-65179185 GGTGTGCAGGGGAAGGAGGAGGG + Intronic
1150720442 17:67609884-67609906 GCCGGAATGGAGAAGTAGGATGG - Intronic
1150976882 17:70097456-70097478 GGAGGTCAGGAGCAGGAGGATGG + Intronic
1151143367 17:72016493-72016515 TGGGGTCTGGAGAAGGAGAAAGG + Intergenic
1151224009 17:72635117-72635139 GGTGGGCTGAGGAAGCAGGAGGG - Intergenic
1151383520 17:73741492-73741514 TGAGGACGGGAGAAGGTGGAAGG + Intergenic
1151394538 17:73813491-73813513 GGTGGACGGCAGGAGAAGGAAGG - Intergenic
1151476149 17:74345249-74345271 GGTGGGAAGGGGAAGGAGGATGG + Intronic
1151753614 17:76057474-76057496 AGTGGAGTGGAGAGGGAGAACGG - Exonic
1152007864 17:77693871-77693893 AGGTGCCTGGAGAAGGAGGAGGG + Intergenic
1152365630 17:79854736-79854758 GGCAGACTGAAGAAGGAGGAAGG + Intergenic
1152524312 17:80878958-80878980 CGGGGCCTGGGGAAGGAGGAGGG - Intronic
1152624033 17:81380109-81380131 GGGGGAGTGGAGCGGGAGGATGG - Intergenic
1152931085 17:83110192-83110214 GCTGGCCTGGGGGAGGAGGAAGG + Intergenic
1153027881 18:687764-687786 GGTGGCCTGGAGGGAGAGGAGGG + Intronic
1153762211 18:8342101-8342123 GGAGGCCTGGACAGGGAGGAAGG + Intronic
1153764861 18:8365750-8365772 GGTGTCCCGGAGAAGGAGGAGGG - Intronic
1154026863 18:10716184-10716206 GGTGGAGGAGAGAAGGTGGAAGG - Intronic
1154110959 18:11567934-11567956 GGAGGAGAGGAGGAGGAGGAGGG + Intergenic
1154485527 18:14868720-14868742 GGTGGGCTGAAGAAGTGGGAAGG - Intergenic
1155052094 18:22157492-22157514 GGTGGAATAGGAAAGGAGGAAGG + Intergenic
1155967490 18:32049598-32049620 GGTGGCGGGGAGGAGGAGGATGG + Intronic
1156427913 18:37035943-37035965 GGTGGCATGGAGAAGTAGTAAGG - Intronic
1156501601 18:37563556-37563578 GGTTGACTTGAGAGGGAGGGGGG + Intronic
1156501647 18:37563909-37563931 GGAGGGCTGGAGAAAGAGGGTGG + Intronic
1157233354 18:45940061-45940083 GGTGGGCAGGATAAGGAGGTGGG + Intronic
1157245267 18:46048223-46048245 GGTGGCTTGAAGATGGAGGAAGG + Intronic
1157354596 18:46920838-46920860 AGGGGAGTGGAGAAGGAGGGAGG + Intronic
1157442845 18:47723518-47723540 GGCGCCATGGAGAAGGAGGATGG - Intergenic
1157755770 18:50216234-50216256 GATGGCCTAGAGAAGGAAGAAGG - Intergenic
1157923088 18:51733787-51733809 GCTGGCCTGGAGTAGGGGGAAGG + Intergenic
1158099856 18:53818947-53818969 CCTGGGCTGGAGGAGGAGGAAGG + Intergenic
1158220633 18:55146798-55146820 GGGGTACAGGAGAAGCAGGAGGG + Intergenic
1158220937 18:55149986-55150008 TGTGGATGGGAGAAGGAGGAGGG + Intergenic
1158272390 18:55730571-55730593 GTTGGAGAGGAGAAGGAGGCAGG + Intergenic
1158341759 18:56473635-56473657 GATGGCCTGGAGAAGAAGGAGGG - Intergenic
1158851024 18:61495996-61496018 GGTGGAGGGGAGAGGGAAGAAGG - Intronic
1159041078 18:63323156-63323178 GGTGGCCTGGGGAATGAAGACGG - Intergenic
1159362821 18:67427352-67427374 GTAGGAATGCAGAAGGAGGAAGG - Intergenic
1159730181 18:72016143-72016165 GGTGGACTGGATAAAGAAAATGG - Intergenic
1159959648 18:74545603-74545625 CGTGGACTGGGGACAGAGGAGGG - Intronic
1160355694 18:78226612-78226634 GGTGTGCAGGTGAAGGAGGAGGG - Intergenic
1160419344 18:78733380-78733402 GGTGAAGTGGAGAAGGTGGTAGG - Intergenic
1160486628 18:79299298-79299320 GAAGGGCTGGAGAGGGAGGAGGG - Intronic
1160676889 19:395733-395755 GGATGAATGGAGAAGGACGATGG + Intergenic
1160676898 19:395785-395807 GGATGAATGGAGAAGGATGATGG + Intergenic
1160676910 19:395863-395885 GGATGAATGGAGAAGGACGATGG + Intergenic
1160676928 19:395951-395973 GGATGAATGGAGAAGGACGATGG + Intergenic
1161166805 19:2792046-2792068 TGGGGACAGGAGGAGGAGGAAGG - Intronic
1161207136 19:3047099-3047121 GGGGGAGAGGGGAAGGAGGAGGG - Intronic
1161503190 19:4628979-4629001 GCTGGCTTGGAGATGGAGGAAGG - Intergenic
1161714665 19:5868416-5868438 GGGCGACCGGAGGAGGAGGAGGG + Intronic
1162007254 19:7788591-7788613 GGTGCCCTGGAGGAGGAGGTGGG + Intergenic
1162053108 19:8046845-8046867 GATGGGGAGGAGAAGGAGGAGGG - Intronic
1162186976 19:8913460-8913482 GTGGGGCTGGAGAGGGAGGATGG + Exonic
1162280576 19:9693870-9693892 TGTTCACTGGAGAATGAGGAAGG + Intronic
1162310981 19:9907070-9907092 TGTTGACTGGAGATGGAGGTGGG - Intronic
1162541100 19:11296472-11296494 GGTTCCCTGGAGAAGCAGGAGGG + Intronic
1162591659 19:11596311-11596333 GGAGGACAGGAAGAGGAGGAAGG - Intronic
1163390702 19:17028164-17028186 GTTGGACTGGCAAAGGAGGCAGG - Intergenic
1163554603 19:17984899-17984921 GGAGGACTGGAGGAGGTGGGAGG - Intronic
1163596503 19:18224101-18224123 GGTAGTGTGGAGAGGGAGGAGGG - Intronic
1163830743 19:19546079-19546101 GGCTGTCTGGAGAAGAAGGAGGG - Exonic
1164149814 19:22541383-22541405 GGTGGAGGAGGGAAGGAGGAAGG - Intergenic
1164249999 19:23467971-23467993 GGAGAAGTGGAGGAGGAGGATGG - Intergenic
1164324721 19:24181203-24181225 GGAGGAGAGGAGAAGGAGGATGG + Intergenic
1164324726 19:24181217-24181239 GGAGGATGGGAGAAGGAGGAGGG + Intergenic
1164753898 19:30675570-30675592 TGTGGATTGGAGAAGGAGCTGGG + Intronic
1164755647 19:30686973-30686995 GGAGGACTTTAGAAGGGGGAGGG - Intronic
1164878250 19:31708510-31708532 GGTGGGTTGGATAAGGAGAAGGG - Intergenic
1165591275 19:36972405-36972427 AAGGGACTGGAGAAGGATGAGGG - Intronic
1165741649 19:38208439-38208461 TGGGGACAGGAGCAGGAGGAGGG - Intergenic
1166302803 19:41921878-41921900 GGTGGAGATGAGGAGGAGGAGGG - Intronic
1166392896 19:42419705-42419727 GGTGGATGGGGGATGGAGGAAGG + Intronic
1166878058 19:45910066-45910088 TTTGGACTGGATAAGGAGGAGGG + Intergenic
1167191197 19:47991434-47991456 GGAGGAGAGGAGAAGGAGAAGGG - Intronic
1167307350 19:48716738-48716760 GGAGGACTGTGGAGGGAGGAGGG + Exonic
1167435200 19:49475008-49475030 GGTGGACAGGAGGAGGGAGATGG + Intronic
1167435247 19:49475169-49475191 GGTGGACAGGAGGAGGGAGACGG + Intronic
1167517698 19:49932801-49932823 GTTGAGGTGGAGAAGGAGGAGGG - Exonic
1167591973 19:50409068-50409090 GGTGGGCTGGAGCAGGAGGGTGG + Intronic
1168277928 19:55287329-55287351 GGTAACCTGGAGAGGGAGGATGG - Intronic
1168290099 19:55353393-55353415 GCTGGAATGGAGAGGGAGAAGGG + Exonic
1168644506 19:58051481-58051503 GCTGGGCTAGAGACGGAGGAGGG - Intronic
