ID: 1030079849

View in Genome Browser
Species Human (GRCh38)
Location 7:105767858-105767880
Sequence GAGGGGTGGACTGGAGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 832
Summary {0: 1, 1: 0, 2: 4, 3: 81, 4: 746}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030079849_1030079854 -9 Left 1030079849 7:105767858-105767880 CCTCCTTCTCCAGTCCACCCCTC 0: 1
1: 0
2: 4
3: 81
4: 746
Right 1030079854 7:105767872-105767894 CCACCCCTCTGGAGTTCGACTGG No data
1030079849_1030079860 4 Left 1030079849 7:105767858-105767880 CCTCCTTCTCCAGTCCACCCCTC 0: 1
1: 0
2: 4
3: 81
4: 746
Right 1030079860 7:105767885-105767907 GTTCGACTGGTACTCAGGGCTGG No data
1030079849_1030079859 0 Left 1030079849 7:105767858-105767880 CCTCCTTCTCCAGTCCACCCCTC 0: 1
1: 0
2: 4
3: 81
4: 746
Right 1030079859 7:105767881-105767903 TGGAGTTCGACTGGTACTCAGGG No data
1030079849_1030079858 -1 Left 1030079849 7:105767858-105767880 CCTCCTTCTCCAGTCCACCCCTC 0: 1
1: 0
2: 4
3: 81
4: 746
Right 1030079858 7:105767880-105767902 CTGGAGTTCGACTGGTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030079849 Original CRISPR GAGGGGTGGACTGGAGAAGG AGG (reversed) Intronic
900350177 1:2230554-2230576 GAGGGGTGCGCCGGAGAGGGAGG + Intronic
900427299 1:2586577-2586599 GAGGCTTGGCCTGGAGTAGGAGG + Intronic
900431688 1:2605808-2605830 CTGGGCTGGACTGGAGAGGGTGG + Intronic
900476215 1:2877578-2877600 GCGGAGTGGCCTGGAGCAGGCGG + Intergenic
901103319 1:6736211-6736233 GAGGAGTGGAGAGGAGAAGGAGG - Intergenic
901167259 1:7229528-7229550 GAGGGGAGGATTGGAGGATGGGG + Intronic
901464754 1:9413898-9413920 GGAGGCTGGACTGGAGAAGTTGG + Intergenic
901860292 1:12070021-12070043 GAGGGGTGGTTAGGAGAAGGTGG + Intronic
902571962 1:17352681-17352703 GAGGGGAGGACTGTGGGAGGAGG + Intronic
902973266 1:20070521-20070543 GAGGGAGAGACTGGAGAAGGGGG + Intronic
902988672 1:20171171-20171193 GGAGAGGGGACTGGAGAAGGTGG - Intronic
903041406 1:20533387-20533409 GAGGGGTGGACTAGAGGATGAGG + Intergenic
904201021 1:28819030-28819052 GAGGGGTGGATTGGATGGGGAGG + Intronic
904277498 1:29393943-29393965 GAAGGGAGGAAGGGAGAAGGAGG - Intergenic
904298855 1:29541359-29541381 GTGGGGTGGAGTGGGGAAGCGGG + Intergenic
904373684 1:30066380-30066402 GTGGGGTGGAGTGGAGAGGAGGG - Intergenic
904400327 1:30252535-30252557 ATGGGGTCGCCTGGAGAAGGAGG + Intergenic
904476630 1:30769254-30769276 GAGACGTGGCCTGGAGAAGCAGG - Intergenic
905472538 1:38204365-38204387 GAGAGGGGGAGTGGAGAAGTGGG + Intergenic
905484116 1:38283753-38283775 CAGGGATGGACGGGAGACGGTGG - Intergenic
905707696 1:40074409-40074431 GCGGGGGGGACAGGAGGAGGGGG - Intronic
905896028 1:41546258-41546280 GAGGACTGTAGTGGAGAAGGCGG + Intronic
905941384 1:41866234-41866256 GAGTGGTGGCCTGGGGAAAGGGG - Intronic
906061716 1:42953365-42953387 GAGGGGTGGACTGGAGCCTGAGG - Intronic
906318141 1:44800969-44800991 GAGGGGTGGGGTGGGGACGGTGG + Intronic
906431699 1:45760529-45760551 GAGGGTTAGGCGGGAGAAGGTGG + Intergenic
907145135 1:52224351-52224373 GAGGGGTAGGCAGGGGAAGGTGG + Intronic
907255138 1:53173421-53173443 GAGGGGAGGAGAGGAGAGGGAGG - Intergenic
907520713 1:55021726-55021748 GAGGGGAGGAGAGGAGAGGGTGG + Intergenic
907804761 1:57807122-57807144 GGAGAATGGACTGGAGAAGGTGG - Intronic
908245057 1:62221342-62221364 TAAGGGTGGGGTGGAGAAGGAGG - Intergenic
908794743 1:67819920-67819942 GAGAGATGGACTGGGGATGGAGG - Intronic
909109529 1:71457156-71457178 GTGGGGTGGGGTGGAGAATGTGG - Intronic
909433590 1:75616220-75616242 GAGGGAGGGTGTGGAGAAGGGGG - Intergenic
909561802 1:77016073-77016095 AGGGGGAGGAGTGGAGAAGGAGG - Intronic
910432692 1:87174692-87174714 GTGGGGAGGTCTGGAGAAGCAGG + Intergenic
912314464 1:108654420-108654442 GAGGGGTGAACAGGAGAGGGAGG + Intronic
912344204 1:108949201-108949223 GAGGCCTGGAATGGAGAAGGGGG - Intronic
913048670 1:115095879-115095901 TAGGGGTGGACTGGGTAAGCTGG + Intergenic
913056017 1:115160081-115160103 GAGGGGAGGGCAGGGGAAGGGGG + Intergenic
913180545 1:116316937-116316959 CAGGAGTGGGCTGGAGAGGGAGG - Intergenic
914048790 1:144114451-144114473 GTGGGGTGTCCTGGAGAAGCAGG - Intergenic
914130394 1:144850997-144851019 GTGGGGTGTCCTGGAGAAGCAGG + Intergenic
914675695 1:149905817-149905839 GAGGGGTGGGGTGAGGAAGGAGG - Intronic
914713802 1:150237790-150237812 GTGGGGTGGAGTAGGGAAGGTGG - Intergenic
914815582 1:151059764-151059786 GCGGGGAGAACTGGAGAATGCGG + Exonic
915328155 1:155091993-155092015 GAGGCGTGGACTGGAGGTGGTGG + Intergenic
915333815 1:155129269-155129291 CAGGTGTTGACTGGAGGAGGAGG + Intronic
915351196 1:155227451-155227473 GTGGGCGGGACTGGAGAATGGGG + Intergenic
915468957 1:156114535-156114557 TAGGGGTGCGCTGGAGAGGGTGG + Intronic
915529751 1:156496561-156496583 GAAGGGCTGACTGGAGCAGGAGG - Intronic
915570902 1:156744561-156744583 GGGGGGAGGGCTGGAGCAGGAGG + Intronic
915973069 1:160367464-160367486 AAGGGGAGGAGTGGAGAAGAGGG - Intronic
916141514 1:161703602-161703624 TAGTGGTTGCCTGGAGAAGGTGG + Intergenic
916875471 1:168964054-168964076 GAGGGGTGGGCAGGAGGGGGTGG - Intergenic
917129901 1:171730546-171730568 GAGGAGTGGAATGGAGGAAGGGG + Intronic
917727253 1:177839587-177839609 TCGGGGTGGAGAGGAGAAGGTGG - Intergenic
917779031 1:178371553-178371575 GGGGGGAGGAATGGAGGAGGAGG + Intronic
917896425 1:179492644-179492666 GAGGGATGGAAGGGAGAAGGAGG + Intronic
918387091 1:184020499-184020521 GAGGGGAGGAATGGAGAAAGGGG - Intronic
918857755 1:189780669-189780691 GAGGGATGGAGGGAAGAAGGAGG + Intergenic
919058071 1:192595425-192595447 GAGGGGTGGGGAGGAGGAGGAGG + Intergenic
919742737 1:200990537-200990559 GAGGGGTGGAATGGAAGAGAAGG + Intronic
919923947 1:202182668-202182690 AAGGTGGGAACTGGAGAAGGTGG - Intergenic
919923951 1:202182684-202182706 AAGGTGGGAACTGGAGAAGGTGG - Intergenic
920611599 1:207444688-207444710 GTGGGGTGGTCTGGAGGATGGGG - Intergenic
921007904 1:211112290-211112312 GAGGGGTGGAGGGGTGGAGGGGG - Intronic
922121329 1:222672275-222672297 GTGATGTGGACGGGAGAAGGTGG - Intronic
922314673 1:224433299-224433321 GAGGGGTGGATTAGAGCTGGTGG - Intronic
922967731 1:229705747-229705769 GAGGAGTTGACTGGAGCAGCTGG + Intergenic
923268505 1:232334699-232334721 AAGGGGAGGACAGAAGAAGGAGG - Intergenic
923268558 1:232334915-232334937 GAGGATTGGGATGGAGAAGGTGG - Intergenic
923854386 1:237829905-237829927 GAGGCGTGGTCCAGAGAAGGTGG + Intronic
924043151 1:240003281-240003303 GAGGGATGAACTGTAGAAGCTGG + Intergenic
924413099 1:243827293-243827315 GAGAAGTGGAATGGAGAATGAGG - Intronic
1063603312 10:7501159-7501181 GAGGAGTGGAGTGGAGTCGGTGG + Intergenic
1065323096 10:24526849-24526871 GAGGGTTAGAATGGTGAAGGTGG + Intronic
1067456874 10:46425457-46425479 GAGGTAGGGACTGGAAAAGGAGG - Intergenic
1067810856 10:49426082-49426104 GAGGGGGCGTCTGGAGAGGGGGG + Intergenic
1069706172 10:70460179-70460201 GAGGGGAGGCCTGGGGCAGGGGG - Intergenic
1069756574 10:70777396-70777418 GAGGGGAGGAGAGGAGCAGGAGG + Intronic
1070484162 10:76913710-76913732 GAGGAGTAGAAGGGAGAAGGCGG + Intronic
1070486049 10:76932797-76932819 CAGCGGTAGACTGGAGCAGGAGG - Intronic
1070658241 10:78285898-78285920 GAAGGGAGGAGTGGAGAGGGAGG - Intergenic
1070949322 10:80418461-80418483 GAGGGGTGCACTGCATGAGGTGG - Intronic
1071294023 10:84206303-84206325 GATGGGCAGCCTGGAGAAGGAGG + Intronic
1071753536 10:88509477-88509499 GAGGGGAGGAGAGGAGGAGGGGG + Intronic
1071944393 10:90625619-90625641 GAGGGGAGAGCTGGAGATGGGGG + Intergenic
1072199438 10:93145110-93145132 GATGGGTGGTCAGGAGAGGGTGG + Intergenic
1072534281 10:96349242-96349264 GAGGGGTGGATTGGATGGGGAGG + Intronic
1073249296 10:102111958-102111980 GAGTGGTGGACTAGGGGAGGGGG + Intronic
