ID: 1030079850

View in Genome Browser
Species Human (GRCh38)
Location 7:105767861-105767883
Sequence CCAGAGGGGTGGACTGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 437}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030079850_1030079858 -4 Left 1030079850 7:105767861-105767883 CCTTCTCCAGTCCACCCCTCTGG 0: 1
1: 0
2: 4
3: 40
4: 437
Right 1030079858 7:105767880-105767902 CTGGAGTTCGACTGGTACTCAGG No data
1030079850_1030079860 1 Left 1030079850 7:105767861-105767883 CCTTCTCCAGTCCACCCCTCTGG 0: 1
1: 0
2: 4
3: 40
4: 437
Right 1030079860 7:105767885-105767907 GTTCGACTGGTACTCAGGGCTGG No data
1030079850_1030079859 -3 Left 1030079850 7:105767861-105767883 CCTTCTCCAGTCCACCCCTCTGG 0: 1
1: 0
2: 4
3: 40
4: 437
Right 1030079859 7:105767881-105767903 TGGAGTTCGACTGGTACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030079850 Original CRISPR CCAGAGGGGTGGACTGGAGA AGG (reversed) Intronic
900155894 1:1203159-1203181 AGAGAGGGCTGGCCTGGAGACGG + Intergenic
900226865 1:1537056-1537078 GCACAGGGATGGCCTGGAGAGGG - Intronic
900350176 1:2230551-2230573 GCAGAGGGGTGCGCCGGAGAGGG + Intronic
901381281 1:8876493-8876515 CCACAGTGGTGGCCTGGAGATGG - Intronic
901674152 1:10873189-10873211 CCAGATGGGTGGGCTGCAGCTGG + Intergenic
902087389 1:13874017-13874039 CCAGACGGCTTGACTGGAGCTGG + Intergenic
902299855 1:15494048-15494070 CCAGAGGGGTGGTGGGGAGCCGG - Intronic
902585138 1:17434417-17434439 CCAGGTGGGTGGTCTGCAGAGGG + Intronic
903919715 1:26790963-26790985 CCTGAGAGGTGGAAAGGAGATGG - Intronic
903974404 1:27139754-27139776 ATAGAGGGGAGAACTGGAGAAGG - Intronic
904396948 1:30228372-30228394 CCCTAGGGGTGGAGTGGAGCAGG - Intergenic
904462004 1:30685882-30685904 CCAGAGGGGTGCAGAGGAGCTGG - Intergenic
905087983 1:35400752-35400774 CCAGAGGGGCTGACTGCAAAAGG - Intronic
905118974 1:35667123-35667145 CCAGAGGAGAGCTCTGGAGAGGG - Intergenic
905484117 1:38283756-38283778 GCACAGGGATGGACGGGAGACGG - Intergenic
907338754 1:53718629-53718651 GCAGTGGTGTGGGCTGGAGATGG - Intronic
907989042 1:59561173-59561195 CCAGAGGGGTGGAGTGGGATGGG + Intronic
908245058 1:62221345-62221367 CCATAAGGGTGGGGTGGAGAAGG - Intergenic
908789795 1:67770272-67770294 CAAGGTGGGTGGAATGGAGAGGG + Intronic
908794744 1:67819923-67819945 ACAGAGAGATGGACTGGGGATGG - Intronic
909257504 1:73442959-73442981 CCAGAGGTGGGGATTGGAGAGGG - Intergenic
910574654 1:88747083-88747105 CCAGAGGCTTGAACTGGGGAGGG + Intronic
911158124 1:94656306-94656328 TCAGAGGGGTGGATTGGAAGAGG + Intergenic
911440452 1:97920545-97920567 CCAGAGAGGTGGACTCTAGGGGG - Intronic
912510864 1:110189389-110189411 CCTTCGGGATGGACTGGAGATGG - Intronic
913180546 1:116316940-116316962 TCACAGGAGTGGGCTGGAGAGGG - Intergenic
914462634 1:147898915-147898937 CCAGAGGGATTGACTGAGGATGG + Intergenic
915328154 1:155091990-155092012 ACAGAGGCGTGGACTGGAGGTGG + Intergenic
915596689 1:156900326-156900348 CCAGGGGATTGGACAGGAGAAGG - Intronic
916875472 1:168964057-168964079 TCAGAGGGGTGGGCAGGAGGGGG - Intergenic
917188517 1:172388667-172388689 CCAGAGTGGGGGCCAGGAGAGGG - Exonic
917499101 1:175569921-175569943 CCTGAGGGGTAGACTGGAAGAGG - Intronic
917845323 1:179015466-179015488 ACAGAGAGGTGGATTGGAGTAGG - Intergenic
919943845 1:202306070-202306092 CCAGTGGGATGGACCGGAGAAGG + Intronic
920301187 1:204990060-204990082 CTAGAGTGGTGGGCTGGGGAAGG - Intronic
920377627 1:205517744-205517766 CCAGCGGGGGGCAGTGGAGATGG - Intronic
920777157 1:208951098-208951120 CCAGAGGGTTGGAATGGTGAAGG + Intergenic
924553455 1:245099209-245099231 CCGGAGCAGTGGACTGGGGAGGG - Intronic
1063172020 10:3517569-3517591 CCAGAAGTGTGGAGTGGAGGGGG - Intergenic
1065609507 10:27458150-27458172 CAAGATGAGTGGTCTGGAGATGG - Intergenic
1065810706 10:29440581-29440603 CAAGATGAGTGGTCTGGAGATGG - Intergenic
1067229645 10:44397407-44397429 AAAGAGGGGAGGACAGGAGAGGG + Intergenic