925002015 2:410513-410535 GGTGGTGTGGACAATGAGGATGG - Intergenic
925847117 2:8044222-8044244 AGAGGAAGGGAGAAGGAGGAAGG - Intergenic
926127062 2:10278204-10278226 GCTGGACTGGGGCCGGAGGAGGG + Intergenic
926446466 2:12948511-12948533 TGTGATCTGGAGCAGGAGGAGGG + Intergenic
927076284 2:19581088-19581110 GATGGAATGCAGGAGGAGGAAGG + Intergenic
927170942 2:20368820-20368842 GGGAGACTGAAGTAGGAGGATGG + Intergenic
927466802 2:23342892-23342914 GGTGGGCTGGAGAGCGAGGAAGG + Intergenic
927475286 2:23409926-23409948 GGTGAGCTGGGGAAGGAGCAGGG + Intronic
927513317 2:23658084-23658106 AGTGGGCAGGAGAGGGAGGAGGG - Intronic
927646257 2:24878846-24878868 GCAGGACTGGAGAATGAGTAGGG - Intronic
927859475 2:26551441-26551463 GGAAGACTGAGGAAGGAGGAAGG - Intronic
928076441 2:28269275-28269297 GATGGAGAGGAGAAGGGGGAAGG - Intronic
928249367 2:29661292-29661314 GGTAGAGAGGAGAAGCAGGAGGG - Intronic
930866494 2:56126963-56126985 GATGGACTGGAGGAGCAGGAGGG + Intergenic
932337712 2:70940343-70940365 GGTGGGCTGGATAGGGAGGTGGG - Exonic
932442355 2:71745635-71745657 GGTGGACTGGGAGAAGAGGAGGG + Intergenic
932562007 2:72881416-72881438 GGAAGACTGCAGAAGGAGCAGGG - Intergenic
932777824 2:74539071-74539093 GGTGGAAAGGAGAGGGAGCATGG - Intronic
933351993 2:81165152-81165174 GGGAGACTGAAGCAGGAGGATGG + Intergenic
933358393 2:81244591-81244613 GGTGGATTGGAGCAGGAACAAGG - Intergenic
933711410 2:85328470-85328492 CGTGGAGTCGGGAAGGAGGAGGG - Intergenic
933721524 2:85400516-85400538 GGGGGACAGGAGCAGGGGGAGGG - Intronic
934937048 2:98473070-98473092 GGTGCAGTGGAGAGTGAGGAGGG + Intronic
934937064 2:98473160-98473182 GGTGCAGTGGAGAGTGAGGAGGG + Intronic
934937071 2:98473190-98473212 GGTGGAGTGGAGAGAGTGGAGGG + Intronic
934937096 2:98473310-98473332 GGTGGAGTGGAGAGTGAGGAGGG + Intronic
934937103 2:98473340-98473362 GGTGGAGTGGAGAGTGAGGAGGG + Intronic
936401944 2:112171316-112171338 AGTCAAATGGAGAAGGAGGAGGG + Intronic
936439780 2:112541873-112541895 GGAGGCCTGGGGAAGGAGGTGGG - Intergenic
937153888 2:119704616-119704638 GGAGGAAAGGAGGAGGAGGAAGG + Intergenic
937330698 2:121026480-121026502 GATGGACTTAAGAAGGAGGGTGG - Intergenic
937737260 2:125307177-125307199 GGAGGAAAGGAGAAGAAGGAAGG + Intergenic
937860892 2:126708107-126708129 GGTGGAGTGGGGAAGGTGGCAGG + Intergenic
938081187 2:128371034-128371056 GAGGGACCAGAGAAGGAGGACGG - Intergenic
938737687 2:134201327-134201349 GGTGGACTGGAGTATGGGGTTGG + Intronic
938969924 2:136422741-136422763 AGGGGCCTGGAGAAGGTGGAAGG + Intergenic
939392443 2:141585955-141585977 GGCAGACTGAAGCAGGAGGATGG - Intronic
940648983 2:156421884-156421906 GGTAGGCTGAAGAGGGAGGAAGG + Intergenic
940970687 2:159893687-159893709 GGTGTCATGGAGGAGGAGGAGGG - Intronic
941886265 2:170530818-170530840 GGTGGTGTGGTGAAGGTGGAAGG + Intronic
941918545 2:170828051-170828073 GGAGGACAGCAGAAGGAGGAGGG - Intronic
941918554 2:170828089-170828111 GGAGGACAGCAGAAGGAGGAGGG - Intronic
941933249 2:170963473-170963495 GGGGGGCGGGAGGAGGAGGAGGG - Intronic
941939252 2:171016072-171016094 GGTGGGCTGGAGAGTGGGGATGG - Intronic
942168377 2:173264861-173264883 GGGGAAATGGAGAAAGAGGAAGG + Intronic
942462552 2:176178304-176178326 GGAGGACTGGAGAAGGGGCTGGG + Intergenic
943707032 2:191046613-191046635 GGAGGACTGCAGCTGGAGGATGG + Intronic
944488700 2:200234617-200234639 GCTTGACTGGAGAAGGATCAGGG + Intergenic
944851035 2:203719459-203719481 GTTGGACTTGATAGGGAGGATGG - Intronic
945818039 2:214629619-214629641 GGTGGCTTGGAGAAGGAGAGTGG + Intergenic
946122879 2:217531818-217531840 TGTTGACTGGAAAAGGAGTAAGG + Intronic
946144442 2:217718451-217718473 GTTGGGCTGGAGAAGGAGAAAGG - Intronic
946177394 2:217929893-217929915 GGTGGAGGGGACAAGGCGGAGGG - Intronic
947317841 2:228881260-228881282 GAAGCTCTGGAGAAGGAGGAGGG + Intronic
947363366 2:229368412-229368434 GGTGGAATGGAGAGAGAGTATGG - Intronic
947760949 2:232603425-232603447 GGTGGAAGGAGGAAGGAGGAAGG + Intergenic
947817454 2:233047788-233047810 GGTGTCCTGGAGGAGGAGGCGGG + Intergenic
947859416 2:233348245-233348267 GGTGAACTGCAGGTGGAGGAGGG + Intergenic
947859673 2:233349563-233349585 GAAGGGCTGGAGAAGGGGGATGG + Intergenic
948062938 2:235055123-235055145 GTTGGAAGGGAGCAGGAGGAAGG + Exonic
948458648 2:238118771-238118793 GGAGGAGGGGAGATGGAGGAGGG + Intronic
948458745 2:238119154-238119176 GGAGGAGGGGAGATGGAGGAGGG + Intronic
948478704 2:238237525-238237547 GGGGTCCTGGAGCAGGAGGAGGG + Intergenic
948748198 2:240110752-240110774 GGAAGAGAGGAGAAGGAGGAGGG - Intergenic
948770822 2:240250542-240250564 GGAGGGCTGAAGAGGGAGGAGGG + Intergenic
948940201 2:241191502-241191524 AGGGGACTGGAGCAGGAGGGAGG - Intronic
948995424 2:241575972-241575994 GGAGGACTGGAGGAGGAGGAGGG - Intergenic
948995483 2:241576201-241576223 GGAGGGCTGGATAAGGAGGAGGG - Intergenic
1168848042 20:958770-958792 GGTGGCCTGGGGAAGGAAGATGG - Exonic
1169110923 20:3033231-3033253 GGTGGACTGGTGTCGGGGGAAGG - Intronic
1169324069 20:4661158-4661180 GGGGGACTGGGGAGGGAGGGAGG + Intergenic
1170792686 20:19520981-19521003 GGAGTACTGGGGAAGGAGGGAGG + Intronic
1171087420 20:22250577-22250599 GGGGGAGTGGAGGAGGAGGAGGG + Intergenic
1171087432 20:22250616-22250638 GGAGGGCTGGAGCAGGAGGAGGG + Intergenic
1171123643 20:22584625-22584647 GGTGGGGAGGAGGAGGAGGAAGG + Intronic
1171182092 20:23098358-23098380 GGTGGACTGGGGGAGGAAGTGGG - Intergenic
1171384800 20:24763045-24763067 GGTGGGCTGGGGAAGGGGAAGGG + Intergenic
1171447859 20:25217485-25217507 GGTGCCCTGGAGAAGAACGAGGG - Exonic
1171780237 20:29410938-29410960 GCTGGGCTGGAGCAGGGGGACGG + Intergenic
1171824201 20:29879202-29879224 GCTGGGCTGGAGCAGGGGGATGG + Intergenic
1172180766 20:33002131-33002153 GGTGGATGGAAGAAGGAAGAAGG + Intronic
1172199302 20:33114028-33114050 GGTGGGCTGGGGAATGGGGATGG - Intergenic
1172261975 20:33574807-33574829 GGTGGAATGGAGAAGGGCAAAGG + Intronic
1172852303 20:37975371-37975393 CATGGAGTGGAGAGGGAGGAAGG + Intergenic