1073266240 10:102230232-102230254 GAGGGGAAGCCTGGAGAAGGCGG + Exonic
1073964117 10:108968576-108968598 GAGGAGTGGAACAGAGAAGGGGG + Intergenic
1074054121 10:109906797-109906819 GAGGGATGGGGTGGAGGAGGAGG - Intronic
1075386109 10:122056615-122056637 GAGAGCTGGAGTGGACAAGGAGG + Intronic
1076638078 10:131895931-131895953 GGGGGATGGACTGGAGAGAGTGG - Intergenic
1076732776 10:132446720-132446742 GTGGGGTGGGCAGGAGGAGGTGG + Intronic
1077095068 11:795750-795772 GAGGGGTGGAGGGGAGGAAGGGG - Intronic
1077277371 11:1720103-1720125 GAGGGGTGGAGTGGACATGTGGG + Intergenic
1077443114 11:2577897-2577919 GGGGGGTGGCCTGGGAAAGGGGG - Intronic
1077851121 11:6075212-6075234 GAAGAGTGGAAAGGAGAAGGTGG + Intergenic
1078386577 11:10898354-10898376 GAGGGCTGGAGAGGAGGAGGAGG + Intergenic
1078534215 11:12160339-12160361 CAGCAGTGGACTGGAGGAGGAGG - Intronic
1078629122 11:12985862-12985884 AAGGGGTGGACTGGACCAGATGG + Intergenic
1078699904 11:13669732-13669754 GAGGGGTGGAGTGTAGGAGGAGG - Intronic
1079240198 11:18717046-18717068 GAGGGGTGGAGTGGTGAAGAGGG + Intronic
1079333443 11:19551874-19551896 GAGGAGAGGAGAGGAGAAGGAGG - Intronic
1081651799 11:44828796-44828818 GAGGGCTGGAGTGAAGCAGGGGG - Intronic
1081694981 11:45103321-45103343 AATGGGGGGACTGGTGAAGGAGG + Intronic
1081755905 11:45544291-45544313 TAGGGCAGGACTGGGGAAGGAGG - Intergenic
1081779321 11:45699076-45699098 GAGAAGTGAGCTGGAGAAGGTGG - Intergenic
1082080121 11:48006322-48006344 GAGAGGTGGAGTGGGAAAGGAGG + Intronic
1082218735 11:49606191-49606213 GAGGGAGGCACTGGAGAAAGAGG + Intergenic
1082959357 11:58904206-58904228 GAGGTGTGGAAGGGAGAAGATGG - Intronic
1082966093 11:58967410-58967432 GAGATGTGGAAGGGAGAAGGCGG - Intronic
1083266718 11:61550337-61550359 GAGGAGTGGAGAAGAGAAGGTGG + Intronic
1083298930 11:61730236-61730258 GAGGAGTGGGAGGGAGAAGGTGG - Intronic
1083729099 11:64643361-64643383 GAGGGGGGGGCGGGAGAAGGGGG + Intronic
1083729142 11:64643534-64643556 GAGGGCTGGAAGGGAGAGGGAGG + Intronic
1084162676 11:67358469-67358491 GAGGGACAGACTGGAGAAGAGGG - Intronic
1084178800 11:67436633-67436655 GAGGGGAGGATGGGAGGAGGTGG - Intronic
1084470434 11:69356241-69356263 GAGGGAGGGAGAGGAGAAGGAGG + Intronic
1084729567 11:71064670-71064692 GAGGGGTGGAGGGGACAAGAGGG + Intronic
1084889225 11:72228564-72228586 GAGAGGTGGGGTTGAGAAGGGGG - Intronic
1084949728 11:72657970-72657992 GAGGGGTGGAGGGAAGAGGGAGG + Intronic
1085061424 11:73450656-73450678 GGGGAGGGGAGTGGAGAAGGGGG - Intronic
1085196164 11:74673086-74673108 GAGAGGTGGAGGGGAGAGGGTGG - Intergenic
1086061979 11:82709099-82709121 GAGGTTTGAACTGGAGAAGCTGG - Intergenic
1086504706 11:87493286-87493308 GAGGAGTGGACAGGAGGAGTGGG + Intergenic
1086630840 11:89017931-89017953 GAGGGAGGTACTGGAGAAAGAGG - Intronic
1087013543 11:93535072-93535094 GAGGCGTGGATTGGAGACTGGGG - Intronic
1087772114 11:102222163-102222185 GAGGTGAGGGCTGGAGATGGTGG + Intronic
1088741334 11:112769776-112769798 GAGAGGTGGGCTGGAGAGGCAGG - Intergenic
1088744382 11:112793324-112793346 GAGGGCTGGAATGGAGCAGAAGG + Intergenic
1089315574 11:117588815-117588837 GAGGGGTGGCTTAGAGGAGGGGG - Intronic
1089377799 11:118007094-118007116 GGGGTGGGGAGTGGAGAAGGAGG - Intergenic
1089504342 11:118953606-118953628 GAGGGCTGGGGTGGGGAAGGTGG + Intronic
1089514037 11:119020276-119020298 GAGGAGTGTGATGGAGAAGGTGG + Intronic
1089514049 11:119020338-119020360 GAGGAGTGTGGTGGAGAAGGTGG + Intronic
1089528636 11:119112740-119112762 GGGGCGTGGAGTGGAGGAGGTGG - Exonic
1089606479 11:119644385-119644407 GGGGGGTGGTCGGGAGAAGCAGG - Intronic
1089696082 11:120217075-120217097 GGGAGGTGGAGGGGAGAAGGAGG + Intronic
1089770963 11:120802615-120802637 CAGGGGGAGGCTGGAGAAGGAGG + Intronic
1090074043 11:123568236-123568258 GAGGGGCGGAGTGCAGAAGGAGG + Intronic
1090887587 11:130892898-130892920 GAGAGGTGGGGTGGGGAAGGGGG + Intronic
1090958155 11:131532228-131532250 GAGGAGTGGGGTGGAGAATGGGG - Intronic
1091070518 11:132558420-132558442 GAGGGGAGGAGGGGAGGAGGAGG - Intronic
1091618485 12:2067649-2067671 GATGGGAGGACTGGTGGAGGTGG + Intronic
1091875761 12:3931694-3931716 GAGGGGTGGGCTGGGGGTGGGGG - Intergenic
1092257261 12:6934184-6934206 GAGGAGTGGACGGAAGAAAGAGG + Exonic
1092263761 12:6965854-6965876 GAGGCGGGTACTGGAGAAGGTGG + Intronic
1092644214 12:10551583-10551605 CAGGGGTGTCCTGGAGATGGAGG + Intergenic
1092912540 12:13160285-13160307 TAGGGAGGGACAGGAGAAGGCGG - Intergenic
1093377006 12:18441586-18441608 GAAGAGTGGACTGGAACAGGCGG + Intronic
1094424138 12:30301371-30301393 GAGGGGTGGAATGAGGAAAGGGG + Intergenic
1094765420 12:33588858-33588880 GAGTGGTGGACTGGTGGGGGTGG + Intergenic
1095787469 12:46125470-46125492 GAGGGGAGGAGAGGAGAAAGAGG + Intergenic
1095870390 12:47020274-47020296 GAGGGTAGGACTGGAAAATGAGG + Intergenic
1096002503 12:48141338-48141360 GGGGGCTGGACTGGCCAAGGTGG + Exonic
1096670974 12:53198046-53198068 AAGGAGTGGACTGGAGGTGGGGG - Intronic
1096678848 12:53241754-53241776 AAGGGGAGGGCTGGAAAAGGAGG + Intergenic
1096699261 12:53371504-53371526 GAGGGCCGGGCTGGAGGAGGAGG - Intergenic
1097158501 12:57029392-57029414 AAGCCTTGGACTGGAGAAGGTGG - Intronic
1097237230 12:57548920-57548942 GCAGGGTGGATGGGAGAAGGAGG - Intergenic
1097316621 12:58178125-58178147 GAGCAGAGGACTGTAGAAGGTGG + Intergenic
1097834116 12:64256574-64256596 GAGGGTGGGACGGAAGAAGGAGG - Intergenic
1098202525 12:68071018-68071040 GAGGTGTGGTGTCGAGAAGGAGG - Intergenic
1099121915 12:78700754-78700776 GAGGGGAGGAGAGGAGAGGGAGG + Intergenic
1099933331 12:89098701-89098723 CAGGGGTGGAGTGGAGTTGGAGG - Intergenic
1100045576 12:90376178-90376200 GAAGGGTGGAGGGTAGAAGGAGG - Intergenic
1100565724 12:95791239-95791261 GAGGGGGTGGCTGGAGGAGGAGG - Intergenic
1101254827 12:102966513-102966535 GGGTGGTGGAGTGGAGGAGGGGG - Intergenic
1101459184 12:104872356-104872378 GAGGAGTGGAGAGGAAAAGGGGG + Intronic
1101692198 12:107093105-107093127 GAGGAGGGGACCGGAGAAGGCGG + Exonic
1101822726 12:108196183-108196205 GAGGGTTGTCCGGGAGAAGGAGG + Exonic
1102151143 12:110689531-110689553 CAGGGGTGGCCCGGAGACGGTGG - Intronic
1102640534 12:114362523-114362545 GAGTGCTGGATAGGAGAAGGGGG - Intronic
1103021704 12:117539760-117539782 GAAGGGTGTAGGGGAGAAGGCGG + Exonic
1103155374 12:118680254-118680276 GAGGGGTGGACGGAAGGGGGCGG + Intergenic
1104311911 12:127660921-127660943 GAGAGGTGAATTGGGGAAGGTGG - Intergenic
1104346038 12:127999814-127999836 GAACAGTTGACTGGAGAAGGAGG - Intergenic
1105293660 13:19070751-19070773 GAGGGGAGGAGTGCAGGAGGAGG - Intergenic
1105747365 13:23390913-23390935 CAGGTTTGGGCTGGAGAAGGAGG - Intronic
1106276749 13:28216333-28216355 GAGGGGTGGAAAGGAGAGAGGGG + Intronic
1107359485 13:39603240-39603262 GGGGAGGGGACTGGAGAAAGAGG - Intronic
1107639986 13:42432028-42432050 GAGGGGTGGCCTCTAGAAGCCGG + Intergenic
1108733453 13:53258251-53258273 GAGGGGTGAACTGGCCCAGGTGG + Intergenic
1110627407 13:77666842-77666864 GAGAGGAGGAGAGGAGAAGGAGG + Intergenic
1111822789 13:93233805-93233827 GTGTGGGAGACTGGAGAAGGGGG + Intronic
1112207230 13:97336926-97336948 CAGGAGTGGACAGAAGAAGGAGG - Intronic
1112404608 13:99107876-99107898 GAGGGGAGGAAGGGAGAAAGAGG + Intergenic
1112433498 13:99373698-99373720 GATGGGTGGGCTGGAGTAGAGGG + Intronic
1113044885 13:106145408-106145430 AAGGGGTGGGAGGGAGAAGGAGG - Intergenic
1113677032 13:112214642-112214664 GAGGGCTGGAGGGGAGGAGGGGG + Intergenic
1113790959 13:113027886-113027908 GAGGGGTGTCCTGGGGAGGGCGG + Intronic
1113889567 13:113728805-113728827 GAGGGATGCCCTGGAGAGGGCGG + Intronic
1113909719 13:113836336-113836358 GAGGGGAGGAGGGGAGGAGGAGG + Intronic