1069340474 10:67403213-67403235 CCAGTGGGGTGGAATGGATTGGG - Intronic
1070656904 10:78277928-78277950 CCAGCCCGGTGGAGTGGAGAAGG + Intergenic
1071944390 10:90625616-90625638 GCAGAGGGGAGAGCTGGAGATGG + Intergenic
1072039117 10:91590803-91590825 CCACAGATGTGGGCTGGAGACGG - Intergenic
1072641311 10:97213360-97213382 CCTGAGGGGTAGACAGGAAAGGG - Intronic
1072884827 10:99263863-99263885 CAAGAGTGGTGGACTGGGGATGG - Intergenic
1073412482 10:103353312-103353334 CCAGACGTTGGGACTGGAGAAGG - Intergenic
1074065343 10:110008165-110008187 CCAGAGGGTAGGGCGGGAGAAGG - Exonic
1074428012 10:113369068-113369090 CCAGAAAGGTGGGCTGGAGTTGG + Intergenic
1074787961 10:116858109-116858131 CCAGATGGGTGGTTTGGGGAGGG - Intronic
1075160565 10:120021080-120021102 CCAGAGGGCAGGACTGGGGCAGG + Intergenic
1075399451 10:122150556-122150578 AAAGAGGGGTGGCCAGGAGACGG + Intronic
1076656217 10:132025365-132025387 CAAGATGGGTGGGCTGAAGACGG - Intergenic
1076726890 10:132418128-132418150 CCAGCAGGGAGGCCTGGAGATGG - Intergenic
1078840528 11:15072950-15072972 CCAGAGGAGTGAGGTGGAGAAGG + Intronic
1079125363 11:17714677-17714699 TGAGAGGGGAGGACTGGAAAGGG + Intergenic
1079290560 11:19184542-19184564 GCAGAGGGGGTGACTGGAGGAGG - Intronic
1080384078 11:31800132-31800154 CCAGAGGGGCGAACGGGGGAGGG + Intronic
1081649787 11:44816103-44816125 CAAGACTGCTGGACTGGAGAAGG + Intronic
1082112448 11:48292431-48292453 CCAGAGGGGTGGAGCTAAGATGG + Intergenic
1083352770 11:62042702-62042724 GCAGAGGAGTGGATTGGAAAAGG + Intergenic
1083431739 11:62616821-62616843 ACAGAGGGGTGGTCCGGGGAAGG + Intronic
1083864452 11:65446022-65446044 CCTGAGGCCTGGGCTGGAGATGG + Intergenic
1083885356 11:65570813-65570835 CCAGAGGGGAGGGCCGGGGAAGG - Intronic
1083958803 11:66002608-66002630 CCAGAGGGGTTGCGGGGAGAAGG + Intronic
1084793562 11:71489967-71489989 GCAGCGGGGTGGGGTGGAGAAGG + Intronic
1084831041 11:71769598-71769620 CCAGAGTTGGGGACTGCAGAGGG - Intergenic
1084948821 11:72653606-72653628 AGAGAGGAGAGGACTGGAGAGGG + Intronic
1085196165 11:74673089-74673111 CCAGAGAGGTGGAGGGGAGAGGG - Intergenic
1086887785 11:92224736-92224758 CGCGAGGGGGAGACTGGAGAGGG + Intergenic
1088900832 11:114115792-114115814 CCAGAGGAGGGGAGGGGAGAAGG + Intronic
1088915090 11:114221554-114221576 ACAGTGGGGTGGAGTGGAGAAGG - Intronic
1089209237 11:116789424-116789446 CCAGAGGGAGGGGCTGGAGATGG + Exonic
1089514036 11:119020273-119020295 CCAGAGGAGTGTGATGGAGAAGG + Intronic
1089514048 11:119020335-119020357 CCAGAGGAGTGTGGTGGAGAAGG + Intronic
1089874125 11:121703676-121703698 GCAGAGGGGAGGAGAGGAGAGGG + Intergenic
1091119835 11:133047690-133047712 CCTGAGGAGTGGGCTGGGGATGG - Intronic
1091240086 11:134046351-134046373 CCAGAAGGGAGGACTGCAGAGGG - Intergenic
1091635269 12:2192364-2192386 TCAGGGGTGGGGACTGGAGAGGG - Intronic
1091788901 12:3259937-3259959 AGAGATGGATGGACTGGAGATGG + Intronic
1092411653 12:8257677-8257699 CCAGAGTTGGGGACTGCAGAGGG + Intergenic
1093666284 12:21817235-21817257 CCAGATGGGTGCAGTGAAGAAGG - Exonic
1093985580 12:25528735-25528757 CCAGAGGGCTTCACTGCAGATGG - Intronic
1095357887 12:41297704-41297726 CCACTGGGGTTGGCTGGAGAAGG - Intronic
1095977737 12:47951345-47951367 CCTGAGGGGTAGGCTGGAGATGG - Intergenic
1096497379 12:52046218-52046240 CCAGAGGGTAGGGGTGGAGATGG - Intronic
1096799586 12:54101272-54101294 CCAGAGAGGGGCACTGGGGATGG + Intergenic
1097335955 12:58383508-58383530 CCAGAGGGGAGAAGAGGAGAAGG + Intergenic
1098341190 12:69453030-69453052 ACAGAGCTGTGGACTGGAGGAGG - Intergenic
1101005490 12:100397502-100397524 CCACAGGGGTAGCTTGGAGATGG - Intronic
1101205294 12:102481262-102481284 CCAGAGTGGTGGGGTGGGGAGGG - Intergenic
1101599275 12:106194690-106194712 CCAGCTGGGAAGACTGGAGAAGG - Intergenic
1102815133 12:115859287-115859309 CCAGTGTGGTGGCCTGAAGAAGG - Intergenic
1103362957 12:120364495-120364517 GCTCTGGGGTGGACTGGAGAGGG - Intronic