1173269728 20:41522099-41522121 GGTAGGCTGGGGCAGGAGGATGG + Intronic
1173410382 20:42804372-42804394 GGTGGACAGCAGCAAGAGGAAGG - Intronic
1173829485 20:46071981-46072003 GAAGGACTGGAGGAGGAGCATGG - Intronic
1174104084 20:48149707-48149729 GGTGAACTGGAGAGGGAGGTGGG + Intergenic
1174316785 20:49709365-49709387 GGTGGATTTGATAAGGAGCAAGG - Intronic
1174393318 20:50231510-50231532 GGAGGAGTGGAGAATGAGGATGG + Intergenic
1174749511 20:53097740-53097762 CATGGAGTGGTGAAGGAGGAAGG - Intronic
1174968725 20:55249623-55249645 GGTGGAGAGTAGAAGGGGGATGG - Intergenic
1175160171 20:57002502-57002524 AGTGGACAGGAGAGGAAGGAAGG - Intergenic
1175264821 20:57696154-57696176 GGAGGATGGGAGGAGGAGGAAGG + Intronic
1175327656 20:58140909-58140931 GGTGGACAGGAGTTGGGGGAGGG + Intergenic
1175526785 20:59639717-59639739 GGAGGAGGGGAGAAGGGGGATGG + Intronic
1175616640 20:60405359-60405381 TTTGGAATGGAGAAGGGGGAAGG + Intergenic
1175941661 20:62540115-62540137 CGAGGGCTGGAGGAGGAGGAGGG + Intergenic
1176173960 20:63708926-63708948 GGTGGGCAGGAGGAGGAAGAGGG + Exonic
1176310084 21:5144860-5144882 CGGGGACTGGAGGAAGAGGAAGG - Intronic
1176795808 21:13370756-13370778 GGTGGGCTGAAGAAGTGGGAAGG + Intergenic
1177780537 21:25618159-25618181 TTAGGACTGGAGAAGTAGGATGG + Intergenic
1178172666 21:30059035-30059057 GGTGCACTTGAGAGGGAGGGTGG - Intergenic
1178182007 21:30172141-30172163 GATGGACTGGAGGTGGGGGAAGG + Intergenic
1178973576 21:37202480-37202502 GGTGGGGTGGGGAAGGAGAATGG - Exonic
1178982140 21:37273564-37273586 GGAGGGGTGGAGAAGGAGGAGGG + Intergenic
1179846972 21:44117172-44117194 TGGGGACTGGAGGAAGAGGAAGG + Intronic
1180289489 22:10783986-10784008 GGTGGGCTGAAGAAGTGGGAAGG + Intergenic
1180305411 22:11068813-11068835 GGTGGGCTGAAGAAGTGGGAAGG - Intergenic
1180988468 22:19919496-19919518 GGTGTCCTGGGGAAGGAGGTGGG - Intronic
1181033748 22:20160242-20160264 GGTGGGCTGGAGGAGCTGGAGGG - Intergenic
1181053000 22:20246491-20246513 GGAGGGGTGGAGAAGGGGGATGG + Intronic
1181267547 22:21639565-21639587 GGTGGTCTGCAGCAGGAGGCCGG + Intergenic
1181381619 22:22508904-22508926 GGTTAAATTGAGAAGGAGGAGGG + Exonic
1181574685 22:23786434-23786456 AGAGGAATGGAGAAGGTGGAAGG + Intergenic
1181731166 22:24847901-24847923 GGTGGGTTTGAGAAGCAGGATGG - Intronic
1182003010 22:26936495-26936517 GGAGGAATGGAGGAGGATGAGGG - Intergenic
1182080138 22:27522956-27522978 GGTTATCTGGAGAAGGAGGTGGG + Intergenic
1182448183 22:30402099-30402121 GGTGGACTGGGGTAGGGGGATGG - Intronic
1182639152 22:31753098-31753120 GGTGGACTGGACTAGGGGGCGGG + Intergenic
1182741075 22:32567891-32567913 GGTTGGCAAGAGAAGGAGGAGGG - Intronic
1182776933 22:32838238-32838260 AGTGGACTTGAGGAGAAGGAGGG + Intronic
1182865474 22:33600658-33600680 GCAGGACTGGAGAGTGAGGAAGG + Intronic
1183140120 22:35929843-35929865 GGAGGACTGGAGAGGGAGCAGGG + Intronic
1183188388 22:36305762-36305784 GGTGGAAAAGAGAAGGAGGTGGG + Intronic
1183371275 22:37433801-37433823 GGAGAGCTGGAGGAGGAGGAAGG + Intergenic
1183429710 22:37758121-37758143 GAGGCACTGGAGAAGGAGGTAGG + Exonic
1183841678 22:40502980-40503002 GGTGTATTGGGGAAGGGGGATGG - Intronic
1184119040 22:42438452-42438474 GGTTGCCGGGAGGAGGAGGAAGG - Intergenic
1184599152 22:45532391-45532413 AGTGGGCTGGGGAAGGAGGTGGG + Intronic
1184697784 22:46149835-46149857 GGTGGGCGGGGGAACGAGGAGGG - Intergenic
1184770626 22:46594701-46594723 GCCGGACTGGAGATGGAGGCTGG + Intronic
1184920417 22:47601618-47601640 GGAGGGATGGAGAAGGAGGAGGG - Intergenic
1184939188 22:47748505-47748527 GACGGACTGGAGGAGGAGGAGGG + Intergenic
1185187645 22:49412180-49412202 GAGGGAGTGGAGGAGGAGGAGGG + Intergenic
1185263642 22:49885751-49885773 GCTGTCCTGGAGAAGTAGGAAGG - Exonic
949357816 3:3200464-3200486 GCTGGAGTAGAGAAGGATGAGGG + Intergenic
950014987 3:9749255-9749277 AGTCGCCTGGAGTAGGAGGATGG - Intergenic
950461515 3:13124990-13125012 TGTGGACTGGAGAAGGAGGATGG - Intergenic
952122389 3:30261198-30261220 GGTGGCCTGGAGGAGGAGCTTGG + Intergenic
952559483 3:34573956-34573978 GGAGGAAGGAAGAAGGAGGAAGG - Intergenic
952569235 3:34694471-34694493 GGGGGAAGGGAGAAGGAGGGAGG - Intergenic
952735908 3:36691369-36691391 GGGAGGCAGGAGAAGGAGGAAGG + Intergenic
952920557 3:38281139-38281161 GGAGGTCTGGTGAAAGAGGAAGG + Intergenic
952923512 3:38305487-38305509 GCAGGAGTGGGGAAGGAGGAAGG - Intronic
953033589 3:39193113-39193135 GGTGGAATGGATAAGAAAGAAGG - Intergenic
953092523 3:39743478-39743500 GGGGGATGGGAGAAGTAGGAAGG + Intergenic
953169772 3:40496505-40496527 GGGGGACTGAGGCAGGAGGATGG - Intergenic
953373532 3:42409622-42409644 GGTGGTCTGGATTAGGATGATGG - Intronic
953390881 3:42533008-42533030 GGAGGACTGGAGGAAGAGGCAGG + Intronic
953449303 3:42992669-42992691 GGTGAACTGGAAACAGAGGAAGG + Intronic
953881840 3:46694825-46694847 GGAGGGATGGAGAAGCAGGAAGG - Intergenic
954258064 3:49419877-49419899 AGTGGAGAGGAGGAGGAGGAGGG + Intronic
954284930 3:49612238-49612260 GGGAGGCTGGGGAAGGAGGACGG - Intronic
954348863 3:50025662-50025684 GGGAGACTGAAGCAGGAGGACGG - Intronic
954387992 3:50254432-50254454 GGTGGGTGGGAGGAGGAGGAGGG + Intronic
954411740 3:50374063-50374085 GGAGGAAGGGAGAGGGAGGAGGG + Intronic
954416584 3:50396222-50396244 GGTGGAATGGAGGAGGCAGAGGG - Intronic
954631132 3:52048196-52048218 GGAGGTCTGGAGAAGGATGGGGG - Intergenic
954635419 3:52068407-52068429 GGAGGAAGGGAGAGGGAGGAAGG + Intergenic
954694658 3:52415533-52415555 GATTGACTGGAAAAGGAGGCAGG - Intronic
954797425 3:53168677-53168699 GGTGGGGTGGAGCAGGAAGACGG + Intronic
955408317 3:58639781-58639803 GTTGGGATGGAGATGGAGGAGGG + Intronic
955848348 3:63192783-63192805 GGAGGAATGGAGAAGAATGAGGG - Intergenic
956440904 3:69279690-69279712 GGGGAAGAGGAGAAGGAGGAGGG - Intronic
956440915 3:69279721-69279743 GGGGAAGAGGAGAAGGAGGAGGG - Intronic
956696373 3:71922404-71922426 AATGAACTGTAGAAGGAGGAAGG + Intergenic
956900085 3:73706603-73706625 GGTGGAGTGGAGTTGGAGGGAGG - Intergenic
957015625 3:75061199-75061221 GGAGGACTAGAGAGGTAGGAAGG + Intergenic