1114626894 14:24136132-24136154 GCGGGGAGGGCTGGAGGAGGCGG - Intergenic
1114640471 14:24216226-24216248 GCTGGGTGGAGTGGAGAAGTAGG - Intronic
1114659922 14:24337558-24337580 CAGGGGTGGGCTGGGGACGGTGG + Intronic
1114710686 14:24774944-24774966 GTGGGGAGGGCTGGAGAAGAGGG - Intergenic
1114864038 14:26565450-26565472 GAGTGGTGGACTGTAGAATTAGG - Intronic
1115217105 14:31025454-31025476 GGGGGGTGGTCCGGAAAAGGGGG + Intronic
1115522214 14:34244399-34244421 GAAGGGAGGAAAGGAGAAGGGGG + Intronic
1116647965 14:47553993-47554015 GGGGGGTGGACGGGGAAAGGAGG - Intronic
1117025111 14:51611154-51611176 GAGGGGAAAAATGGAGAAGGAGG + Intronic
1117049195 14:51843792-51843814 GTGGGGTGGACTGAAGAGGTGGG - Intronic
1117341894 14:54798716-54798738 GAGGTGTGGAAGGGAGAGGGAGG + Intergenic
1117406813 14:55411887-55411909 GAGGAGGGGCCTGGGGAAGGGGG + Intergenic
1117649060 14:57883020-57883042 GAGGAGGGGAGGGGAGAAGGAGG + Intronic
1118169165 14:63369212-63369234 AGGGGGAGGACTGGAGAGGGAGG + Intergenic
1118737383 14:68711706-68711728 GAGAGGTGAACTAGAGAGGGCGG + Intronic
1118775969 14:68974186-68974208 GAGGTGTGGACTTGAGAATCTGG + Intronic
1118794534 14:69129303-69129325 GAGGGGTTGAGTGGAGTAAGGGG - Intronic
1119636559 14:76278084-76278106 GAGGGGTAGGTTGGAGCAGGGGG + Intergenic
1119749443 14:77067069-77067091 GAGGGCTGGCATGGAGAAGGGGG - Intergenic
1120449444 14:84648360-84648382 GAGGGGTGGACAAGTCAAGGAGG - Intergenic
1121777153 14:96598371-96598393 GAGGGGAGGAAGGGAGGAGGAGG - Intergenic
1122337727 14:101004924-101004946 GTGGAGTTGGCTGGAGAAGGAGG - Intergenic
1122426335 14:101608089-101608111 GAGAGGTGGAGTAGAGGAGGAGG - Intergenic
1122546010 14:102523281-102523303 GAGGAGGGGAAGGGAGAAGGAGG + Intergenic
1123434927 15:20247861-20247883 GAGGGGAGGAGAGGAGAGGGAGG + Intergenic
1124553912 15:30708440-30708462 GAGGGGCCGCCTGGGGAAGGAGG + Intronic
1124677337 15:31697231-31697253 GAGGGGCCGCCTGGGGAAGGAGG - Intronic
1124922461 15:34039624-34039646 GAGAGGTGGACTGCAGCACGTGG + Intronic
1125732414 15:41900624-41900646 GAGGGGTGGGCTGCAGAACGGGG - Exonic
1125745860 15:41996778-41996800 GAGGTGTGGGGTGCAGAAGGTGG + Intronic
1125987352 15:44067036-44067058 GAGGGATGGAATGGACCAGGTGG + Intronic
1127224725 15:56917945-56917967 GAGGGGCTGACTGGAGATGTGGG + Intronic
1127994782 15:64147168-64147190 GAGGGGTGGACTGGCCAGGAGGG - Intergenic
1128044832 15:64608624-64608646 TAGGGGTGGGCAGGGGAAGGTGG - Intronic
1128345339 15:66849545-66849567 GAGGCCTGGCCTGGAGTAGGAGG - Intergenic
1128555668 15:68630105-68630127 GAGGGGTGGAGAGGAAAACGAGG - Intronic
1128567651 15:68711798-68711820 GTGAGATGCACTGGAGAAGGGGG - Intronic
1128637503 15:69312616-69312638 GGGGACTGGACAGGAGAAGGGGG - Intronic
1128664171 15:69526233-69526255 GAGGGCTGGACTGGGACAGGAGG - Intergenic
1128781172 15:70359625-70359647 TAGGTGTGGACTGGAGTTGGAGG + Intergenic
1128878692 15:71223648-71223670 GAGGGGTAGACAGGTGAAAGAGG + Intronic
1129524047 15:76202993-76203015 GAGGTCTGGGCTGGAGACGGTGG - Intronic
1129549888 15:76436974-76436996 CAGAGGTTCACTGGAGAAGGGGG + Intronic
1129723911 15:77892012-77892034 GAGGGCTGGGCTGGGGGAGGAGG - Intergenic
1129741636 15:77992374-77992396 GATAGGTGCACTGGAGCAGGGGG + Intronic
1129757781 15:78108928-78108950 GAGGCTTGGACTGGAGAAGAGGG - Intronic
1130048899 15:80467261-80467283 TCGGCATGGACTGGAGAAGGTGG + Intronic
1130286032 15:82555392-82555414 CAGGGATGCACTGGGGAAGGAGG - Intronic
1130510678 15:84586884-84586906 GAGGGCTGGACTGAAGGAGCTGG - Intergenic
1131229059 15:90647124-90647146 GAGGGGTGTGGAGGAGAAGGAGG - Intergenic
1132255381 15:100372561-100372583 CAGTGGTTGCCTGGAGAAGGGGG + Intergenic
1132579765 16:679619-679641 GAGGGGAGGACTGGCCACGGAGG + Intronic
1134846748 16:17446990-17447012 GAGGGATGGAGGGGAGGAGGGGG - Intronic
1135526621 16:23217951-23217973 GAAGGGTGAAGTGGAGAAGGAGG - Intergenic
1136346526 16:29679467-29679489 GCAGGGTGGCCTGGAGGAGGTGG + Intronic
1136419541 16:30123203-30123225 GAGGGGAGGAGTGGAGATGGCGG - Exonic
1136428713 16:30185124-30185146 GAGGGGTGTCCTGGGGGAGGTGG + Intronic
1137527456 16:49248930-49248952 GATGAGTGGAATGGAGGAGGAGG + Intergenic
1137547736 16:49415996-49416018 GAGGAGTGGAGTTGAGGAGGGGG + Intergenic
1137652665 16:50133894-50133916 GAGGGGGTGGCTGGAGAAAGAGG + Intergenic
1137788294 16:51154310-51154332 GAGGGGGGGATGGGAGGAGGGGG + Intergenic
1139013150 16:62658111-62658133 GAGGGATGGTTTGGAGGAGGAGG + Intergenic
1139264073 16:65623145-65623167 CAAGGGAGGACTGGAGGAGGAGG + Intergenic
1139352169 16:66343577-66343599 GTGAAGTGGCCTGGAGAAGGTGG - Intergenic
1139390558 16:66604632-66604654 GAGGGGCGGGCTGGAGGAGCGGG + Intronic
1141028822 16:80570777-80570799 GTGGGGTTGAGTGGGGAAGGTGG - Intergenic
1141174624 16:81710794-81710816 CCGGGGTGGACTGGAGAGGGCGG - Exonic
1141335101 16:83147264-83147286 AAAGGGTGGACGGAAGAAGGTGG - Intronic
1141364704 16:83432003-83432025 GAGGGATAGACTGGAGAAGGAGG + Intronic
1141790533 16:86231297-86231319 AAGGGGTGGACTGGATCTGGGGG - Intergenic
1142001293 16:87665764-87665786 GAGGGATGGGCTGGGGAAGGAGG - Intronic
1142270884 16:89088739-89088761 GAGGGGGTGACTGAACAAGGAGG + Intronic
1142401293 16:89860099-89860121 GAGGTGTGGACTGCAGGAGGAGG + Intronic
1142631949 17:1230832-1230854 GAGAGGGGGCCTGGAGACGGGGG + Intergenic
1142635833 17:1256981-1257003 GAGGGGTGGACTGGTGAGCATGG - Intergenic
1142720691 17:1773825-1773847 GTGGGGTGGCCTGGGGTAGGGGG + Intronic
1143181594 17:4987299-4987321 GAGGGATGTTCTGGAGAAGCCGG + Intronic
1143183579 17:4998154-4998176 GAGGTGAGGGCTGGGGAAGGGGG + Exonic
1143429343 17:6868784-6868806 GAGGAATTTACTGGAGAAGGTGG + Intergenic
1143459717 17:7094451-7094473 GAGAAGTGGACAGGAGAATGGGG - Intergenic
1143966103 17:10757367-10757389 AAGGGGAGGACTGGGGAAGAGGG + Intergenic
1143974753 17:10821601-10821623 GAGGGGAGGACAGAAGAAGGAGG - Intergenic
1143989203 17:10942342-10942364 GAGAGGTGGGGTGGAGAATGTGG + Intergenic
1144201177 17:12943900-12943922 GACAGGAGGACTGGAGGAGGGGG - Intronic
1144693899 17:17288246-17288268 GAGGGGAGGAGTGGGGGAGGGGG + Intergenic
1146064813 17:29625889-29625911 GAGGGAGGTGCTGGAGAAGGTGG - Intergenic
1146157007 17:30533017-30533039 GAGGGCTGAACTAGTGAAGGGGG - Intergenic
1146458236 17:33023809-33023831 GAAGGGGGAACTGGATAAGGAGG - Intronic
1146762618 17:35491580-35491602 GAGGGATGGGCTGCAGAATGGGG + Intronic
1147420785 17:40321315-40321337 GAGGGCGGGACTGGAGCGGGAGG - Intronic
1147567652 17:41547560-41547582 GAGGTGTGGACAGGAGCAGCAGG - Intergenic
1147953723 17:44121139-44121161 GAGGGGAGGAAGGGAGGAGGCGG + Intronic
1147996544 17:44363106-44363128 GAAGGGGGGAGGGGAGAAGGGGG - Intronic
1148105251 17:45115310-45115332 GATGGGTGGGGTGGGGAAGGGGG - Intronic
1148382578 17:47210385-47210407 GAGGGGTGGGCTGAAGAGGGAGG + Intronic
1148386798 17:47239913-47239935 GAGGGGTGGAGAGGAGAGGGAGG + Intergenic
1148437277 17:47694260-47694282 GCGGGGTGGGCAGGAGGAGGCGG + Intronic
1148556059 17:48579126-48579148 GAGGAGTGGATAGGAGAAGGGGG - Exonic
1148658932 17:49311835-49311857 GAGAGGTGTGCTGGAGCAGGAGG - Intronic
1148835297 17:50462775-50462797 GAGGGCTGGAGTGGAGAGGGCGG - Intronic
1148895658 17:50837664-50837686 GAGGGCTGACCTGGAGAGGGTGG + Intronic
1148953953 17:51337939-51337961 GAGGGAGGGAGAGGAGAAGGTGG + Intergenic
1149993008 17:61393194-61393216 GAAGGGTGGTCAGGTGAAGGTGG + Intergenic
1151173855 17:72270813-72270835 GAGGATTGTACTGGAAAAGGAGG - Intergenic
1151271375 17:72998850-72998872 GAGAGGTGGAAGGGAGATGGCGG + Intronic
1151419648 17:73988736-73988758 GGGGTGGGGACTGTAGAAGGAGG + Intergenic