1103408035 12:120689428-120689450 CCAGATTGGTAGAATGGAGAGGG - Intronic
1104164888 12:126218119-126218141 CCAAAGGGCTGGTCTGGACATGG + Intergenic
1104718863 12:131033632-131033654 CCGGTGGAGTGGACTGGAGCCGG + Intronic
1106672635 13:31922928-31922950 ACACAGGTGTGGAATGGAGAAGG + Intergenic
1107449770 13:40497886-40497908 ACAGAGGGTTGGAAAGGAGAGGG - Intergenic
1111022983 13:82479189-82479211 AGAGAGGGGTGGGCAGGAGAAGG - Intergenic
1112105233 13:96232651-96232673 CCAGAGACAAGGACTGGAGAGGG + Intronic
1112576177 13:100638737-100638759 CCAGCTGGCTGGAATGGAGATGG + Intronic
1113444738 13:110356543-110356565 CCAGAGAGGTGGGCAGGAGTGGG - Intronic
1113460137 13:110476557-110476579 CCAGGGGGGTGCACAGGAGGGGG - Intronic
1113790958 13:113027883-113027905 CCAGAGGGGTGTCCTGGGGAGGG + Intronic
1113800616 13:113084626-113084648 GCACAGGCGTGGAGTGGAGACGG - Intronic
1114185635 14:20399833-20399855 CCAGAGGGAGGAAGTGGAGATGG + Intronic
1114244756 14:20902351-20902373 CCAGGTGGCTGGACTGCAGAAGG - Intergenic
1114247756 14:20930501-20930523 CCAGGTGGCTGGACTGGAGAAGG - Intergenic
1114655238 14:24311696-24311718 CCCGGGGGGTGGGATGGAGAAGG + Exonic
1115476077 14:33814107-33814129 GTAGAGGGGTGGATTTGAGAGGG + Intergenic
1115727273 14:36230865-36230887 CCAGAAGAGTGCAATGGAGATGG - Intergenic
1116393966 14:44426000-44426022 GGAGTGGGGAGGACTGGAGATGG + Intergenic
1118612612 14:67553502-67553524 CCAGGGAGGTGCCCTGGAGAAGG - Intronic
1119687289 14:76643039-76643061 CCAGAGAGGAGGGCAGGAGAAGG - Intergenic
1119768474 14:77205624-77205646 ACAGAGGGGAGGAATGGAGGGGG + Intronic
1121079572 14:91096672-91096694 CCAGGGGGGTGGGCAGGGGAAGG - Intronic
1121552585 14:94813624-94813646 CCAGAGAGGGGGACAGGGGATGG + Intergenic
1122203879 14:100138728-100138750 CCTGAGGGGTGCTCTGGACAGGG + Intronic
1122244129 14:100389616-100389638 CCAGAGGGGAGGCCAGGTGAAGG - Intronic
1122632647 14:103114024-103114046 CCAGGGGGGTGGCCAGGAGTGGG + Intergenic
1122840758 14:104461595-104461617 CAAGGGGGGTGGACGGGGGACGG + Intergenic
1123004898 14:105316422-105316444 TCAGAGGGGCAGACAGGAGAAGG - Intronic
1123034979 14:105468312-105468334 CCAGAGCGGTGGACAGCAGAGGG - Intronic
1123131775 14:105993064-105993086 CTAGAGGGGTGGACTGGGAAAGG - Intergenic
1123149535 14:106167526-106167548 CTGGAGGGGTGGACTGGAAAAGG - Intergenic
1123173042 14:106391873-106391895 CTGGAGGGGTGGACTGGAAAAGG - Intergenic
1123458404 15:20445868-20445890 TGAGAGGTGTGGACTGGAAATGG - Intergenic
1123582008 15:21724192-21724214 CTGGAGGGGTGGACTGGGAAAGG - Intergenic
1123618655 15:22166788-22166810 CTGGAGGGGTGGACTGGGAAAGG - Intergenic
1123659661 15:22554541-22554563 TGAGAGGTGTGGACTGGAAATGG + Intergenic
1123722827 15:23074754-23074776 AAAGAGGGGTGGAAGGGAGAAGG + Intergenic
1124264697 15:28222037-28222059 TGAGAGGTGTGGACTGGAAATGG - Exonic
1124313522 15:28649036-28649058 TGAGAGGTGTGGACTGGAAATGG + Intergenic
1124597253 15:31101660-31101682 CCACAGCAGTGGAATGGAGAGGG + Intronic
1125204075 15:37131349-37131371 GAAGAGGGATGGACTGAAGAGGG + Intergenic
1125360133 15:38856508-38856530 CCAGGGTGGTGCTCTGGAGAAGG - Intergenic
1126323463 15:47449383-47449405 CAAGAGGGTCTGACTGGAGAAGG + Intronic
1126578588 15:50221394-50221416 CCAGAGAGGTGGACTGATGCTGG - Intronic
1128234806 15:66060066-66060088 ACAGAGGGATGGACAGCAGAGGG + Intronic
1128715642 15:69905636-69905658 TCAGATGGATGGACTGGACAAGG + Intergenic
1128935410 15:71742159-71742181 CCACCAGGGAGGACTGGAGAAGG - Intronic
1129884046 15:79026392-79026414 GCAGAGTGGTGGCCTGGAGCAGG - Intronic
1130041718 15:80410511-80410533 CCAGAGATCTGGGCTGGAGAAGG + Intronic
1131313823 15:91314863-91314885 CCAGAAGGCTAGACTGGTGATGG + Intergenic
1131473366 15:92714968-92714990 CCAGAGAGCCGGAGTGGAGAGGG - Intronic
1132062597 15:98704722-98704744 CCAGAGCGGTGTCCTGCAGAGGG + Intronic
1132935675 16:2479575-2479597 CCTGAGGGGTGGAATGGATGAGG + Intronic