957245111 3:77706516-77706538 GGGGGGCTGGAGGAGGAGGATGG + Intergenic
957322469 3:78650121-78650143 GGTGGAGTGGGGAAGGGGTAGGG - Intronic
958163667 3:89851431-89851453 AGGGGAGAGGAGAAGGAGGAAGG + Intergenic
959034664 3:101346961-101346983 GGAGGAAAGGAGGAGGAGGAAGG + Intronic
961040123 3:123672252-123672274 GGAGGAAGGGAGAAGGAGGGAGG + Intronic
961080923 3:124027145-124027167 GTTGGTTTGGAGATGGAGGAAGG + Intergenic
961233162 3:125338783-125338805 GATGGACTGGAAATGGAGTATGG - Intronic
961345358 3:126260363-126260385 GGAGGAGGGGAGAAGGAAGAGGG - Intergenic
961360428 3:126364055-126364077 GGGGGACTGGGGAATGAGAATGG - Intergenic
961512054 3:127409232-127409254 GGAGGCCGGGAGGAGGAGGATGG - Intergenic
961599208 3:128046102-128046124 GTGGGACTTGAGAAGGAGAAAGG - Intergenic
962237841 3:133723798-133723820 GGTGGGGTGGGGAAGGGGGAGGG - Intergenic
962598909 3:136975910-136975932 GGTGGACTGGGCAAGGAGGTGGG + Intronic
962704005 3:138026176-138026198 GGGGAACAGGAGAAGGAGGGGGG - Intronic
962848200 3:139288951-139288973 TGTGGGCTGGAGTAGGAGGGAGG + Intronic
964134238 3:153326446-153326468 GGTGGACTGGATAACGAAAATGG - Intergenic
965742770 3:171893529-171893551 GGTGGACTGGAGCAGCAGAGTGG + Intronic
966762764 3:183431823-183431845 GGTTCACTGGAGAAGGAAGCAGG - Intergenic
967011689 3:185441288-185441310 AGAGGCCTGGAGGAGGAGGAAGG - Intronic
967016815 3:185489769-185489791 GGTGTTCTGGAGTAGGGGGAGGG - Exonic
967217794 3:187225031-187225053 GGAGGATTGGAGAAGTAAGAGGG - Intronic
967648605 3:191957467-191957489 GGAGGGATGGAGAAGGAGGAAGG + Intergenic
967931455 3:194693374-194693396 TGTGAACTGGAGAAGGAGGAAGG - Intergenic
967950862 3:194839394-194839416 GGAGCAATGGAGCAGGAGGAAGG + Intergenic
968005443 3:195239409-195239431 GGGGGACTTGAAAGGGAGGAGGG - Intronic
968020081 3:195378079-195378101 GGAGGAAGGGAGGAGGAGGAAGG + Intronic
969239284 4:5888485-5888507 GGAGGGCGGGAGAAGGAGGAGGG + Intronic
969245171 4:5927273-5927295 GATGGGCTGGAAAAGGAGCAAGG - Intronic
969365133 4:6689910-6689932 GATGGGCTGGAGGGGGAGGAGGG - Intergenic
969398341 4:6937797-6937819 GGTGGATTAGAGAAGCAGGATGG + Intronic
969500974 4:7552746-7552768 GCTGGAGTGGAGAGGCAGGAAGG - Intronic
969527531 4:7711508-7711530 GCTGGACTGGAGAAGGCCCAGGG + Intronic
969575010 4:8031522-8031544 GGTTGTCTGGAGCAGGAGGCTGG + Intronic
969637155 4:8375891-8375913 GGTGGACTGGATAAAGAAAATGG - Intronic
969670060 4:8585170-8585192 GGTCTACTGGAGACGGGGGAGGG + Intronic
969680311 4:8639673-8639695 GGGGGGCTGGAGCAGCAGGAAGG + Intergenic
969707542 4:8820112-8820134 GGTGGAGTGGAGGAGGTGGGGGG + Intergenic
970056371 4:11978016-11978038 GGGGGACTGAGGCAGGAGGATGG - Intergenic
971127101 4:23765961-23765983 GGTGGATGAGACAAGGAGGAAGG - Intronic
971390541 4:26181428-26181450 GGAGGTATGGAGAGGGAGGAAGG - Intronic
971487998 4:27180984-27181006 GGTGGCATGGAGAAGGGGAATGG + Intergenic
973259526 4:48148077-48148099 GCTGGGCTGGTGAAGGGGGATGG + Intronic
973323218 4:48831163-48831185 GGTGGACTCGAGAGGGGGCAGGG - Exonic
973719735 4:53711255-53711277 GGGGGTCTGGAGCAAGAGGAAGG - Intronic
973758109 4:54094651-54094673 GGAGAACTGGAGAGGGAGGGAGG + Intronic
973906867 4:55540727-55540749 CGTGGAGTGGAGAGGGAGGAAGG + Intronic
974639727 4:64612605-64612627 GGTGGACTGGATAAAGAAAATGG + Intergenic
974808041 4:66907103-66907125 GTTTGACTGGAAAAGGAGGTGGG - Intergenic
975252150 4:72192873-72192895 GGTGGGGTGGAGAGGGAAGAAGG + Intergenic
975448037 4:74490575-74490597 GCTGGACAGGGGATGGAGGAGGG - Intergenic
976439597 4:85058186-85058208 GGAGGAATGGAGAGGGAGAAAGG - Intergenic
976521973 4:86039267-86039289 GATGCACTGGAGAGAGAGGAAGG + Intronic
978011782 4:103695309-103695331 GGTGAAGTGGAGGAGGTGGAAGG - Intronic
978123996 4:105113758-105113780 GTTGTAGTGGAGAAGGATGATGG - Intergenic
979972894 4:127159601-127159623 GGGGGAAAGGAGATGGAGGAAGG + Intergenic
980859132 4:138479031-138479053 GGGGGAGGGGAGAAGGGGGAGGG - Intergenic
981025074 4:140069551-140069573 GGAGGAGGGGAGGAGGAGGAGGG + Intronic
981500805 4:145449494-145449516 TGTGGGCTGGAGAAAGAGAAGGG + Intergenic
982799306 4:159683763-159683785 TGTGGGCTGGAGAAGGCAGAAGG + Intergenic
982932123 4:161421671-161421693 GGTGGACTGGATGAGGCAGATGG + Intronic
983094237 4:163542959-163542981 GGTGGACAAGAGAAGCTGGAAGG + Intronic
983162104 4:164429320-164429342 GCTGGAGTGGTTAAGGAGGAAGG - Intergenic
983498746 4:168475881-168475903 GGTGGAGGGGAGAAGGGAGAAGG - Intronic
984070737 4:175108822-175108844 GGAGGAATGAAGAAGGAGGCAGG + Intergenic
984339125 4:178431237-178431259 GGAGGACTGAGGTAGGAGGATGG + Intergenic
984549133 4:181139816-181139838 GGTGGAGTGGAGCAGGATGGGGG - Intergenic
984591815 4:181625707-181625729 GGGAGACTGAAGAAGGAGAATGG + Intergenic
984702230 4:182825777-182825799 GGGGAAAGGGAGAAGGAGGAGGG - Intergenic
984703430 4:182833006-182833028 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703447 4:182833055-182833077 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703483 4:182833155-182833177 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703489 4:182833174-182833196 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703505 4:182833227-182833249 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703523 4:182833278-182833300 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703561 4:182833376-182833398 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703567 4:182833395-182833417 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703578 4:182833430-182833452 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703627 4:182833556-182833578 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703633 4:182833575-182833597 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703639 4:182833594-182833616 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703650 4:182833629-182833651 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703699 4:182833755-182833777 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703705 4:182833774-182833796 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703711 4:182833793-182833815 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703724 4:182833832-182833854 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703730 4:182833851-182833873 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703736 4:182833870-182833892 AGGGGAGGGGAGAAGGAGGAGGG - Intergenic