1151745476 17:76009514-76009536 GAGGAGCGGTGTGGAGAAGGAGG - Exonic
1151983220 17:77526442-77526464 GCGGGGAGGAGTGGAGAGGGAGG - Intergenic
1152089923 17:78240635-78240657 GAGAGGTGTGCTGGGGAAGGTGG + Exonic
1152131392 17:78478918-78478940 GAGGTGTGGACTGATGATGGTGG - Intronic
1152581249 17:81166381-81166403 GAGGGGAGGCATGGAGGAGGGGG + Intergenic
1152655731 17:81518438-81518460 TAGGGGTGGAATAGAGAGGGAGG + Intronic
1152789809 17:82273047-82273069 GAGGGGAGGGTTGGGGAAGGAGG - Intronic
1155372474 18:25116272-25116294 AAGGAGTTGATTGGAGAAGGTGG + Intronic
1155407006 18:25500130-25500152 GAGGGGTGGGATGGAGGGGGTGG + Intergenic
1155595933 18:27487304-27487326 TAATGGTGGACTTGAGAAGGTGG - Intergenic
1156501645 18:37563905-37563927 GAAGGGAGGGCTGGAGAAAGAGG + Intronic
1157214914 18:45774731-45774753 GTTGGGTGGACAGGAGAAGAGGG - Intergenic
1157233352 18:45940057-45940079 GAGGGGTGGGCAGGATAAGGAGG + Intronic
1157573465 18:48729061-48729083 GAGGGGAGGACAGGATGAGGAGG - Intronic
1157656334 18:49393048-49393070 GAGGGGAGGAGGGGAGGAGGAGG + Intronic
1157683051 18:49622014-49622036 GAGGGGAGGGCTGGGCAAGGAGG + Intergenic
1157723670 18:49945743-49945765 GAGGGGAGGAGGGGAGGAGGAGG + Intronic
1157862167 18:51151354-51151376 AAGGCGGGCACTGGAGAAGGTGG + Intergenic
1157881892 18:51328682-51328704 GTGGGGTGGCCTTGAGAAGTTGG - Intergenic
1157957366 18:52113379-52113401 GAAGGATGGACTGAAAAAGGAGG + Intergenic
1158070236 18:53462031-53462053 GAGGGATGGAGTGAAGAGGGAGG + Intronic
1158446272 18:57524677-57524699 GAGGAGAGGAGTGGAGGAGGAGG + Intergenic
1159060356 18:63508146-63508168 GAGGGGTGAGCTGGGGGAGGAGG + Intergenic
1159877394 18:73827659-73827681 GAAGGATGGAGAGGAGAAGGAGG + Intergenic
1160322651 18:77910980-77911002 GAGGGCTGGACTGGGGGACGGGG - Intergenic
1160739990 19:681168-681190 GAGGGGTGGAATGGAGAGGGGGG + Intronic
1160811836 19:1016195-1016217 GAGGGGTGGGCGGGGGGAGGGGG + Intronic
1160835295 19:1122094-1122116 GAGGGGAGGGCTGGATTAGGGGG - Intronic
1160922382 19:1527001-1527023 GAGTGGGGTCCTGGAGAAGGTGG + Intronic
1161086110 19:2335548-2335570 GAGGGATGCAGTGGAAAAGGAGG - Intronic
1161218890 19:3108825-3108847 GAAGGCTGGACTGGAGCTGGAGG + Intronic
1161403781 19:4080886-4080908 GAGGGGTGGGGAGGGGAAGGGGG + Intergenic
1161502236 19:4622770-4622792 GGGGGCGGGACTGGAGAAGGTGG + Intergenic
1161649819 19:5477707-5477729 GAGTGGTGGCCTGGAGGTGGAGG - Intergenic
1162174871 19:8823361-8823383 GAGGGGTTGACTGAGGCAGGAGG - Intronic
1163291930 19:16384633-16384655 GAGGAGTGAACTGTTGAAGGAGG - Intronic
1163327011 19:16611111-16611133 CAGGGTTGGACTCGAGATGGAGG + Intronic
1163554605 19:17984903-17984925 GGGAGGAGGACTGGAGGAGGTGG - Intronic
1163596677 19:18224860-18224882 TAGGGGCGGACTGGAGGCGGCGG + Intronic
1163774249 19:19208491-19208513 GTGGGGAGGAGTGGAGAAGCGGG + Intergenic
1164292540 19:23880889-23880911 GAGAGGAGGAATGGAGCAGGAGG + Intergenic
1164292805 19:23882445-23882467 GAGGAGAGGAGAGGAGAAGGAGG + Intergenic
1164701078 19:30284767-30284789 GACGTGTGGTCAGGAGAAGGTGG - Intronic
1164868650 19:31625680-31625702 GAGGCGAGGGATGGAGAAGGGGG - Intergenic
1165051145 19:33142367-33142389 GAGGGGCTGCCTGGAGAAAGTGG + Intronic
1165117437 19:33537381-33537403 GAGGGGCAGTCAGGAGAAGGAGG - Intergenic
1165255877 19:34577022-34577044 GAGGGGTCTTCTGGGGAAGGAGG + Intergenic
1165431846 19:35777434-35777456 GGGTGGGGGACTGGAGAAGCAGG - Intronic
1165799101 19:38536813-38536835 GAGGGGTGGACGGGGTTAGGAGG - Intronic
1165811637 19:38615221-38615243 GTGGGGTGGAGTGGAGGGGGAGG + Intronic
1165832626 19:38736953-38736975 GAGGGGAGGAGTGGAGGAGCAGG - Intronic
1166198132 19:41219752-41219774 GGGGGCTGGACCTGAGAAGGGGG + Intronic
1167019257 19:46861547-46861569 GAGGGGTGGAAGGGGGAAGGGGG - Intergenic
1167112472 19:47470440-47470462 GAAGGGGGCCCTGGAGAAGGTGG - Intronic
1167247263 19:48381127-48381149 CTGGGGTTGACTGGGGAAGGGGG - Intergenic
1167418749 19:49390609-49390631 GAGGTGTGGGCTGGAGAACGAGG - Intronic
1167516152 19:49924340-49924362 TAGGGGTGGTGTGGAGAGGGAGG - Intronic
1167591971 19:50409064-50409086 CAGAGGTGGGCTGGAGCAGGAGG + Intronic
1167602928 19:50465053-50465075 GAGGGAGAGACTGGAGACGGAGG - Intronic
1168280195 19:55301666-55301688 GAGGGGGGGACCGGCGGAGGGGG + Intronic
1168296689 19:55380387-55380409 GAGGGGAGGAGGGGGGAAGGGGG - Intronic
1202688241 1_KI270712v1_random:67354-67376 GTGGGGTGTCCTGGAGAAGCAGG - Intergenic
925194259 2:1910488-1910510 GATGGGTGGACTGGGAGAGGGGG + Intronic
925242503 2:2344181-2344203 GAAGGGTGGAGTGGAGAGGCAGG + Intergenic
925755518 2:7128316-7128338 GAGGGGGGGAAGGGAGAAAGGGG - Intergenic
926581093 2:14633504-14633526 GGGAGGTGGGCTGGAGAGGGTGG + Intronic
926730900 2:16034645-16034667 CAGGGGTGGAGTGGAGATGGAGG + Intergenic
927466801 2:23342888-23342910 GATGGGTGGGCTGGAGAGCGAGG + Intergenic
927513319 2:23658088-23658110 GAGGAGTGGGCAGGAGAGGGAGG - Intronic
927642693 2:24855451-24855473 GAAGGCTGGACCGGAGGAGGGGG + Intronic
927849746 2:26491363-26491385 GAGGGGTGGAGGGAAAAAGGAGG + Intronic
927854480 2:26519226-26519248 CTGGGCTGGGCTGGAGAAGGTGG + Intronic
928099948 2:28431154-28431176 GAGGAGAGGACAGGAGGAGGTGG - Intergenic
928129248 2:28637769-28637791 GAGTGGTGGAGTGGGCAAGGAGG - Intronic
929421554 2:41795383-41795405 GAGGGGTGGAGTGGGGGAGGTGG - Intergenic
929751095 2:44714573-44714595 GAGGGGTGGAGAGGAGCAGCAGG - Intronic
929876563 2:45801448-45801470 AAGGGGAGCAGTGGAGAAGGGGG + Intronic
930148005 2:48027101-48027123 GAGCAGAGGACTGGAGAAGTTGG - Intergenic
931321530 2:61177905-61177927 GAGGGGTGGGCGGGAGGAGAAGG - Exonic
932214629 2:69958833-69958855 GGTGGGAGAACTGGAGAAGGGGG - Intergenic
932793999 2:74679726-74679748 GCGGGATGGACTGGAGGTGGTGG + Exonic
933609645 2:84421186-84421208 GAGAGGTGGTTAGGAGAAGGTGG + Intergenic
933768620 2:85728900-85728922 GAGGCTTGGAATGGTGAAGGAGG + Intergenic
934863568 2:97786010-97786032 AAGGGGTAGGCTGAAGAAGGAGG + Intronic
935737483 2:106117916-106117938 GAGGGGTTGGCTGAGGAAGGGGG + Intronic
935793026 2:106611538-106611560 GAGGGCTGGGCAGAAGAAGGGGG + Intergenic
936080694 2:109430569-109430591 GAGGGGAGGAGAGGAGAACGGGG - Intronic
936450076 2:112627301-112627323 AAGGGGTGAACTGGACAGGGAGG - Intergenic
936921548 2:117694190-117694212 TAGGTGTGGAAGGGAGAAGGTGG - Intergenic
937039008 2:118806879-118806901 GAGGGGTGGAGTGGGGGAGGAGG - Intergenic
937091467 2:119209249-119209271 GGGGAGTGAAGTGGAGAAGGAGG - Intergenic
937890492 2:126934899-126934921 GTGGGGTGGAGTGAAGCAGGAGG + Intergenic
938155816 2:128939195-128939217 GAAGGTTGGGCTGGAGAAGGTGG + Intergenic
939914452 2:148021598-148021620 AAGGGGGGGAGTGGAGGAGGAGG - Intronic
939982272 2:148795987-148796009 GGGCAGTGGTCTGGAGAAGGTGG - Intergenic
940838687 2:158554231-158554253 AGGAGGTGAACTGGAGAAGGTGG - Intronic
943178234 2:184506222-184506244 CAAGGGTGGACTGGAAAAGCTGG - Intergenic
943498272 2:188652313-188652335 GTGTGGAGGACTGGATAAGGAGG - Intergenic
943786569 2:191884050-191884072 GGGAGGTGGAGTGGAGATGGGGG - Intergenic
943822213 2:192339725-192339747 GTTGGGTTGACTGAAGAAGGAGG + Intergenic
944081427 2:195792801-195792823 GAGGGATGGTCAGGGGAAGGGGG + Intronic
944770876 2:202912665-202912687 GAGGGGCAGGCTGGAGAAGGAGG + Intronic
944784379 2:203053615-203053637 GTGGGGGGAACTGAAGAAGGAGG - Intronic
946230408 2:218287743-218287765 GAGGGGTGGCCTCGAGTTGGGGG - Intronic
946312374 2:218889914-218889936 GAAAGGTGGGCTGGAGAATGGGG + Intronic
946519119 2:220446691-220446713 GAGGGAGGGAGGGGAGAAGGGGG - Intergenic
946986578 2:225280478-225280500 GAGGAGTCCACTGGTGAAGGAGG - Intergenic