1133115892 16:3577771-3577793 CCACAGGGGTGGCCTGGAGGTGG - Intergenic
1135498492 16:22973419-22973441 CCAGAGGGGTGGGAAGGAGTGGG + Intergenic
1135707624 16:24688402-24688424 CCAGAAGGGTGGAGAGGAGGTGG - Intergenic
1136627991 16:31473356-31473378 CCAGTGGGCAGTACTGGAGAAGG - Intronic
1136680522 16:31959259-31959281 CTGGAGGGGTGGACTGGAAAAGG + Intergenic
1136702859 16:32159165-32159187 TGAGAGGTGTGGACTGGAAATGG - Intergenic
1136764840 16:32768431-32768453 TGAGAGGTGTGGACTGGAAATGG + Intergenic
1136780863 16:32900805-32900827 CTGGAGGGGTGGACTGGAAAAGG + Intergenic
1136803259 16:33101953-33101975 TGAGAGGTGTGGACTGGAAATGG - Intergenic
1136889552 16:33958864-33958886 CTGGAGGGGTGGACTAGAAAAGG - Intergenic
1138461614 16:57151732-57151754 CCAGAGGGGTGGGGCGGAGGGGG - Intergenic
1139352170 16:66343580-66343602 CCAGTGAAGTGGCCTGGAGAAGG - Intergenic
1139655758 16:68386554-68386576 CCAGAGGGGTGGGGTGGGGGTGG - Intronic
1141174626 16:81710797-81710819 TTACCGGGGTGGACTGGAGAGGG - Exonic
1141187207 16:81796443-81796465 GCATAGGGGTGGATTGGAGGTGG + Intronic
1141759292 16:86016931-86016953 CCAGTGGGTTGGACTAGAGATGG + Intergenic
1141790536 16:86231300-86231322 CGAAAGGGGTGGACTGGATCTGG - Intergenic
1142306260 16:89287584-89287606 CCAGAGACGTGAACTGGAAAAGG - Intronic
1203067197 16_KI270728v1_random:1030556-1030578 TGAGAGGTGTGGACTGGAAATGG + Intergenic
1203083515 16_KI270728v1_random:1164834-1164856 CTGGAGGGGTGGACTGGAAAAGG + Intergenic
1142663185 17:1445487-1445509 TCCGAGGGCAGGACTGGAGAGGG + Intronic
1142977835 17:3656121-3656143 CCAGGGGCGAGGACTGGCGAGGG - Intronic
1143858845 17:9873124-9873146 CCAGCAGGGTGGACTAGAGCAGG - Intronic
1144415738 17:15044409-15044431 ACAGGTGGGTTGACTGGAGAGGG - Intergenic
1144579571 17:16450764-16450786 AGAGAGGGGTGGACAGGAGGTGG + Intronic
1146657665 17:34644634-34644656 TCAGAGAGGTAGCCTGGAGAAGG + Intergenic
1147769405 17:42857153-42857175 CCATAGGGCTGGAGAGGAGACGG - Exonic
1147918552 17:43902506-43902528 CCAGCAGGCTGGACAGGAGATGG + Intronic
1148026593 17:44593197-44593219 CCAGAGTGGTGGGTTGGGGAGGG + Intergenic
1148382577 17:47210382-47210404 GGAGAGGGGTGGGCTGAAGAGGG + Intronic
1148386797 17:47239910-47239932 CCAGAGGGGTGGAGAGGAGAGGG + Intergenic
1148489058 17:48011773-48011795 CCAGAGGGGCAAACTGGGGAGGG + Intergenic
1148785064 17:50142236-50142258 CCAGGGAGGTGGAGTGGAGGAGG - Intronic
1148835298 17:50462778-50462800 CAAGAGGGCTGGAGTGGAGAGGG - Intronic
1148895657 17:50837661-50837683 GCAGAGGGCTGACCTGGAGAGGG + Intronic
1149458992 17:56811989-56812011 CCAGAGGGGTGGCCTGGGGTGGG - Intronic
1149659743 17:58327968-58327990 CCAGGTGGGGGGACTGGCGAGGG + Exonic
1150416898 17:64995369-64995391 CCAGAGTGGCTGGCTGGAGAAGG + Intergenic
1150794770 17:68228556-68228578 CCAGAGTGGCTGGCTGGAGAAGG - Intergenic
1152201794 17:78951723-78951745 CCACAGGGCTGTCCTGGAGAGGG + Intergenic
1152667226 17:81578116-81578138 CAGGAGGGGTGGTCTGGAGGCGG - Intronic
1156484271 18:37455089-37455111 CCAGAGGTTTTGAGTGGAGAGGG - Intronic
1157523861 18:48363946-48363968 CCTGAGGGGTGGAGTGGGTATGG - Intronic
1157739734 18:50081747-50081769 GCAGAGGGGTGGAATAGAAAAGG - Intronic
1159789690 18:72763412-72763434 CAAGATGAGTGGACTGGGGAGGG - Intronic
1160079036 18:75704972-75704994 CCAGTGGGCTGGACTGGGGTGGG - Intergenic
1160288024 18:77564684-77564706 ACAGAGGGCTGGCCTGGAGAGGG - Intergenic
1160317224 18:77859267-77859289 CCAGTGGGGAGCACCGGAGAAGG - Intergenic
1160557161 18:79733453-79733475 CCGCAGGGGTGTACAGGAGACGG - Intronic
1160739987 19:681165-681187 CCTGAGGGGTGGAATGGAGAGGG + Intronic
1161086111 19:2335551-2335573 CCAGAGGGATGCAGTGGAAAAGG - Intronic
1161220086 19:3114344-3114366 CCAGAGGGCTGGGCAGGAAAAGG + Intronic
1161649820 19:5477710-5477732 GCAGAGTGGTGGCCTGGAGGTGG - Intergenic
1162756822 19:12865781-12865803 CCAGAGGGTTGGTCTGCAGGAGG - Exonic