984703744 4:182833889-182833911 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703755 4:182833924-182833946 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703768 4:182833959-182833981 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703774 4:182833978-182834000 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703780 4:182833997-182834019 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703800 4:182834048-182834070 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703837 4:182834145-182834167 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703843 4:182834164-182834186 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703849 4:182834183-182834205 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703855 4:182834202-182834224 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703866 4:182834237-182834259 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703915 4:182834363-182834385 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703921 4:182834382-182834404 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703927 4:182834401-182834423 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703933 4:182834420-182834442 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703939 4:182834439-182834461 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703952 4:182834478-182834500 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703958 4:182834497-182834519 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703964 4:182834516-182834538 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703970 4:182834535-182834557 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703976 4:182834554-182834576 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703982 4:182834573-182834595 AGGGGAAAGGAGAAGGAGGAGGG - Intergenic
985026459 4:185743979-185744001 GGGGGACAGGAGGAGGAGGAGGG - Intronic
985100064 4:186450074-186450096 GGAAGACTGGAGAAGGAGTCTGG - Intronic
985239933 4:187919360-187919382 GGTGGAGAGGAGGAGGAGGCAGG + Intergenic
985415778 4:189734445-189734467 GATTGACTGGAGAAGGTGGCAGG - Intergenic
985851631 5:2392649-2392671 GGAGGACAGAAGAGGGAGGAAGG - Intergenic
986348903 5:6858933-6858955 GGTGGAGAGAAGAAGGAGAAGGG - Intergenic
986623730 5:9703782-9703804 GTTGGAGTGGATAAGGAGGCAGG + Intronic
986668748 5:10125540-10125562 GGTGCACAGGAGAAGGATAACGG + Intergenic
986670571 5:10139530-10139552 GGTGGAGAGCAGAGGGAGGAAGG + Intergenic
986738322 5:10683566-10683588 GGTGGACTGGAAAAAAAGAAGGG + Exonic
986793381 5:11185401-11185423 TGTGAACTGGAGAAGAAAGAAGG + Intronic
986892077 5:12320951-12320973 GCTGGGCTGAAGAGGGAGGAAGG - Intergenic
986956914 5:13162718-13162740 GTTTGACTTGAGAAGGAAGAGGG - Intergenic
987243273 5:16022967-16022989 GGTAGAGTGGAAAAGGAAGAAGG + Intergenic
987355476 5:17059880-17059902 GGTGGCATGGAGGAGGTGGATGG + Intergenic
988452476 5:31357128-31357150 CGTGGACTGAAGGTGGAGGATGG + Intergenic
988484447 5:31656954-31656976 GATACACTGGAGAAGGAGGAGGG + Intronic
988530538 5:32023336-32023358 CGTGGCTTGGAGAAGGAGGAAGG - Intronic
988999465 5:36745332-36745354 GGTGGCGGGGAGGAGGAGGAGGG + Intergenic
990315149 5:54576619-54576641 TGAGGACAGGAGAATGAGGAAGG - Intergenic
991501518 5:67281992-67282014 GGGGGAAGGGGGAAGGAGGAAGG - Intergenic
991501524 5:67282006-67282028 GGGGGAACGGAGAAGGGGGAAGG - Intergenic
991509060 5:67356741-67356763 GGGGGACTGCGGCAGGAGGATGG - Intergenic
991563954 5:67985254-67985276 GATGAAGTGGAGAAGGTGGAAGG + Intergenic
991597467 5:68320328-68320350 GCTGGGGTGGAGAAGGAGGGAGG + Intergenic
991649989 5:68842804-68842826 GGTGGCATTCAGAAGGAGGATGG - Intergenic
992206232 5:74433058-74433080 GGAGGAGTGGGGAAGGAGGTAGG + Intergenic
992591819 5:78303440-78303462 GCTGCCCTGGAGATGGAGGAAGG - Intergenic
992701348 5:79344469-79344491 AGGGGACTGGAGAAAGAGAAGGG + Intergenic
994380145 5:99061035-99061057 GGAGGACAGGATGAGGAGGATGG - Intergenic
995534482 5:113121394-113121416 GGGGGACTGGAGAGGTAGGCAGG - Intronic
996974145 5:129409803-129409825 GATGGGCTGGAGAAGAAGGTCGG + Intergenic
996976486 5:129440648-129440670 GATGGATTGGAGAGAGAGGAAGG - Intergenic
997262389 5:132475067-132475089 GGGGGTGTGGAGATGGAGGAGGG + Intronic
997396565 5:133564679-133564701 GGTGGATTTGACAAGGATGAGGG + Intronic
997654592 5:135545626-135545648 TGGGGACTGGAGAAGGGGAATGG + Intergenic
997874229 5:137534266-137534288 GCTGGAGTGGAGGAGCAGGAGGG - Intronic
998217778 5:140250298-140250320 GGTGGATTGGAGGAGCAGCATGG - Intronic
999437193 5:151571920-151571942 TGTGAACTGGAGAAGTAGCATGG - Intergenic
999658640 5:153835223-153835245 GATGGACTGGAGATAGGGGAGGG + Intergenic
999868673 5:155728438-155728460 GGAGGACTAGAACAGGAGGAGGG + Intergenic
1000192575 5:158925545-158925567 GGTGGCCAGTGGAAGGAGGAAGG - Intronic
1000357543 5:160415183-160415205 AGAGGACTGGAGAAAGAAGAAGG - Exonic
1001310684 5:170608117-170608139 GGGGGGCTGGAGAAGGATGTGGG - Intronic
1001741743 5:174058578-174058600 CCTGGAGTGGAGACGGAGGAGGG + Intronic
1001980270 5:176033471-176033493 GGTGGGCTGAAGAAGTGGGAAGG + Intronic
1002042283 5:176523483-176523505 GGGGGAGGGGAGGAGGAGGAGGG - Intergenic
1002080889 5:176736732-176736754 GGAGGACAGGAGAAGGAAGGCGG - Intergenic
1002237113 5:177810192-177810214 GGTGGGCTGAAGAAGTGGGAAGG - Intergenic
1002377476 5:178798512-178798534 GGAGGATTGGTGAAAGAGGAAGG + Intergenic