947335651 2:229080061-229080083 GGAGGGTGGACTGGAGAACAGGG - Intronic
947586178 2:231358321-231358343 GAGGGGAGGGATGGAGAAGCAGG - Intronic
947739958 2:232480488-232480510 GCGGGGTGGAGGGGAGGAGGGGG + Intronic
947817452 2:233047784-233047806 GTGGGGTGTCCTGGAGGAGGAGG + Intergenic
948183336 2:236000471-236000493 GGGGACTGGACTGGAGGAGGGGG - Intronic
948301923 2:236914038-236914060 CAGGGGTGGATGGGAGGAGGGGG + Intergenic
948370461 2:237486434-237486456 GCCGGGCGGACTGGAGACGGCGG + Intronic
948620068 2:239228651-239228673 TTGGGAAGGACTGGAGAAGGGGG + Intronic
948940203 2:241191506-241191528 GTGGAGGGGACTGGAGCAGGAGG - Intronic
948995426 2:241575976-241575998 GGGAGGAGGACTGGAGGAGGAGG - Intergenic
1168964739 20:1892594-1892616 GGAGGGTGGACTGGAGAGAGAGG - Intergenic
1169074009 20:2750576-2750598 GTGGGGTGGAGAGGAGAAGTGGG - Intronic
1169092852 20:2872209-2872231 GATGGTAGGACTGGAGATGGTGG + Intronic
1169110924 20:3033235-3033257 GTGGGGTGGACTGGTGTCGGGGG - Intronic
1170138546 20:13102589-13102611 GAGAGGTGTACGGGAGATGGAGG - Intronic
1170939422 20:20836095-20836117 GAGGTTTGGACTGCAGGAGGTGG + Intergenic
1172199303 20:33114032-33114054 GAGAGGTGGGCTGGGGAATGGGG - Intergenic
1172483506 20:35285326-35285348 GAGGGGAGGACTGAGGAAGCAGG + Intergenic
1172773197 20:37393234-37393256 GATGGGTAGGCTGGAGGAGGAGG + Intronic
1172780891 20:37436421-37436443 GATGGGTGGACAGAAGATGGGGG - Intergenic
1173438850 20:43057316-43057338 GAGGGGGGAAGGGGAGAAGGAGG + Intronic
1173489177 20:43465609-43465631 GAGGGGTGGCGGGGAGGAGGGGG + Intergenic
1173586570 20:44187210-44187232 GAGGGCAGGATTGGAGAAGGGGG - Exonic
1173643823 20:44621471-44621493 GAGGGGAAGGCTGGAGAGGGTGG - Intronic
1174044629 20:47724706-47724728 GAGGGATGGACTAGAGGAGGGGG + Intronic
1174066266 20:47867958-47867980 GAGGGGTGCACTGGAGAGGCGGG + Intergenic
1174384569 20:50179461-50179483 GTGGGGTGGGTTGGGGAAGGTGG + Intergenic
1174400882 20:50275188-50275210 GATGGGTGGACGGGTGAATGGGG + Intergenic
1174513916 20:51076653-51076675 GGGTGGTGGACTGGAGGGGGTGG + Intergenic
1174556396 20:51398430-51398452 CAGGGTTGGGCGGGAGAAGGGGG - Intronic
1175013387 20:55763169-55763191 GAGGTGTGGGCTGGAGAAGACGG + Intergenic
1175125095 20:56745466-56745488 AAGGATTGGGCTGGAGAAGGAGG - Intergenic
1175273791 20:57753799-57753821 GGAGGGTGGACTGGAGCTGGGGG + Intergenic
1175377747 20:58541060-58541082 GAGGGCTGCAGAGGAGAAGGTGG - Intergenic
1175531051 20:59674506-59674528 GAAGCGGGGACAGGAGAAGGGGG - Intronic
1175531071 20:59674581-59674603 GAAGCGGGGACAGGAGAAGGGGG - Intronic
1175531081 20:59674612-59674634 GAAGCGGGGACAGGAGAAGGGGG - Intronic
1175531139 20:59674803-59674825 AAGTGGGGGACAGGAGAAGGTGG - Intronic
1175900819 20:62359264-62359286 CAGGGGCCGACTGGAGAGGGAGG + Intronic
1175934584 20:62509156-62509178 GAGGGGTGGAGGGTGGAAGGTGG - Intergenic
1176013435 20:62913345-62913367 GAGGGGGGCACTAGAGATGGTGG + Intronic
1177237319 21:18409814-18409836 GAGGGGTGAAGGGGGGAAGGGGG - Intronic
1177890668 21:26800333-26800355 GAAGGGTGGCCTGGAAAGGGTGG - Intergenic
1179051140 21:37889445-37889467 GAGGGCTGGGCTGGGGAAAGGGG + Intronic
1179655561 21:42842278-42842300 GTGGGCTGGGCTGGAGAAGCTGG + Intergenic
1179797759 21:43795126-43795148 GATGGGTGGTCTGGCGAAGTAGG + Intronic
1179985569 21:44918857-44918879 GTGGGCTGGGCTGGAGAAGCAGG - Intronic
1180119785 21:45738973-45738995 AAGGGGTGGGCTGAAGATGGGGG - Intronic
1180955164 22:19738222-19738244 GAAGGGGAGACTGGAGGAGGAGG - Intergenic
1181052999 22:20246487-20246509 GAGGGGAGGGGTGGAGAAGGGGG + Intronic
1181528437 22:23502749-23502771 GAGGGGTGGAGGGGTGAAGGAGG - Intergenic
1181758337 22:25040852-25040874 GCGGGGTGGAGCAGAGAAGGAGG + Exonic
1182417914 22:30233110-30233132 GAGGGAGGCACTGGAGGAGGGGG - Intergenic
1182448184 22:30402103-30402125 GGGCGGTGGACTGGGGTAGGGGG - Intronic
1182478883 22:30593517-30593539 AAGGGATGGACTGGAGAGGGTGG + Intronic
1182805934 22:33070415-33070437 GTGGGGTGGGTTAGAGAAGGTGG + Intergenic
1183000623 22:34855722-34855744 GAGGGGTGGGCAAGAGAACGGGG - Intergenic
1183247096 22:36702322-36702344 GAGGGGTGGGGTGGAGAGGGGGG + Intronic
1183619146 22:38962461-38962483 GGGGGGTTGAATGGAGCAGGAGG - Intronic
1183624346 22:38992397-38992419 GGGGGGTTGAATGGAGCAGGAGG - Intronic
1184019215 22:41809314-41809336 GAGGCCTGGCCTGGAGCAGGTGG - Intronic
1184357890 22:43994689-43994711 GTGGGGTGCACAGCAGAAGGTGG + Intronic
1184397531 22:44252147-44252169 GAGGGGTGGAGATGAGAAGCAGG + Intronic
1184552313 22:45210914-45210936 GAGGGGAGGTCTGGAGACGTGGG - Intronic
1184770625 22:46594697-46594719 GAGGGCCGGACTGGAGATGGAGG + Intronic
1185332847 22:50259376-50259398 GGGGGCTGGCCTGGAGAGGGAGG + Intronic
1185345160 22:50307714-50307736 GCGGGGAGAACAGGAGAAGGGGG + Intergenic
1185346613 22:50313361-50313383 GAGGGAAGGTCTGGAGCAGGAGG - Intronic
1185399336 22:50607856-50607878 GAGGGGAGGAGGGGAGGAGGAGG + Intronic
949891705 3:8738157-8738179 GAGGAGTTGACTGCAGAAGCTGG - Intronic
949987286 3:9551358-9551380 GAGAGTTGGACTGGGGAAAGTGG - Intronic
950129754 3:10534021-10534043 GAGGGGTGAGTTGGAGACGGGGG - Intronic
950198443 3:11026142-11026164 GAGGGGTGGCCCGGAGGAGGGGG - Intronic
950461516 3:13124994-13125016 GCTGTGTGGACTGGAGAAGGAGG - Intergenic
950614246 3:14146591-14146613 GAGGGTTTGGATGGAGAAGGCGG + Intronic
950707448 3:14791820-14791842 AAGGGGTGGGCTGGAGGAGCAGG + Intergenic
952506355 3:34010037-34010059 GAGGGGTAGACATGAGAATGAGG - Intergenic
952816858 3:37453364-37453386 GAGGGGTGGGCCTAAGAAGGGGG + Intronic
952833484 3:37584979-37585001 GAGGGGAGCACTGGAAAAAGAGG + Intronic
952905078 3:38134462-38134484 GAGGGCTGGACTGAAGATTGTGG + Intronic
954063435 3:48088280-48088302 GAGGGGTGGTCTGGAGAACCGGG - Intronic
954108030 3:48419682-48419704 GAGGGTGGAAGTGGAGAAGGCGG + Exonic
954109780 3:48427591-48427613 GAGGTGTGGACTGGAGGGGTAGG - Intronic
954409913 3:50365975-50365997 GATGCCTGGACTGGAGATGGGGG - Intronic
954462683 3:50636723-50636745 GAGGGGAGGCCTGGAGGAGAAGG + Intronic
954694659 3:52415537-52415559 GTGGGATTGACTGGAAAAGGAGG - Intronic
954699776 3:52445165-52445187 GAGGGGCGGAGGAGAGAAGGAGG + Intergenic
954790539 3:53130187-53130209 GGGGGGTCGACCGGAGACGGTGG - Intronic
954992934 3:54856470-54856492 GAGGGAAGGACAGGAGCAGGTGG - Intronic
955916422 3:63912421-63912443 GGGGGGTGGCCTTGAGGAGGCGG + Intronic
956466171 3:69522743-69522765 GAGGTGTTGGCTGGAGATGGGGG - Intronic
956934950 3:74089965-74089987 GAGGGGGTGGCTGGAGAAAGAGG - Intergenic
957611859 3:82477647-82477669 GAGTGGTGAACTAGAGAAGGTGG + Intergenic
958636296 3:96750872-96750894 GAGAGGAGGCCTGGAGAGGGTGG - Intergenic
959150876 3:102606084-102606106 GAGGGGTTTCCTGGAGAAGTGGG - Intergenic
959545249 3:107588335-107588357 AAGGGGGGGCCTGGAGCAGGGGG + Intronic
959621573 3:108403732-108403754 AAGGGGTGGACTGGAGGCAGGGG - Intronic
959884784 3:111487341-111487363 GGGGGGTGGGGTGGAGAAAGAGG - Intronic
960043079 3:113170070-113170092 GTGGGGAGGCCTGGGGAAGGTGG - Intergenic
960527010 3:118721395-118721417 TAGGGGGTGACAGGAGAAGGTGG + Intergenic
960847963 3:122022159-122022181 GAGGGGTTCCTTGGAGAAGGTGG - Exonic
961001908 3:123379598-123379620 GAGAGGAGGTGTGGAGAAGGGGG + Intronic
961052805 3:123761434-123761456 GAGGGACGGAGTGGAGCAGGTGG + Intronic
961090381 3:124106163-124106185 AAGTGGTAGACTGGAGGAGGGGG + Intronic
961171684 3:124801840-124801862 GAGGAGTGGGCTGGGGAGGGAGG - Intronic
961235750 3:125365325-125365347 GATGGGTGGATGTGAGAAGGAGG - Intronic
961512055 3:127409236-127409258 GAGGGGAGGCCGGGAGGAGGAGG - Intergenic
961621912 3:128231051-128231073 GAGGGGAGGAGAGGAGTAGGGGG - Intronic