1163783982 19:19265017-19265039 ACAGATAGATGGACTGGAGATGG - Intronic
1164320524 19:24140208-24140230 ACAGAAAGGTGGACAGGAGAGGG - Intergenic
1164576240 19:29407039-29407061 CCAGAGGGGTGCTGGGGAGAGGG - Intergenic
1165109553 19:33493797-33493819 CCAGAGGGTGGGATTGGGGAAGG - Intronic
1165117438 19:33537384-33537406 CCAGAGGGGCAGTCAGGAGAAGG - Intergenic
1165419850 19:35717487-35717509 CAGGAGGCGTGGGCTGGAGAAGG - Intergenic
1167319072 19:48784541-48784563 CCTGAGGGGTGGACTAGAACAGG + Intergenic
1167761117 19:51449990-51450012 ACAGAGGGAGGGGCTGGAGATGG - Intergenic
1168114092 19:54211347-54211369 TGAGAGGGATGGACTGGAGTAGG + Intronic
1168513828 19:56994335-56994357 CCAGAGGGATGGATGTGAGAAGG + Intergenic
1168701774 19:58444259-58444281 CTGGAGGGGAGGACGGGAGAAGG - Intergenic
925075384 2:1012558-1012580 AGAGAAGGGTGGTCTGGAGAAGG + Intronic
925075405 2:1012669-1012691 AGAGAAGGGTGGTCTGGAGAAGG + Intronic
925075418 2:1012743-1012765 AGAGAAGGGTGGTCTGGAGAAGG + Intronic
925075432 2:1012817-1012839 AGAGAAGGGTGGTCTGGAGAAGG + Intronic
925075444 2:1012891-1012913 AGAGAAGGGTGGTCTGGAGAAGG + Intronic
925075466 2:1013002-1013024 AGAGAAGGGTGGTCTGGAGAGGG + Intronic
925075474 2:1013039-1013061 AGAGAAGGGTGGTCTGGAGAGGG + Intronic
925075489 2:1013113-1013135 AGAGAAGGGTGGTCTGGAGAGGG + Intronic
925075497 2:1013150-1013172 AGAGAAGGGTGGTCTGGAGAGGG + Intronic
925075519 2:1013261-1013283 AGAGAAGGGTGGTCTGGAGAGGG + Intronic
925075534 2:1013335-1013357 AGAGAAGGGTGGTCTGGAGAGGG + Intronic
925075542 2:1013372-1013394 AGAGAAGGGTGGTCTGGAGAGGG + Intronic
925075550 2:1013409-1013431 AGAGAAGGGTGGTCTGGAGAGGG + Intronic
925075572 2:1013520-1013542 AGAGAAGGGTGGTCTGGAGAGGG + Intronic
925075593 2:1013631-1013653 AGAGAAGGGTGGTCTGGAGAAGG + Intronic
925075608 2:1013705-1013727 AGAGAAGGGTGGTCTGGAGAGGG + Intronic
925075623 2:1013779-1013801 AGAGAAGGGTGGTCTGGAGAGGG + Intronic
925075631 2:1013816-1013838 AGAGAAGGGTGGTCTGGAGAGGG + Intronic
925075639 2:1013853-1013875 AGAGAAGGGTGGTCTGGAGAGGG + Intronic
925075646 2:1013890-1013912 AGAGAAGGGTGGTCTGGAGAAGG + Intronic
925075661 2:1013964-1013986 AGAGAAGGGTGGTCTGGAGAGGG + Intronic
925075675 2:1014038-1014060 AGAGAAGGGTGGTCTGGAGAAGG + Intronic
925075683 2:1014075-1014097 AGAGAAGGGTGGTCTGGAGAGGG + Intronic
925075690 2:1014112-1014134 AGAGAAGGGTGGTCTGGAGAAGG + Intronic
925075704 2:1014186-1014208 AGAGAAGGGTGGTCTGGAGAAGG + Intronic
925075718 2:1014260-1014282 AGAGAAGGGTGGTCTGGAGAAGG + Intronic
925075733 2:1014334-1014356 AGAGAAGGGTGGTCTGGAGAGGG + Intronic
925075759 2:1014482-1014504 AGAGAAGGGTGGTCTGGAGAGGG + Intronic
925075766 2:1014519-1014541 AAAGAAGGGTGGTCTGGAGAAGG + Intronic
925075773 2:1014556-1014578 AGAGAAGGGTGGTCTGGAGAAGG + Intronic
925075781 2:1014593-1014615 AGAGAAGGGTGGTCTGGAGAGGG + Intronic
925075809 2:1014743-1014765 AGAGAAGGGTGGTCTGGAGAAGG + Intronic
925075814 2:1014780-1014802 AGAGAAGGGTGGTCTGGAGAAGG + Intronic
925212457 2:2061561-2061583 CCAGAGGGATGGAGGGAAGAGGG + Intronic
925742462 2:7018059-7018081 CCAGGAGGGTGGACAGGAGGTGG + Intronic
925920418 2:8634164-8634186 AGAGAGGTGAGGACTGGAGAAGG - Intergenic
926062829 2:9814666-9814688 ACAAAGAGGTGGGCTGGAGAGGG + Intergenic
926116654 2:10217799-10217821 AGAGAGGGGTGGGCTGGGGAGGG - Intergenic
926125622 2:10270101-10270123 CCAGAGGGGTGGCCTGGCAAGGG - Intergenic
926687944 2:15712411-15712433 CCACAGGTTTGGGCTGGAGAAGG + Intronic
927606388 2:24490922-24490944 CCCGAGGGGAGGGCAGGAGAGGG + Intergenic
928086767 2:28350854-28350876 CCAGAGTGGAGGGCTGGGGAGGG + Intergenic
928282130 2:29957066-29957088 CCAGGGGAGTGGACTTGATATGG - Intergenic
929276787 2:40034454-40034476 TCAAAGGGGTGGACTGTAGCGGG - Intergenic
929562281 2:42963386-42963408 CCAGAGGTGAGGATTGGGGAGGG + Intergenic
930102984 2:47617520-47617542 GCAAAGGGCTGGAATGGAGAGGG - Intergenic