1002724316 5:181284157-181284179 GGTGGGCTGAAGAAGTGGGAAGG - Intergenic
1003030884 6:2599526-2599548 GGTGTTCTGGAGAAGCAGAACGG + Intergenic
1003244333 6:4371286-4371308 GGTGGACGGGACATGCAGGAAGG - Intergenic
1003381918 6:5632570-5632592 GGGGGAAGGGGGAAGGAGGAAGG - Intronic
1003418160 6:5931761-5931783 GGTGGGCAGGAGAGGGAGAAGGG - Intergenic
1003778691 6:9398605-9398627 GGCTGATTGGAAAAGGAGGAGGG - Intergenic
1004065883 6:12243319-12243341 GGAGGAGAGGAGGAGGAGGAGGG + Intergenic
1004305920 6:14501980-14502002 GGTGGACAGGAAGAGGAGAAGGG - Intergenic
1005086070 6:22008132-22008154 GGTGGACTGGAGAGAGAGGGAGG - Intergenic
1005469879 6:26152825-26152847 AGTGGGCTGAAGAAGGAGAAAGG - Intergenic
1005484647 6:26288154-26288176 GGTAGAGTGAACAAGGAGGAAGG + Intergenic
1006503412 6:34472780-34472802 GGAGGGCTGTAGAAGGAGTATGG + Intronic
1006509563 6:34514798-34514820 GGGTGGCTGGAGAAGGAGGCGGG + Intronic
1007100525 6:39243189-39243211 GGGGGCCTGGAGATGGAGGCTGG + Intergenic
1007176125 6:39898881-39898903 GCAGAACTGGAGAAGGAGGTGGG + Exonic
1007585735 6:42988127-42988149 TGTGGGCTGGAGTAGGGGGAAGG - Intronic
1007731999 6:43953039-43953061 GGTGCACTGGAGAAAGATAAAGG - Intergenic
1008326142 6:50184444-50184466 GGGGGAGTGGAGAAAGAGGTTGG + Intergenic
1008816881 6:55579088-55579110 GGGAGACTGGAGGAGGATGAGGG + Exonic
1008981656 6:57490311-57490333 GGTGAATTTGAGAAGGATGAAGG - Intronic
1010355237 6:74924835-74924857 GGTGGAATCAAAAAGGAGGATGG + Intergenic
1010593835 6:77741225-77741247 GGAAGGCTGGAGAAGGACGAAGG + Intronic
1011778078 6:90754287-90754309 GGTGGGCTGGGGAAGCAAGACGG + Intergenic
1011968064 6:93185225-93185247 GGTGGATATGAGAAGGAGAAGGG - Intergenic
1012900883 6:105004852-105004874 TCTGGACTGGAGCAGGAGTATGG - Intronic
1012931868 6:105325897-105325919 TCTGGACTTGAGAAGGAGGCAGG + Intronic
1012939384 6:105401564-105401586 GCTGGAATGGAGAAAGAGGCTGG - Intronic
1013317946 6:108959562-108959584 GGTGGACTTGTGCAGGAGGGAGG + Intronic
1013373557 6:109491745-109491767 GGAGGAGTGGGGAAGGAGTAAGG - Intergenic
1013639510 6:112059519-112059541 GGTCCACTGGGGAAGGAGGCAGG - Intronic
1013648706 6:112171553-112171575 GGTTGACTGGATGTGGAGGAGGG + Intronic
1015284331 6:131467930-131467952 GGAGGACGGGAGGAGGATGAGGG + Intergenic
1015316946 6:131827725-131827747 AGTGGCCTGGACAAGAAGGAGGG - Intronic
1015464627 6:133535065-133535087 GGTGTACTGGAAAAGGTAGAGGG + Intergenic
1015648664 6:135427502-135427524 GGTAGAAAGTAGAAGGAGGAGGG - Intronic
1015897425 6:138030790-138030812 GAAGGAGTGGAGAAGGAAGAAGG + Intergenic
1015898337 6:138038643-138038665 GGGGGACTGAGGCAGGAGGATGG + Intergenic
1016026135 6:139288796-139288818 AATGGCCTGGAGAAGGAAGATGG - Exonic
1016271368 6:142293961-142293983 GATGTTCTGGAGAAGAAGGAGGG - Intergenic
1016327172 6:142915804-142915826 GGTGGTCTGGAGATGGAAGTGGG - Intronic
1016765794 6:147792100-147792122 GGTGGAATGCAGAATGAGAAAGG + Intergenic
1017524591 6:155231544-155231566 CGTGGAGTGGAGAAGGAAAAGGG - Intronic
1017670754 6:156767203-156767225 GGTGGGCTGAAGCAGGAGGAGGG - Intergenic
1017949085 6:159120379-159120401 GGAGCAAAGGAGAAGGAGGAAGG - Intergenic
1018029633 6:159831707-159831729 GGCTGACTAGGGAAGGAGGAAGG + Intergenic
1018254384 6:161903953-161903975 GGTGGGCAGGAGAAACAGGAGGG + Intronic
1018471356 6:164101154-164101176 GGTGGCCTGCAGGTGGAGGAGGG - Intergenic
1018471362 6:164101175-164101197 GGGGGGCTGCAGATGGAGGAGGG - Intergenic
1018471369 6:164101195-164101217 GGGGGGCTGCAGATGGAGGAGGG - Intergenic
1018471385 6:164101236-164101258 GGTGGCCTGCAGGTGGAGGAGGG - Intergenic
1018471391 6:164101257-164101279 GGGGGGCTGCAGATGGAGGAGGG - Intergenic
1018731022 6:166650499-166650521 GCTGGAGGAGAGAAGGAGGAGGG + Intronic
1018844711 6:167547517-167547539 GATGGGGTGAAGAAGGAGGAGGG - Intergenic
1019122124 6:169811926-169811948 AGTGGGTTGGAGAGGGAGGAAGG - Intergenic
1019198046 6:170293646-170293668 GGAGAACAGGAGGAGGAGGAAGG - Intergenic
1019419158 7:942684-942706 GGAGGAAGGGAGGAGGAGGAAGG + Intronic
1019419193 7:942811-942833 GGAGGAAGGGAGGAGGAGGAAGG + Intronic
1019419246 7:943020-943042 GGAGGAAGGGAGGAGGAGGAAGG + Intronic
1019419380 7:943537-943559 GGAGGAAGGGAGGAGGAGGAAGG + Intronic
1019419445 7:943781-943803 GGAGGAAGGGAGGAGGAGGAAGG + Intronic
1019419459 7:943831-943853 GGAGGAAGGGAGGAGGAGGAAGG + Intronic
1019472538 7:1229039-1229061 GGGGGAGTAGAGAAGGAGGTGGG - Intergenic
1019608042 7:1919945-1919967 GGTGGACTGGAGGAGGGGTGTGG - Intronic
1019781181 7:2940692-2940714 GGAGGAGAGGAGGAGGAGGAAGG + Intronic
1019892002 7:3954494-3954516 GGTGTAGAGGAGAAGCAGGAGGG - Intronic
1020092579 7:5349875-5349897 GGTGGACTGGCGGGGGTGGAGGG + Intronic
1020632523 7:10656670-10656692 GGGAGACTGGAGAAGGAGGTGGG + Intergenic
1020712884 7:11630956-11630978 GGTAGAATGGAGGAGGAGTAGGG - Intronic
1021693024 7:23248332-23248354 AGTGGACTGGTGAAAGAGGGTGG - Intronic
1021806763 7:24364971-24364993 GGAGGACTGGAGGAGGTGGGAGG - Intergenic
1021973221 7:25985089-25985111 GGTGCACTGGACAGGGTGGAGGG - Intergenic
1023003721 7:35840138-35840160 GGGGGAAGGGGGAAGGAGGAAGG - Intronic
1023192492 7:37597681-37597703 GGTGGACTGGGAAAGTAGGAAGG + Intergenic
1023426695 7:40044421-40044443 GGGGGACTGAAGTAGGAGGATGG - Intronic
1024228851 7:47348719-47348741 TTTGATCTGGAGAAGGAGGATGG + Intronic
1024529206 7:50376820-50376842 AGTGGCCTGGAGAAGGTGCATGG + Intronic
1025120137 7:56294801-56294823 GGTGGATGGATGAAGGAGGATGG + Intergenic
1025212220 7:57026270-57026292 GGTGAGCTGCAGAGGGAGGATGG + Intergenic
1025659734 7:63550558-63550580 GGTGAGCTGCAGAGGGAGGATGG - Intergenic
1025945110 7:66099274-66099296 GGAGGAGGGGAGGAGGAGGAGGG + Intronic
1025945138 7:66099349-66099371 GGAGGAGGGGAGGAGGAGGAGGG + Intronic
1026205670 7:68255321-68255343 GGAGGAGGGGAGAAGGAGGAGGG - Intergenic
1026306860 7:69150023-69150045 GGAGGGTTGGAGAGGGAGGAGGG - Intergenic
1026814689 7:73501372-73501394 GTTGGACTACAGAAGGAGGGAGG - Intronic