961780500 3:129317644-129317666 AAGGGGTGAGCTGGAGAAGAGGG - Intergenic
961847601 3:129780415-129780437 GAGGGGTGGAGGGGTGGAGGTGG - Intronic
962280625 3:134049151-134049173 GAGGGGGGGAAAGGAGAATGAGG - Intronic
962415850 3:135181258-135181280 GAGGGGTTGGCGGGAGCAGGTGG - Intronic
962598907 3:136975906-136975928 TAGTGGTGGACTGGGCAAGGAGG + Intronic
962848198 3:139288947-139288969 CAGGTGTGGGCTGGAGTAGGAGG + Intronic
963406570 3:144870915-144870937 GAGGGGTGGATTTGAGGAGGGGG + Intergenic
964365818 3:155949996-155950018 GAGGGGTGCACTGGAGGAGGTGG - Intergenic
966354276 3:179062511-179062533 TAGGGGTAGACTAGAGGAGGAGG + Intronic
966454037 3:180094513-180094535 GAGGACTAGACTGGAAAAGGAGG - Intergenic
966659345 3:182397146-182397168 GGGTGGTGGAATGGAGAATGAGG + Intergenic
966946504 3:184780680-184780702 GAGGTGGGGGTTGGAGAAGGAGG - Intergenic
967191705 3:186990599-186990621 GAGGGAGGGATGGGAGAAGGCGG - Intronic
967662145 3:192125752-192125774 GAAGGGAGGAGAGGAGAAGGAGG + Intergenic
967906716 3:194507664-194507686 GAGGGGATGTCAGGAGAAGGAGG - Intergenic
967931456 3:194693378-194693400 GAGGTGTGAACTGGAGAAGGAGG - Intergenic
968138683 3:196238311-196238333 GAGGAGTGGGCAGAAGAAGGAGG - Exonic
968233334 3:197016909-197016931 GAGGGCTGGCCAGGAGAGGGGGG - Intronic
968287412 3:197517170-197517192 GAGGGGTGGGGTGAAGACGGAGG - Intronic
968636657 4:1684406-1684428 GAGGGCCGGCGTGGAGAAGGCGG - Intergenic
968952058 4:3700346-3700368 GAGGGGAGGAGTGGAGGAGGAGG + Intergenic
968967835 4:3778278-3778300 GTGGGGTGGGGTGGCGAAGGTGG + Intergenic
969098202 4:4750261-4750283 GAGGGGAGGACTGGAAAGTGTGG - Intergenic
969134544 4:5019644-5019666 GAGGGGCTGCCTGGAGGAGGGGG + Intergenic
969340360 4:6536632-6536654 GGTGGGTGCAGTGGAGAAGGGGG + Intronic
969703563 4:8780520-8780542 CAGGGGTGGCTGGGAGAAGGAGG - Intergenic
969707538 4:8820108-8820130 GTGGGGTGGAGTGGAGGAGGTGG + Intergenic
969725485 4:8915777-8915799 GGGTGGGGGACGGGAGAAGGAGG + Intergenic
969870467 4:10101384-10101406 GGGGGGTGGTTTGGAGAAGGGGG - Intronic
969979006 4:11135054-11135076 GAGGAGGGGAATGGAGGAGGGGG - Intergenic
970456116 4:16226202-16226224 GAGGGGCGGACTGGGGACCGAGG - Intronic
971097542 4:23424738-23424760 GGGGGGTGGATGGGAGAGGGAGG + Intergenic
971371114 4:26019745-26019767 GAGGGGTGTACTTCTGAAGGAGG - Intergenic
972974089 4:44612191-44612213 GAGGGGTGCCCTGGAGCAGGAGG + Intergenic
973786709 4:54339293-54339315 AACTGGTGGAATGGAGAAGGGGG + Intergenic
974808043 4:66907107-66907129 CAGGGTTTGACTGGAAAAGGAGG - Intergenic
975990783 4:80257909-80257931 GAGGGTTGCAGTGGAGATGGTGG + Intergenic
976112824 4:81694728-81694750 GTTGGGTGGTCTGGAGAGGGAGG - Intronic
979054880 4:115980651-115980673 GAAGGGTGGAAAGGAGAAAGTGG + Intergenic
980179076 4:129382239-129382261 TAGGGGTGGATTGGAGTACGTGG - Intergenic
981945833 4:150343036-150343058 GAGGCGTGGCCTGGAGGTGGGGG + Intronic
982113011 4:152073301-152073323 GAGGGGAGGAGAGCAGAAGGAGG - Intergenic
982421977 4:155208790-155208812 GCGGGGTGGGCGGGTGAAGGTGG - Exonic
983595126 4:169457692-169457714 GAAGGGGGGAGGGGAGAAGGAGG + Intronic
984232895 4:177120706-177120728 GAAGGGTGCAGTAGAGAAGGAGG - Intergenic
984703173 4:182831887-182831909 GAAGGGGGGAGAGGAGAAGGAGG - Intergenic
984703184 4:182831918-182831940 GAAGGGGGGAGAGGAGAAGGAGG - Intergenic
984703226 4:182832044-182832066 GAAGGGGGGAGAGGAGAAGGAGG - Intergenic
984703237 4:182832075-182832097 GAAGGGGGGAGAGGAGAAGGAGG - Intergenic
984703248 4:182832106-182832128 GAAGGGGGGAGAGGAGAAGGAGG - Intergenic
984703259 4:182832137-182832159 GAAGGGGGGAGAGGAGAAGGAGG - Intergenic
984703270 4:182832168-182832190 GAAGGGGGGAGAGGAGAAGGAGG - Intergenic
984703281 4:182832199-182832221 GAAGGGGGGAGAGGAGAAGGAGG - Intergenic
984703297 4:182832246-182832268 GAAGGGGGGAGAGGAGAAGGAGG - Intergenic
984703308 4:182832277-182832299 GAAGGGGGGAGAGGAGAAGGAGG - Intergenic
984703465 4:182833101-182833123 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703485 4:182833159-182833181 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703491 4:182833178-182833200 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703501 4:182833212-182833234 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703563 4:182833380-182833402 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703574 4:182833415-182833437 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703629 4:182833560-182833582 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703635 4:182833579-182833601 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703646 4:182833614-182833636 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703701 4:182833759-182833781 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703707 4:182833778-182833800 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703713 4:182833797-182833819 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703726 4:182833836-182833858 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703732 4:182833855-182833877 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703738 4:182833874-182833896 GAGGAGGGGAGGGGAGAAGGAGG - Intergenic
984703751 4:182833909-182833931 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703770 4:182833963-182833985 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703776 4:182833982-182834004 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703839 4:182834149-182834171 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703845 4:182834168-182834190 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703851 4:182834187-182834209 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703862 4:182834222-182834244 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703917 4:182834367-182834389 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703923 4:182834386-182834408 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703929 4:182834405-182834427 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703935 4:182834424-182834446 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703941 4:182834443-182834465 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703954 4:182834482-182834504 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703960 4:182834501-182834523 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703966 4:182834520-182834542 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703972 4:182834539-182834561 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984703978 4:182834558-182834580 GAGGAGGGGAGAGGAGAAGGAGG - Intergenic
984850454 4:184147861-184147883 GAGGTGTGGTGTGGATAAGGTGG - Intronic
985415779 4:189734449-189734471 AGGGGATTGACTGGAGAAGGTGG - Intergenic
985851142 5:2389800-2389822 GGGGGGTGGCATGGAGACGGGGG - Intergenic
986380617 5:7181704-7181726 GAGGGGTAGGCTGGAGAAAGGGG - Intergenic
986807133 5:11318441-11318463 GGGGCATGGACTGGAGAGGGAGG - Intronic
986897836 5:12392450-12392472 GGGTGCTGCACTGGAGAAGGTGG - Intergenic
987248497 5:16075385-16075407 GAGTGGTGGGCAGTAGAAGGAGG - Intronic
987745974 5:21972550-21972572 GAAGGGTGCACTTGAGAATGGGG + Intronic
989445447 5:41523001-41523023 GAGAGGAGGAGAGGAGAAGGAGG + Intergenic
991668743 5:69025943-69025965 GAGGAGTGGGTGGGAGAAGGTGG + Intergenic
991766181 5:69982652-69982674 GAAGGGTGCACTTGAGAATGGGG + Intergenic
991781138 5:70135502-70135524 GAAGGGTGCACTTGAGAATGGGG - Intergenic
991845415 5:70857735-70857757 GAAGGGTGCACTTGAGAATGGGG + Intergenic
991873582 5:71135816-71135838 GAAGGGTGCACTTGAGAATGGGG - Intergenic