930565745 2:53018315-53018337 CTAGAGTGGTGTGCTGGAGATGG - Intergenic
931426570 2:62177190-62177212 GCAGAGGGGTTGTATGGAGAGGG + Intergenic
931994180 2:67824015-67824037 CTAGAGGAGTGGAGAGGAGAGGG - Intergenic
932576282 2:72963960-72963982 CCAGTGCGCTGGACTGGGGATGG + Intronic
932599460 2:73113390-73113412 CCGCAGGGGCGGACTGGAGGAGG - Intronic
932793998 2:74679723-74679745 CCGGCGGGATGGACTGGAGGTGG + Exonic
933624669 2:84585596-84585618 GCAGAGAGGAGGCCTGGAGAGGG + Intronic
934554113 2:95278414-95278436 CTAGAAGGGTGGACTGGAGCTGG + Intronic
934963982 2:98703828-98703850 CCAGAGAGTTGGAGTGAAGAGGG - Intronic
935572196 2:104673582-104673604 CCAGGCGGGTGGACTGAGGAGGG - Intergenic
935661079 2:105467541-105467563 CCAGAGGGAGGGACTGGATGGGG + Intergenic
936033321 2:109089161-109089183 CCAGATGGGTGGGATGGGGAGGG + Intergenic
936161251 2:110085797-110085819 CCTGAGGGGTGGGCAGGAGCTGG - Intronic
936183412 2:110285557-110285579 CCTGAGGGGTGGGCAGGAGCTGG + Intergenic
936749340 2:115622169-115622191 CATGAGGGGTGGACAGCAGAGGG - Intronic
936761253 2:115786349-115786371 CCAGAGGGGCAGACTGGAATTGG + Intronic
937648752 2:124296853-124296875 TCAGAGGGTGAGACTGGAGAAGG + Intronic
937758683 2:125573047-125573069 CCAGAGAGGTGGAAGGGAGTAGG - Intergenic
937908449 2:127064088-127064110 CAAGAGGGGTGGGCAGGAGGTGG - Intronic
938265303 2:129923768-129923790 CCAGTGGGGTGCAGTGGAAAAGG + Intergenic
940112014 2:150165438-150165460 AAAGAGAGGTGGACTGGGGATGG + Intergenic
940163643 2:150742938-150742960 GCAGAGGGGTGGTCAGGTGAGGG - Intergenic
940339651 2:152566872-152566894 CCAGAGGGGTGGCTGGGAAAAGG + Intronic
940569770 2:155416793-155416815 CCAGAGTCGTGGGCTGGAGTGGG - Intergenic
942462547 2:176178297-176178319 CCCGCGAGGAGGACTGGAGAAGG + Intergenic
944770875 2:202912662-202912684 CCAGAGGGGCAGGCTGGAGAAGG + Intronic
947664394 2:231894583-231894605 CCAGAGGGATGGAGCGGAGTAGG - Intergenic
948254204 2:236554134-236554156 CCAGAAGGGAGGAAGGGAGAGGG - Intergenic
948344557 2:237284488-237284510 AAAGAGGTGTGGACTAGAGATGG - Intergenic
948528824 2:238589955-238589977 CCAGAGGGGAGGGCAGGAGTGGG + Intergenic
948912849 2:241013431-241013453 CCAGCGGGGTGGGGTGGAGTGGG - Intronic
948960596 2:241332949-241332971 CCTGCGGTGGGGACTGGAGAGGG + Intronic
1168804205 20:663138-663160 CCAGAGGGATGGTCTGGGGTTGG + Exonic
1169467730 20:5856368-5856390 CCATAGGGCTGGGCTGGAGGTGG + Intronic
1169584267 20:7062234-7062256 ACAGTGGGGTGGAGTAGAGAAGG - Intergenic
1170043871 20:12065610-12065632 CCAGTCCCGTGGACTGGAGAGGG - Intergenic
1170310351 20:14984858-14984880 CCTGAGAGGTGGAGTGGAGCAGG - Intronic
1170318089 20:15064228-15064250 CTAGAGAGGTGAGCTGGAGAAGG - Intronic
1170763858 20:19274033-19274055 CCAGAGGGGAAGAGGGGAGAAGG - Intronic
1171028734 20:21656728-21656750 CCAGAGTGGTGGTATGGTGAAGG - Intergenic
1171796845 20:29573073-29573095 CCAGAGAGGGGCACTGGGGATGG - Intergenic
1171851403 20:30311090-30311112 CCAGAGAGGGGCACTGGGGATGG + Intergenic
1172191991 20:33067660-33067682 CCAGAGAGTAGGAGTGGAGAGGG + Intronic
1172803415 20:37594281-37594303 CCAGAGGTGGTGACGGGAGAAGG + Intergenic
1173186400 20:40843698-40843720 CCAGAGGGGTGGGATGGGGAAGG - Intergenic
1173643824 20:44621474-44621496 GCAGAGGGGAAGGCTGGAGAGGG - Intronic
1174044626 20:47724703-47724725 TCAGAGGGATGGACTAGAGGAGG + Intronic
1174463527 20:50699716-50699738 CCAGAGTGGGGGCTTGGAGAAGG - Intergenic
1174659661 20:52200812-52200834 GCTGAGGGGTGGAAGGGAGAAGG + Intronic
1175273788 20:57753796-57753818 CTAGGAGGGTGGACTGGAGCTGG + Intergenic
1175390485 20:58624310-58624332 CCAGAGACATGGACTGGAAATGG - Intergenic
1175520099 20:59597103-59597125 CCAGAGGGATGAGCTGGAGCTGG + Intronic
1175813008 20:61868815-61868837 CCAGAGGGGAGGGCGGGAGACGG + Intronic
1176100494 20:63362270-63362292 CCAGAGGCCTGTGCTGGAGAGGG - Intronic
1178244413 21:30936857-30936879 GCAGAGAGGGGCACTGGAGAGGG - Intergenic