1027132250 7:75599331-75599353 GGTTGGCTGGAGGAGGAGAAAGG - Intronic
1027941410 7:84685723-84685745 ACTGGAGTGGAGAAGGAGAATGG + Intergenic
1028112034 7:86952263-86952285 AGTAGACTGGTGAGGGAGGAAGG + Intronic
1029160832 7:98550645-98550667 CATGGTCTGGAGGAGGAGGAAGG + Intergenic
1029455394 7:100668190-100668212 GGTGGACTGGATAAAGAAAATGG + Intergenic
1029675399 7:102065036-102065058 GGTGAGCTGCAGAGGGAGGATGG + Intronic
1030079848 7:105767854-105767876 GGTGGACTGGAGAAGGAGGAAGG - Intronic
1030108846 7:106009400-106009422 GTTGGACTGGAGAAGGTATAAGG - Intronic
1030299707 7:107962867-107962889 AGTGGACTGGTGGAGGAGGGAGG - Intronic
1031039084 7:116819759-116819781 GGAAGACTGGTGAAGGGGGAGGG - Intronic
1031488906 7:122363990-122364012 GGCAGACGGCAGAAGGAGGAAGG + Intronic
1031827073 7:126578633-126578655 GGTGTACTCTAGAAGGATGAGGG + Intronic
1032155240 7:129462571-129462593 TATGGACTGGAGAAACAGGAAGG - Intronic
1032387377 7:131534084-131534106 GGAGGAGTGGAGGAGGAGGTGGG - Intronic
1032459979 7:132103092-132103114 GTTGCCCTGGAGACGGAGGACGG + Intergenic
1032548997 7:132766886-132766908 GGTGAGCTGCAGCAGGAGGAGGG + Intergenic
1032614521 7:133452538-133452560 GGTTGACTGGAGCATGAGGATGG - Intronic
1032715651 7:134506969-134506991 GGTGGACTGCAGAGGGAAGCTGG + Intergenic
1033425861 7:141243622-141243644 GCTGGATTTGAGAAGGAGGAAGG - Intronic
1034384967 7:150733363-150733385 GGTTGACTGGAGGTGGAGAAGGG - Intronic
1034455890 7:151169570-151169592 GGTGGACTGAGGAAGGGGGCAGG + Intronic
1034933354 7:155181967-155181989 CGTGGAGTGGTGAGGGAGGAAGG - Intergenic
1034973833 7:155436559-155436581 GGTGGACAGGAGTGGAAGGAGGG - Intergenic
1035111568 7:156486632-156486654 GGTGGAGGGGAGAAGGGGGTGGG - Intergenic
1035212466 7:157338278-157338300 GGTGGACTGGCGGAGGAGTAAGG - Intronic
1035646926 8:1231598-1231620 GGTGGACTGGATAAAGAAAATGG + Intergenic
1035657411 8:1320391-1320413 GCCGGACCGGAGGAGGAGGACGG + Intergenic
1035776308 8:2191297-2191319 GGAGGAAGGGAGGAGGAGGAAGG - Intergenic
1035966920 8:4202876-4202898 GGTGTCCTGGAGAAGGGGCATGG + Intronic
1036111821 8:5911135-5911157 CATGGAGTGGAGAGGGAGGAAGG + Intergenic
1036763847 8:11533610-11533632 GGAGGAGAGGAGTAGGAGGAGGG + Intronic
1037096516 8:14992957-14992979 GGTAGATTGAAGGAGGAGGATGG - Intronic
1037152583 8:15655844-15655866 GGTGGTTTGGGGAAGAAGGAAGG - Intronic
1037598393 8:20373584-20373606 GGGGAAGTGGGGAAGGAGGAGGG + Intergenic
1037779009 8:21855068-21855090 AGTGGTCTGGAGCAGGAGGTGGG - Intergenic
1037806081 8:22058559-22058581 GGTGGGCTAGAGAGGCAGGAGGG + Intronic
1037818147 8:22122620-22122642 GGTGGGCAGGAGAGGGAGGTTGG + Intronic
1037838533 8:22228532-22228554 GGGAGGCTGGAGAAGGATGATGG + Intronic
1037985668 8:23289109-23289131 GGAGGGCTGGAAGAGGAGGACGG + Exonic
1038007394 8:23444366-23444388 GATGGAGAGGAGAAGGAGGAAGG + Intronic
1038034082 8:23672303-23672325 GGAGCAAAGGAGAAGGAGGAGGG - Intergenic
1038503447 8:28064053-28064075 GGTGAATGGGAGAAGGAGCATGG - Intronic
1038775668 8:30528379-30528401 GGTGGACAGGACATGTAGGATGG + Intronic
1038842454 8:31197755-31197777 GGGGGAGGGGAGAAGGAGGCAGG - Intergenic
1038929578 8:32177968-32177990 GGAGGATTGTTGAAGGAGGAGGG + Intronic
1039280059 8:35974775-35974797 AGTGGACTGGAGAAGGCAGAGGG - Intergenic
1039450920 8:37674540-37674562 GGTGGAGAGGAGGGGGAGGAAGG - Intergenic
1039547511 8:38420685-38420707 GGAGGCCTGTGGAAGGAGGAGGG - Intronic
1039805140 8:40991320-40991342 TGAGGCCTGGAGAAGGAGGTTGG + Intergenic
1039952608 8:42183593-42183615 GATGGGCTTGGGAAGGAGGAGGG + Intronic
1040071935 8:43195648-43195670 GAGGGGCTGGAGGAGGAGGAGGG + Intronic
1040124408 8:43720664-43720686 GGTAGAATGGTGAAGGAGTAGGG + Intergenic
1040483432 8:47848252-47848274 GGTGGACTGGATAAAGAAAATGG + Intronic
1040520592 8:48172958-48172980 GGTGGACAGGAGGAAGAGGGTGG - Intergenic
1040534105 8:48290982-48291004 GGTGCACAGGGGAAGGAGGAGGG - Intergenic
1040836554 8:51737670-51737692 GGTGAACTGGAGGAGCAGGCAGG - Intronic
1042352069 8:67787459-67787481 GGTGGAAGGGAGGAGGAGAAAGG + Intergenic
1043296382 8:78668151-78668173 GGGAGAGGGGAGAAGGAGGAAGG - Intronic
1043461818 8:80468008-80468030 GGTGAAGTGGAGAAGAAAGATGG - Intergenic
1043531046 8:81150243-81150265 GGTAAGCTGGAGGAGGAGGAAGG + Intergenic
1043917598 8:85940556-85940578 GAAGGGCTGGAGAAGGAGGAAGG + Intergenic
1044374033 8:91448399-91448421 GGGAGAATGGAGAAGGAGAAGGG - Intergenic
1044776466 8:95693878-95693900 GGCGGACTGCAGAGGGAGGAGGG - Intergenic
1045013990 8:97982912-97982934 TGTGGTCTGGAGAGGCAGGAAGG - Intronic
1045650623 8:104338843-104338865 CGTGAACTGGAGTGGGAGGAGGG - Intronic
1045743413 8:105387797-105387819 GGAGGACTCGAGAACGAGCAAGG + Intronic
1046098703 8:109590040-109590062 GGATGGGTGGAGAAGGAGGATGG - Intronic
1046351530 8:113020809-113020831 GGGGAACAGTAGAAGGAGGATGG + Intronic
1046494778 8:114999018-114999040 GGTAGAGTGAAGAAGGAAGAAGG - Intergenic
1047343915 8:124009209-124009231 GCTGGAGTGCAGAAGGAGGATGG - Intronic
1047742019 8:127814199-127814221 AAGGGGCTGGAGAAGGAGGATGG - Intergenic
1047907008 8:129483149-129483171 GGGGGAAGGGGGAAGGAGGAAGG + Intergenic
1047907030 8:129483199-129483221 GGAGGAAGGGAGAAGGGGGAAGG + Intergenic
1048199867 8:132363440-132363462 GGTGGTGTGGCAAAGGAGGAAGG + Intronic
1048383119 8:133885850-133885872 GAGAGACTGGAGAAGGAGGGAGG + Intergenic
1048838960 8:138547841-138547863 GCTTGGCTGGAGAGGGAGGAAGG + Intergenic
1049001211 8:139826557-139826579 GGTGGAGTGGGGCAGCAGGAGGG + Intronic
1049121988 8:140747553-140747575 GGGGAACGGGAGGAGGAGGAAGG + Intronic
1049239071 8:141527739-141527761 GGTGGATTGGAGCAGCAGGCAGG + Intergenic
1049408137 8:142460733-142460755 TCTGGCCTGGAGAGGGAGGAGGG - Intronic
1050131779 9:2420465-2420487 GGTGAACTGAAGAAGTAGAAAGG - Intergenic
1050184826 9:2962165-2962187 GGTGGCGTGGAGAAGGAGGACGG - Intergenic
1050246735 9:3697800-3697822 GAAGGACGGGAGAAGCAGGAGGG + Intergenic
1050501703 9:6304969-6304991 GGAGAACTTGAGTAGGAGGAGGG + Intergenic