991975356 5:72179329-72179351 GAGGTGTCGAATGGAGAATGCGG + Intronic
991998264 5:72409946-72409968 GATGGGAGGAAAGGAGAAGGTGG - Intergenic
992005401 5:72472675-72472697 GAGGGCTGGAATGGAGAAACTGG - Intronic
992363791 5:76070605-76070627 GAAGGGTGGTATGTAGAAGGTGG + Intergenic
992527927 5:77630025-77630047 GAGGGGCGGCCGGGAGACGGGGG + Exonic
992791836 5:80220746-80220768 GAGGGGTGAAGTGGGGAGGGGGG + Intronic
993862436 5:93152540-93152562 GAGGGAGGGAGGGGAGAAGGGGG - Intergenic
994129828 5:96213837-96213859 GATGGGAGGACTGGGGAAAGAGG - Intergenic
994223801 5:97228636-97228658 GAGGAGAGGACAGGAGAGGGTGG + Intergenic
995207447 5:109497436-109497458 GAGGGATGGAGGGAAGAAGGTGG + Intergenic
995340836 5:111057428-111057450 GAGAAGTGGACTTCAGAAGGTGG - Intergenic
995534483 5:113121398-113121420 GAGAGGGGGACTGGAGAGGTAGG - Intronic
997578832 5:135004710-135004732 GCAGGGTTGCCTGGAGAAGGAGG + Intronic
997621324 5:135298162-135298184 GAGGGGTGAGAGGGAGAAGGAGG - Intronic
998059189 5:139105741-139105763 CAAGGGTGGACTGGAGGAGGCGG - Intronic
998880217 5:146637889-146637911 GAAGGGTGGCCTGGACAAAGAGG - Intronic
999620802 5:153471270-153471292 GGGGGGTGGAGGGCAGAAGGAGG - Intergenic
999644827 5:153707318-153707340 AAAGGGTGGACAGGAGATGGGGG + Intronic
999755155 5:154658740-154658762 GATGGGTGACCTGGAGAAGGAGG - Intergenic
1000828934 5:166079947-166079969 GAGGAGAGGATTGGAGAATGTGG - Intergenic
1001202426 5:169730299-169730321 GATGGCTGGATGGGAGAAGGAGG + Intronic
1001530701 5:172459463-172459485 GAGGTGTGGAGTGTAGAAGGTGG + Intergenic
1001866744 5:175112888-175112910 GAGAGTGGGTCTGGAGAAGGTGG - Intergenic
1002092610 5:176813900-176813922 GAGGGGTGGCCTAGAACAGGAGG - Intronic
1002205121 5:177557337-177557359 GAAGGATGGAATGGAGAAGAGGG - Intergenic
1002289273 5:178188642-178188664 GGGGGATGGAGTGGAGAAGTGGG + Intergenic
1002675823 5:180911624-180911646 GAGGGGAGGAGAAGAGAAGGAGG + Intronic
1002847623 6:961954-961976 GAGGGATGGCCTGGGGAAGAAGG - Intergenic
1003012590 6:2439674-2439696 GGAAGGTTGACTGGAGAAGGAGG + Intergenic
1003406351 6:5829914-5829936 GACGAGGGGAATGGAGAAGGGGG + Intergenic
1003945401 6:11070866-11070888 GAGGGGTAGGCTGGTGGAGGAGG + Intergenic
1004160241 6:13206171-13206193 GAGGGGTTGGCTGGGGAGGGGGG + Intronic
1004166482 6:13261215-13261237 GAGGGGTGAGCTGGAGGAAGAGG + Intronic
1004523370 6:16382902-16382924 GAGGGGGGGAGTGGGGAGGGTGG + Intronic
1005207925 6:23426365-23426387 GAGGTGAGGGCTGGGGAAGGAGG - Intergenic
1005837904 6:29721654-29721676 GAGGGAAGGGCTGGAGAAGCAGG + Intergenic
1005864021 6:29925050-29925072 GAGGGAAGGGCTGGAGAAGCAGG + Intergenic
1005866447 6:29941295-29941317 GAGGGAAGGGCTGGAGAAGCAGG + Exonic
1006271748 6:32970873-32970895 GAGGGGAGGAGGGGAGGAGGGGG + Exonic
1006286008 6:33094875-33094897 GAAGGATGGGCTGGAGGAGGCGG + Intergenic
1006503045 6:34470044-34470066 GAGGGCTGGGCTGGAGACTGGGG + Intronic
1006535489 6:34696210-34696232 GAGGGGCGGAAGGGAGATGGTGG - Intronic
1006881266 6:37341971-37341993 GATGGGTGGAGAAGAGAAGGTGG + Intergenic
1007116317 6:39345622-39345644 GGGGAGTAGACTGGAGATGGAGG + Intronic
1007231011 6:40347847-40347869 GAGGGGAGGAGGGGAGGAGGGGG - Intergenic
1007275972 6:40674048-40674070 TAGGGGTGGACAGGACAAGATGG + Intergenic
1008884059 6:56412103-56412125 GTGGGGGGGAGGGGAGAAGGAGG + Intergenic
1008884462 6:56417265-56417287 GAGAGGTGGGCTGGAGAGGTGGG - Intergenic
1009593715 6:65708713-65708735 AATGGGGGGAGTGGAGAAGGGGG - Intergenic
1009593803 6:65708945-65708967 GAGGGGTGGAAGGGAGAGGGAGG - Intergenic
1010072376 6:71759053-71759075 GTGGGGTGGATTGGGAAAGGAGG + Intergenic
1010110021 6:72216344-72216366 GAGCTGGGGACAGGAGAAGGTGG - Intronic
1011247452 6:85334531-85334553 TAGTGGTGGACTGGGGAAAGGGG + Intergenic
1011297594 6:85840716-85840738 GAAGGGTGGAATGGCTAAGGTGG - Intergenic
1011632350 6:89339569-89339591 GAGGGGTGGGGAGGGGAAGGGGG + Intronic
1012308728 6:97693617-97693639 TATGGGTGGACTGGATAAGGGGG + Intergenic
1012956568 6:105576951-105576973 GTGGGGAGGACTGGAGAAACAGG - Intergenic
1014244671 6:119055051-119055073 GAGGGGTTGTGAGGAGAAGGGGG - Intronic
1015890664 6:137966967-137966989 AGAGGGTGGACTGGAGATGGTGG + Intergenic
1016187156 6:141210804-141210826 GAGGGGAGGGTTGGAGAAGGGGG + Intergenic
1016398201 6:143649223-143649245 TAGGGATGGAGTGGATAAGGAGG + Intronic
1017637307 6:156456083-156456105 GAGGGGGGGAGTGGAGGAGGGGG - Intergenic
1018844718 6:167547543-167547565 GAGGGATGGGGTGAAGAAGGAGG - Intergenic
1019104046 6:169654703-169654725 GAGGCGCGCACAGGAGAAGGAGG + Intronic
1019223504 6:170493261-170493283 GAGGGGAGGAGAGGAGGAGGAGG + Intergenic
1019223515 6:170493288-170493310 GAGGGGAGGAGAGGAGGAGGAGG + Intergenic
1019223522 6:170493307-170493329 GAGGGGAGGAGAGGAGGAGGAGG + Intergenic
1019223533 6:170493334-170493356 GAGGGGAGGAGAGGAGGAGGAGG + Intergenic
1019223544 6:170493361-170493383 GAGGGGAGGAGAGGAGGAGGAGG + Intergenic
1019422803 7:958850-958872 GGGGTCTGGAGTGGAGAAGGGGG + Intronic
1019496355 7:1342238-1342260 CTGGGGTGGGCTGGAGATGGAGG + Intergenic
1019978898 7:4606517-4606539 GAGGGATGGCCTGGAGTGGGTGG - Intergenic
1021173558 7:17423783-17423805 GAAGGGTGAACTGGGGAGGGAGG - Intergenic
1021874183 7:25033062-25033084 CAGGGGTGGGCTCCAGAAGGGGG + Intergenic
1022003179 7:26245068-26245090 GAGGGTTTGAAGGGAGAAGGGGG - Intergenic
1022230793 7:28410238-28410260 GAGGAGTGGACTGGAGCGGACGG - Intronic
1022270237 7:28800235-28800257 GAAGGCTGGACTGAAGAAAGGGG + Intronic
1022541475 7:31139782-31139804 GAGGGGTGGGCAGGAGGGGGAGG - Intergenic
1022656980 7:32328638-32328660 AAGGGGTGGAGTGGGGATGGGGG - Intergenic
1023112943 7:36832486-36832508 GAAGGCTGGACTGGGGATGGAGG - Intergenic
1023619314 7:42053443-42053465 CAGGGGAGGTATGGAGAAGGCGG + Intronic
1023742828 7:43295625-43295647 GAGGGGAGGAGTGGTGGAGGAGG + Intronic
1023862989 7:44226778-44226800 GAGGGGAGGAAGGGAGAATGGGG + Intronic
1023967607 7:44971011-44971033 GGAGGGTGGGCTGCAGAAGGAGG - Exonic
1024257888 7:47551896-47551918 CAGGGGTGGGGTGGAGAGGGAGG + Intronic
1026205672 7:68255325-68255347 AAGGGGAGGAGGGGAGAAGGAGG - Intergenic
1026776776 7:73235453-73235475 GAGGCGGGGACTGGAGGCGGGGG + Intergenic
1026822202 7:73557362-73557384 GAGGGGGGTGCGGGAGAAGGCGG - Intronic
1027070396 7:75157109-75157131 GAGGCGGGGACTGGAGGCGGGGG - Intergenic
1027244736 7:76359226-76359248 AAGGGGGCGACTGGAGAAGCTGG - Intergenic
1027247024 7:76374299-76374321 GAGGCAGGGGCTGGAGAAGGAGG + Intergenic
1027261515 7:76468075-76468097 GAGGGGAGGAGGGGAGAGGGAGG + Intronic
1027312896 7:76966184-76966206 GAGGGGAGGAGGGGAGAGGGAGG + Intergenic
1028505087 7:91561692-91561714 GAGTGGTGGAGTGGAGTTGGTGG - Intergenic
1028649043 7:93129834-93129856 GACTGGTGGACTGCAGAAGAGGG + Intergenic
1029342427 7:99956035-99956057 GAGGAGTGGGGTGGACAAGGGGG + Intergenic
1030079849 7:105767858-105767880 GAGGGGTGGACTGGAGAAGGAGG - Intronic
1030369118 7:108677049-108677071 GAAGGGTGGAGTGGGGAGGGGGG - Intergenic
1030699467 7:112622379-112622401 GTGGAGAGGACTGGAGTAGGCGG - Intergenic
1031585929 7:123532791-123532813 GAGGGGCAGGCTGGAGAAGGAGG - Exonic
1032446655 7:131989917-131989939 GAGGGCTGGGCTGGAGAATTTGG + Intergenic
1032584943 7:133137734-133137756 GAGGGATGAACTGGCAAAGGAGG + Intergenic
1032610607 7:133408343-133408365 GTGGGGTGGATTGGTGATGGTGG + Intronic
1032718622 7:134532101-134532123 GTGGTGTGGACTGGGGCAGGAGG + Intronic
1033014720 7:137660875-137660897 GAGGGGAGGAAAGGAGAAGAGGG + Intronic
1033360893 7:140638500-140638522 GTGGGGAGGCCTGGAGGAGGAGG - Intronic