1178641242 21:34346008-34346030 CCGGAGGGGAGGACGGGACATGG - Intergenic
1178801097 21:35796402-35796424 CCAGAGGGGTGGAGAGTAGATGG + Intronic
1179179590 21:39034409-39034431 CCGGAGGCGGGGACAGGAGAGGG - Intergenic
1179936316 21:44606864-44606886 CCAGAGGAGAGGAATGGGGAAGG + Intronic
1180047235 21:45313514-45313536 CCAGCGGAGTGGAGTTGAGAGGG + Intergenic
1180105859 21:45617625-45617647 ACAGAGGTGTGTGCTGGAGATGG + Intergenic
1181052996 22:20246484-20246506 GCAGAGGGGAGGGGTGGAGAAGG + Intronic
1181351327 22:22260513-22260535 CAGGAGGGGGGGACTGGAGGAGG + Intergenic
1181916143 22:26281792-26281814 CCAGAGGGGTGGGCAGGGGTAGG - Intronic
1182346748 22:29671727-29671749 CCAAAAGGGGAGACTGGAGATGG + Intronic
1182478882 22:30593514-30593536 GGAAAGGGATGGACTGGAGAGGG + Intronic
1182548963 22:31090953-31090975 CAAGGGGGGTGGACTCTAGAAGG - Exonic
1184114444 22:42414231-42414253 CCAGAGGGGAGCCCTGGAGGGGG - Intronic
1184468820 22:44684089-44684111 CCAGAGGGGTGGGCTGAGGAGGG + Intronic
1184857930 22:47156653-47156675 CCCCAGGAGTGGACAGGAGAAGG - Intronic
1185393974 22:50577624-50577646 CCAGAGGGGTGCACAGGATGTGG - Intronic
950457872 3:13103369-13103391 CCACAGAGGTGGAGGGGAGAGGG - Intergenic
950783143 3:15409647-15409669 GCAGAGGGGAGGACAGGTGATGG + Intronic
951067815 3:18288161-18288183 CCAGTTGTGTGGAATGGAGATGG + Intronic
951345068 3:21537963-21537985 CCAAAGGGGTGGCATGAAGATGG + Intronic
953566139 3:44033481-44033503 CCAGAGGTGTGGACTGGGGAAGG - Intergenic
953609217 3:44433593-44433615 CCAGGGAGGGAGACTGGAGAAGG + Intergenic
954222072 3:49161015-49161037 CCTGTGGGGTGGGGTGGAGAGGG - Intergenic
954713516 3:52516233-52516255 CCGGAGGTGAGGACTGGGGAGGG + Exonic
957056874 3:75449949-75449971 CCAGAGTTGGGGACTGCAGAGGG + Intergenic
958636297 3:96750875-96750897 GCAGAGAGGAGGCCTGGAGAGGG - Intergenic
959565248 3:107826594-107826616 GCAGAGGGGTCGACTGTTGACGG - Intergenic
960289230 3:115863280-115863302 CCTGAGGGGTGGACCTCAGAGGG + Intronic
961171548 3:124801123-124801145 CCCGAGGAGTGGACGGGAGCGGG + Intronic
961171685 3:124801843-124801865 CAAGAGGAGTGGGCTGGGGAGGG - Intronic
961296597 3:125889767-125889789 CCAGAGTTGGGGACTGCAGAGGG - Intergenic
961566629 3:127768715-127768737 CTGGAGGGGTGGACAGGACAGGG - Intronic
962344205 3:134607810-134607832 CCAGGGGAGTGGGCTGGAAACGG + Intronic
962594251 3:136923602-136923624 CCAGTGGGGTGGATGGGAGAGGG + Intronic
962697021 3:137959992-137960014 CCACAGGGCGGGACTGGGGAGGG + Intergenic
965778873 3:172262248-172262270 CCAGAGGGGTTGGGTGGAGACGG + Intronic
965910539 3:173769656-173769678 ACAGAGGGCAGGATTGGAGATGG + Intronic
966525223 3:180912616-180912638 CCAGAGGGGAGGAGGGGGGAGGG - Exonic
966914223 3:184576011-184576033 CCAGAGGGAAGGCCTGCAGAGGG - Intronic
967832330 3:193930898-193930920 ACACAGGGGTGCACTGGAGCTGG - Intergenic
968287413 3:197517173-197517195 CCTGAGGGGTGGGGTGAAGACGG - Intronic
968999694 4:3970235-3970257 CCAGAGTTGGGGACTGCAGAGGG + Intergenic
969141384 4:5077324-5077346 CAAGAGGGTTGGACTGTAAAAGG - Intronic
969754316 4:9138400-9138422 CCAGAGTTGGGGACTGCAGAGGG - Intergenic
971242192 4:24898954-24898976 CCAGAGGTGTGGAGTGGGAAGGG + Intronic
972974088 4:44612188-44612210 GCAGAGGGGTGCCCTGGAGCAGG + Intergenic
973323223 4:48831170-48831192 CCCGGAGGGTGGACTCGAGAGGG - Exonic
973346374 4:49060274-49060296 CCACAGGGCTGGCCTGGAGCTGG + Intronic
975170957 4:71231316-71231338 TTAGAGGGGTGGAATGTAGATGG + Intronic
975363830 4:73504762-73504784 ACAGAGGGGTGGGAGGGAGAGGG - Intergenic
980523124 4:133957403-133957425 CCACAGGGGTAGACTGCTGAAGG - Intergenic
982284466 4:153720630-153720652 CCTGGGGTGTGGCCTGGAGATGG - Intronic
985326980 4:188781959-188781981 CTAGAGGAGGGGGCTGGAGAAGG - Intergenic
985851145 5:2389803-2389825 GCAGGGGGGTGGCATGGAGACGG - Intergenic
986311488 5:6554145-6554167 CCAGAGAGGTGGACAGGCGCTGG - Intergenic