1050517617 9:6461372-6461394 GGGGGAGGAGAGAAGGAGGAGGG - Intronic
1050794766 9:9524282-9524304 GAGAGACTGGAGAGGGAGGAAGG - Intronic
1051365342 9:16317702-16317724 GGTGGACCCAAGAAGAAGGAAGG + Intergenic
1051525291 9:18036216-18036238 GCTGGACTATAGAAAGAGGAAGG + Intergenic
1052483950 9:29071294-29071316 GGGAGACTGAAGAAGGAGGATGG - Intergenic
1052736699 9:32349791-32349813 GGAGGTCTGGAACAGGAGGAAGG + Intergenic
1052736886 9:32351994-32352016 GGGAGACTGGAGGAGGAAGAGGG - Intergenic
1053026213 9:34730463-34730485 GGTGGGCTGGATACTGAGGAAGG - Intergenic
1053096552 9:35333545-35333567 GATGAAAGGGAGAAGGAGGAAGG - Intronic
1053233815 9:36434317-36434339 GGGGGATGGGGGAAGGAGGAGGG + Intronic
1053434014 9:38063377-38063399 GGGAGACTGCAGAAGGAGGTTGG - Intronic
1053886449 9:42647589-42647611 GGTGGGCTGAAGAAGTGGGAAGG - Intergenic
1054225468 9:62455038-62455060 GGTGGGCTGAAGAAGTGGGAAGG - Intergenic
1054820058 9:69513372-69513394 GGTGCACTGGAGAAAGCTGAAGG + Intronic
1054877166 9:70109019-70109041 TGTGGACTGGATAAGGAAGGAGG + Intronic
1054961472 9:70974970-70974992 GGGAGACTGAGGAAGGAGGATGG - Intronic
1055100859 9:72463804-72463826 GGTGTACTTGAGAGGGAGGGTGG + Intergenic
1055423277 9:76166454-76166476 GGTGGACAGGAAAGGGTGGAAGG + Intronic
1055956186 9:81775827-81775849 GGAGGAGGGGAGGAGGAGGATGG - Intergenic
1056534609 9:87516790-87516812 GGTGGATTGGAGAAGCTTGAAGG + Intronic
1056917536 9:90758253-90758275 GAGGGCCCGGAGAAGGAGGAAGG - Intergenic
1057007445 9:91573122-91573144 GTGAGACAGGAGAAGGAGGAAGG + Intronic
1057203168 9:93154492-93154514 GGGGCACTGTAGGAGGAGGAAGG + Intergenic
1057226654 9:93296431-93296453 GGGAGGATGGAGAAGGAGGAAGG - Intronic
1058069276 9:100585199-100585221 GAGGGAATGAAGAAGGAGGAGGG + Intronic
1058726209 9:107807054-107807076 GGTGGACTGCAGCAGAAGGCAGG - Intergenic
1058905494 9:109479196-109479218 GGTGGCCAGGAGTTGGAGGAGGG - Intronic
1059149252 9:111933808-111933830 GGTGGGCTGGGGGAGGAGCAAGG - Exonic
1059327768 9:113514688-113514710 GGAGGAACGGAGAAAGAGGAGGG + Intronic
1059331552 9:113538781-113538803 GCTGGACAGGAGAAGGATGAAGG + Intronic
1059345637 9:113625971-113625993 GGAGGCATGGAGAAGGATGAAGG + Intergenic
1059350635 9:113662460-113662482 GGGGGGCAGGAGAAGGAGGCAGG - Intergenic
1059650258 9:116309619-116309641 GGAGGACAGGAGAGGGAGGACGG + Intronic
1060266011 9:122111839-122111861 GGAGGACTGGCCAAGAAGGATGG - Intergenic
1060376381 9:123118274-123118296 AGTGGACTGAAGGAGTAGGAAGG - Intronic
1061086964 9:128405106-128405128 TGTGGCCAGGGGAAGGAGGAGGG - Intergenic
1061214865 9:129215874-129215896 GGAGGACAGGAGAAGAACGAGGG - Intergenic
1061262275 9:129486947-129486969 GCTGGACGTGAGAGGGAGGACGG + Intergenic
1061374492 9:130215939-130215961 GGTTGAGGGGAGGAGGAGGATGG - Intronic
1061841328 9:133359996-133360018 GGTGCACCGGAGGAGGAGGAGGG + Exonic
1061967613 9:134025184-134025206 GAGGGGCTGGAGGAGGAGGAGGG - Intergenic
1061967640 9:134025266-134025288 GAGGGGCTGGAGGAGGAGGAGGG - Intergenic
1062425910 9:136506068-136506090 GGGGGTCGGGAGATGGAGGAAGG + Intronic
1203377274 Un_KI270442v1:385647-385669 GCTGGGCTGGAGCAGGGGGATGG + Intergenic
1185575475 X:1168971-1168993 GGAGGAGGGGAGAAGGAGGAAGG + Intergenic
1185652362 X:1657715-1657737 GGTGAACAGAGGAAGGAGGAAGG - Intergenic
1185684366 X:1915728-1915750 GGTGGACTGGATAAAGAAAAGGG + Intergenic
1185695183 X:2188723-2188745 GGGGGAGTGGGGATGGAGGAGGG + Intergenic
1185887121 X:3792732-3792754 GGAGGAGGGGAGGAGGAGGAAGG + Intergenic
1186294610 X:8134995-8135017 GGTGGAGTGTTGGAGGAGGAAGG + Intergenic
1187287830 X:17923045-17923067 GATGGTCTGGAGGAGGTGGAAGG + Intergenic
1188518394 X:31011872-31011894 GTTGGGCAGGAGAAGGAGGCAGG + Intergenic
1189436019 X:40993409-40993431 GGTGGGGTGGGGCAGGAGGAGGG - Intergenic
1189532760 X:41903274-41903296 GGGAGACGGCAGAAGGAGGAAGG + Intronic
1190037927 X:47042974-47042996 AGTTGCCTGGAGATGGAGGAGGG - Intronic
1190441076 X:50474908-50474930 GGTGTCCTGGGGAAGGAGAAAGG + Intergenic
1190552546 X:51599684-51599706 GATGGACTGGAGAGGGAAAAGGG - Intergenic
1191054986 X:56232316-56232338 GGTGGGGCTGAGAAGGAGGAGGG - Intergenic
1191762105 X:64657068-64657090 GGTGGTATGGAGAGGGAGAATGG - Intergenic
1192095375 X:68205107-68205129 GGCGGACTGGAAACTGAGGAGGG + Intronic
1192141503 X:68650460-68650482 GGAGGAGGGGAGGAGGAGGAGGG + Intronic
1192261817 X:69510242-69510264 GGAGGGCTGGGGAAGGAGGTTGG + Intronic
1193295312 X:79826230-79826252 AGTGTACTGGTGAATGAGGATGG - Intergenic
1194152540 X:90343643-90343665 GGTGAATTAGATAAGGAGGAGGG + Intergenic
1195129822 X:101840955-101840977 GGTGGAAGGGATAAGGTGGAGGG - Intronic
1195176414 X:102318868-102318890 GGTGGAAGGGATAAGGTGGAGGG + Intronic
1195182450 X:102368225-102368247 GGTGGAAGGGATAAGGTGGAGGG - Intronic
1195667092 X:107441281-107441303 GGTGGACTGGAAGTGGAGGTGGG + Intergenic
1196058100 X:111377779-111377801 GGAGGAAGGAAGAAGGAGGAAGG - Intronic
1196861223 X:120029164-120029186 GATGGACGGGAGAAAGAGGGTGG - Intergenic
1197433302 X:126393522-126393544 GGTCCACAGAAGAAGGAGGAAGG + Intergenic
1197782479 X:130171845-130171867 GGTGCGCTGGAGGAGGAGGAGGG + Exonic
1198214807 X:134546027-134546049 GGAGGACTGGAAAAGGAGTAAGG - Intergenic
1198218007 X:134574415-134574437 GGTAGACTAGAGAAGGAGTGGGG - Intronic
1198622492 X:138529621-138529643 GCTAGACTGGTGAAGGAAGAAGG + Intergenic
1199361470 X:146924420-146924442 TGGGGACTTCAGAAGGAGGAGGG - Intergenic
1200072844 X:153537523-153537545 GGAGGAGTGAAGATGGAGGAGGG + Intronic
1200090236 X:153632651-153632673 GGGGGACAGGGGCAGGAGGAGGG - Intergenic
1200154963 X:153970437-153970459 GGAGGAGGGGAGAAGGGGGAGGG + Intronic
1201461738 Y:14233022-14233044 GGGGGAGGGGAGAGGGAGGAGGG - Intergenic
1201620773 Y:15954764-15954786 GGTGACCTGGAGAAGGAGTGTGG + Intergenic
1201625598 Y:16011705-16011727 GGAGGAAGGGAGAAAGAGGAAGG + Intergenic
1202588762 Y:26460067-26460089 GGTGGATTGGATAAGGAAAATGG - Intergenic