1034293199 7:149948525-149948547 GAGGGCTGGGATGGAGAGGGTGG - Intergenic
1034348107 7:150399218-150399240 GAGGAGGGAACTGGAGATGGTGG + Intronic
1034419739 7:150983378-150983400 GAGGGGTGTTCAGAAGAAGGAGG + Intergenic
1034435882 7:151062611-151062633 CAGGGGTGAACCTGAGAAGGAGG - Intronic
1034435953 7:151062867-151062889 GAGGTGGGGACTGGAGCAGCTGG - Intronic
1034526209 7:151664450-151664472 GAGGGCTTGGCTGGAGGAGGAGG - Intronic
1034635633 7:152565271-152565293 GAGGGGTGGGCTGGAGAACAGGG + Intergenic
1034812875 7:154148354-154148376 GAGGGCTGGGATGGAGAGGGTGG + Intronic
1035111570 7:156486636-156486658 GCAGGGTGGAGGGGAGAAGGGGG - Intergenic
1035851457 8:2923052-2923074 GAAGGCTGTACTGGGGAAGGCGG - Intergenic
1036295193 8:7529184-7529206 GAGGGGAGGAGTGGAGGAGGAGG - Intergenic
1036327377 8:7791834-7791856 GAGGGGAGGAGTGGAGGAGGAGG + Intergenic
1036400052 8:8400103-8400125 GAGGGGAGAAGGGGAGAAGGGGG - Intergenic
1036591708 8:10174354-10174376 TAGGGGTGGACTCGGGATGGAGG + Intronic
1036638889 8:10569765-10569787 GAGGGGTGGGAGAGAGAAGGTGG + Intergenic
1037029048 8:14079159-14079181 GAGGGGAGGGCTGGGGAGGGAGG + Intergenic
1037605615 8:20435123-20435145 GAGGAGAGGACGGGAGAAGGAGG - Intergenic
1037722486 8:21456407-21456429 GTGTGCTGGACTGGAGAGGGTGG + Intergenic
1037832871 8:22199419-22199441 GGGGGGTGGGGTGGAGGAGGTGG - Intronic
1037935304 8:22911470-22911492 GAGGGGTGGAGAGAAGGAGGTGG - Intronic
1038397798 8:27259934-27259956 GAGAGGTGTTCTGGAGGAGGGGG - Intergenic
1038399500 8:27272178-27272200 GTGGGGTGGGGTGGGGAAGGCGG - Intergenic
1038423869 8:27452001-27452023 GAGGGGTGGCATTGAGGAGGAGG + Intronic
1039250562 8:35659869-35659891 TAGTGGTGGCCTGGGGAAGGGGG - Intronic
1039475341 8:37836650-37836672 GAGGGATGGACTGAAGGTGGAGG - Intronic
1039868467 8:41526383-41526405 GCGGGGGAGATTGGAGAAGGTGG + Intergenic
1040023829 8:42763843-42763865 GAAGCATGGACTGGAGAATGTGG + Intronic
1040063118 8:43121630-43121652 GGGGAGTGGACTGGAAAAGTGGG - Intronic
1041544528 8:59026954-59026976 GAGGGAAGCAATGGAGAAGGGGG + Intronic
1042369347 8:67973108-67973130 CAGGGGAGGCCTGGAGAAAGGGG - Intronic
1044351187 8:91168360-91168382 GAGAGGAGGGCTGGAGATGGGGG - Intronic
1044429746 8:92095282-92095304 GAGGGGTGGCCAGGAGGAAGGGG - Intronic
1044727248 8:95203621-95203643 CAGGGGTGGAGTGGGGTAGGGGG + Intergenic
1044821941 8:96160870-96160892 GAGGGGAGGAATGGGGAGGGAGG + Intergenic
1045317023 8:101052226-101052248 GAGGGGTGCACTGGGAAAGCTGG - Intergenic
1046946097 8:119975691-119975713 GAGGGGTGGAGTGGAGGGGAAGG + Intronic
1047208165 8:122819939-122819961 GAGGGGAGGCCTGGGGAGGGTGG - Intronic
1047455357 8:125003895-125003917 GTGGGGTGGGGTGGGGAAGGTGG + Intronic
1047609251 8:126504933-126504955 CAGGGTTGGCCTGGAGAGGGTGG - Intergenic
1047742020 8:127814203-127814225 GAGGAAGGGGCTGGAGAAGGAGG - Intergenic
1047785319 8:128148655-128148677 GAGGGGTGGGAAAGAGAAGGAGG + Intergenic
1048280944 8:133105338-133105360 TAGGGGTGGACCGGAGGTGGGGG + Intronic
1048383117 8:133885846-133885868 GAGAGAGAGACTGGAGAAGGAGG + Intergenic
1048466086 8:134665745-134665767 GAGAGATGGACAGGAGAAGGGGG + Intronic
1048701323 8:137093149-137093171 GAGTGGTGGAATGGAGATGGGGG - Intergenic
1049293358 8:141815976-141815998 GTGGAGTGGAGTGGAGGAGGTGG + Intergenic
1049712370 8:144071185-144071207 GAGGGGAGGAGAGGGGAAGGGGG - Intergenic
1049812239 8:144580730-144580752 GAGAGCGGGACTGGTGAAGGTGG - Intronic
1050184827 9:2962169-2962191 GTGGGGTGGCGTGGAGAAGGAGG - Intergenic
1050861958 9:10446113-10446135 AGGGGGTGGGGTGGAGAAGGTGG - Intronic
1051642694 9:19238482-19238504 GAGGGGAGGGGAGGAGAAGGGGG - Intronic
1052774279 9:32718418-32718440 GAGGAGAGGGGTGGAGAAGGGGG - Intergenic
1052820832 9:33136991-33137013 GAGATGTGTACTGGGGAAGGGGG - Intronic
1053214326 9:36258229-36258251 GAGGGGAGGCCTGGGGCAGGAGG + Intronic
1053286929 9:36855711-36855733 TAGGGGTGGAGTGGAGGATGTGG - Intronic
1054759162 9:68989412-68989434 GAGGGCAGGGCTGGGGAAGGTGG - Intronic
1055514905 9:77024141-77024163 GAAGTGGAGACTGGAGAAGGTGG + Intergenic
1056170471 9:83980235-83980257 GCGGGGAGGACGCGAGAAGGCGG - Exonic
1056316501 9:85395454-85395476 GAAGTGAGGTCTGGAGAAGGAGG - Intergenic
1056805003 9:89721645-89721667 GTGGGGTGGGCTGGGGAAGGTGG + Intergenic
1057008446 9:91581307-91581329 GGGGGATGGATTGGAGAGGGAGG - Intronic
1057210534 9:93198818-93198840 GAGGGCAGGGCTGGAAAAGGGGG - Intronic
1057804762 9:98212149-98212171 GGAGGGTGGGCTTGAGAAGGTGG - Intronic
1058446824 9:105062241-105062263 GTGCGGTGGACTGGGGAAGGGGG + Intergenic
1058603731 9:106698309-106698331 GAGGGTTGGACTGGGGAGGAGGG + Intergenic
1059669876 9:116481889-116481911 GAGGGGAGGAGAGGAGCAGGTGG + Intronic
1059732758 9:117073319-117073341 CAGGAGTGGAGTGGAGAAGCAGG - Intronic
1060103729 9:120860896-120860918 GTGGGGAGGGCTGGAGAAGAGGG + Intronic
1060596445 9:124851915-124851937 AAGGGCTGGGCTGGGGAAGGTGG + Intergenic
1061200686 9:129136786-129136808 GTGTGGTGGGCTGGAGGAGGCGG + Intronic
1061218815 9:129237089-129237111 GAGGTGAGGACTGGAGATGAGGG - Intergenic
1061356284 9:130107694-130107716 CAGGGGTAGTTTGGAGAAGGAGG + Intronic
1061449308 9:130659987-130660009 GAGGGGAGCGCTGGGGAAGGAGG + Intergenic
1061531982 9:131221595-131221617 AAGGAGAGGACTGGAGGAGGGGG - Intronic
1061747284 9:132749776-132749798 CAGGGGTGGACTGGAGCTGAGGG + Intronic
1061882109 9:133573738-133573760 GAAGGGTGGGGTGGGGAAGGGGG + Intronic
1062050544 9:134444509-134444531 GAGGGAGGGACGGGGGAAGGAGG - Intergenic
1062081912 9:134628615-134628637 GAGGGCTGGTGTGAAGAAGGAGG - Intergenic
1062083402 9:134636337-134636359 CAGGTGTGCACTGGAGCAGGTGG - Intergenic
1062174484 9:135153395-135153417 GAGGGGTGGTCAGAGGAAGGAGG - Intergenic
1062392535 9:136339656-136339678 GGGGGCTGGCCTGGAGAGGGCGG + Intronic
1062524168 9:136971621-136971643 GAGGGCTGGGCTGGGGAGGGAGG + Exonic
1185734392 X:2485964-2485986 GAGGGTTGGACGGAAGGAGGAGG + Intronic
1186410649 X:9342401-9342423 GAGAGGTGGAGGGGAGAAGGAGG - Intergenic
1186472481 X:9832333-9832355 GAGGGGTGTGCTGCAGAGGGAGG - Intronic
1186760758 X:12719431-12719453 GAGTGGTGGAGTGGTGAAGGTGG - Intronic
1187523631 X:20035009-20035031 GAGGGGTGGAAGGGAGTAGCTGG - Intronic
1187528149 X:20072410-20072432 GATGGATGGACTGGAAAGGGAGG - Intronic
1188662105 X:32773549-32773571 GTGGGGAGGACAGGATAAGGAGG - Intronic
1189251160 X:39601536-39601558 GAGAGGTGGACAGGAGCAAGTGG + Intergenic
1190066061 X:47242519-47242541 GAGGGTGAGACTGCAGAAGGAGG + Exonic
1190260145 X:48792297-48792319 GTGGGGTGGAGAGGAGAAGAGGG - Intronic
1192178218 X:68899050-68899072 GAGGAGGGGAGTGGAGAAGTGGG + Intergenic
1192219020 X:69184440-69184462 TGGGAGTGGAGTGGAGAAGGAGG - Intergenic
1194577948 X:95637461-95637483 GAAGGGGGGACTGGATGAGGAGG + Intergenic
1195129824 X:101840959-101840981 GAGGGGTGGAAGGGATAAGGTGG - Intronic
1195176412 X:102318864-102318886 GAGGGGTGGAAGGGATAAGGTGG + Intronic
1195182452 X:102368229-102368251 GAGGGGTGGAAGGGATAAGGTGG - Intronic
1195272166 X:103242695-103242717 GAGGGAAGGGCTGGAGAAAGAGG - Intergenic
1196297443 X:114015176-114015198 GAGGGGGGGACAGGGGGAGGCGG + Intergenic
1198934989 X:141895723-141895745 GAGGGGTGGAGGGGAGGGGGAGG + Intronic
1200032947 X:153311143-153311165 GGGTGGAGGACTGGGGAAGGAGG - Intergenic
1200136247 X:153876070-153876092 GAGGGGAGGGCTGGAGAAGCCGG - Intronic
1200164810 X:154028771-154028793 GAGAAGTGGACTGGAGGAGCTGG - Intronic
1201119885 Y:10864808-10864830 GTGGGGTGGAATGGAATAGGGGG - Intergenic
1202370525 Y:24192731-24192753 GAGTGGTGGCCTGGGGAAGTTGG - Intergenic
1202500259 Y:25477386-25477408 GAGTGGTGGCCTGGGGAAGTTGG + Intergenic