987111800 5:14694360-14694382 CAAGGGGTGTGGACTGCAGATGG + Exonic
987112454 5:14700660-14700682 GCAGAGGGGAGGGCTGGGGAGGG - Intergenic
987277178 5:16374464-16374486 CCAGAGAGTTGCACTGGGGAAGG - Intergenic
988509473 5:31853760-31853782 CCAGAGGGGTGGAGTGGGACTGG + Intronic
989680508 5:44023135-44023157 CCATAGGGGTGGATAGGAGTGGG + Intergenic
990539408 5:56757245-56757267 CCGGAGGTCTGGACTGGACAGGG + Intergenic
991944888 5:71890404-71890426 CCTGAGGAGTGGAATGGACAAGG + Intergenic
992393088 5:76347289-76347311 CCAAAGGCATGGTCTGGAGAGGG + Intronic
992465077 5:76996313-76996335 CCAGAGTGGAGGGATGGAGAAGG - Intergenic
994824717 5:104698580-104698602 GCATAGGGGAGGAGTGGAGAGGG - Intergenic
996681571 5:126233152-126233174 ACAGTGGGGTCTACTGGAGAGGG + Intergenic
997655010 5:135548056-135548078 CCAGAGAGGTGTCCTGGAGTGGG + Intergenic
998045854 5:138986025-138986047 CCAGAGGGAGGGAAGGGAGAGGG - Intronic
999386580 5:151157862-151157884 CTAGAGGGGTGGGGTGGAGGAGG - Exonic
999580239 5:153030567-153030589 CAAGAGGGCTGAACTGGAAAAGG - Intergenic
1001034560 5:168288380-168288402 CCAGGAGGGTGGCCAGGAGAGGG + Intergenic
1001882822 5:175259490-175259512 CCAGAGGGGTGGGGTGTACAAGG + Intergenic
1001936578 5:175709839-175709861 CCTGAGGGCTGGGCTGAAGATGG - Intergenic
1002139506 5:177130483-177130505 CCAGATGGGGAGGCTGGAGATGG + Intergenic
1002352691 5:178594233-178594255 ACAGAGGAGAGGACAGGAGAGGG + Intergenic
1002954513 6:1848685-1848707 CCAGAGGGCAGGACTGCATAGGG + Intronic
1003123927 6:3340126-3340148 CAGGAGGGATGGCCTGGAGAAGG + Intronic
1003181990 6:3799874-3799896 CCAGCTGGGGGCACTGGAGAGGG + Intergenic
1003926491 6:10882213-10882235 CCAGAGGGTGGGGGTGGAGAGGG + Intronic
1005251514 6:23951432-23951454 CCAGAGGGGTAGGGTGGGGAAGG - Intergenic
1005790602 6:29295983-29296005 CCACACCGGTGGACTGGAGTGGG + Intergenic
1006953840 6:37849163-37849185 CCAGAAGGTTGGAGTGAAGATGG + Intronic
1008248088 6:49203768-49203790 GCAGAGAGGGGAACTGGAGAGGG - Intergenic
1010206087 6:73323570-73323592 CCAGATGGGTGGACATCAGATGG + Intergenic
1011309306 6:85964441-85964463 GCAGAGAAGGGGACTGGAGAGGG + Intergenic
1015093242 6:129384670-129384692 CAACAGGGGTAGACTGGAGATGG + Intronic
1016608355 6:145960867-145960889 GGAGAGGGGTGGAGTGGAGAGGG + Intronic
1017748470 6:157468149-157468171 CCTGAGTGGAGGGCTGGAGAGGG + Intronic
1018838892 6:167505216-167505238 TCAGAGGGTTGGACTGCAGTGGG + Intergenic
1020887889 7:13842262-13842284 CCAGAGAAGTGGACTGGGCAGGG - Intergenic
1021173559 7:17423786-17423808 ACAGAAGGGTGAACTGGGGAGGG - Intergenic
1022793827 7:33715945-33715967 TCAGAGGGGTGAACTGGAGATGG - Intergenic
1024009938 7:45258946-45258968 CCAGAAGGGTGGTGTGGAGGTGG + Intergenic
1024090655 7:45937339-45937361 CCAGAGGGCTGGCCATGAGAGGG - Intergenic
1024444943 7:49466157-49466179 GCAGAGGGAAGGACAGGAGAAGG + Intergenic
1026508928 7:71011211-71011233 CCAGAGGTGTTGGCTGGGGAAGG - Intergenic
1028505088 7:91561695-91561717 CCAGAGTGGTGGAGTGGAGTTGG - Intergenic
1029834298 7:103293106-103293128 CCCAAGGGTTGGACTGGGGAGGG - Intergenic
1030079850 7:105767861-105767883 CCAGAGGGGTGGACTGGAGAAGG - Intronic
1030160184 7:106499753-106499775 CCAGAGGGAAGAACTGGGGAGGG + Intergenic
1030191395 7:106813850-106813872 CCAGAAGGATGGACAGGAGGTGG - Intergenic
1030584476 7:111400521-111400543 ACAGTGGGGTAGGCTGGAGAAGG - Intronic
1031585930 7:123532794-123532816 CCAGAGGGGCAGGCTGGAGAAGG - Exonic
1032281480 7:130506313-130506335 CCAGAGGGGTGGGGGGGAGGGGG - Exonic
1032466233 7:132147141-132147163 CCAGAGGGGAGGACAGACGAAGG - Intronic
1033213213 7:139475798-139475820 CCAGAGGCCTGGACTTGCGACGG + Intronic
1033457934 7:141519178-141519200 CCAGCTGGCTGGACTGGAGCAGG - Intergenic
1033527684 7:142232601-142232623 CCAGAGAGGGGGGATGGAGAGGG + Intergenic
1034411012 7:150942249-150942271 CCAGAGGGTGGGACGGGAGCTGG - Intergenic
1034499281 7:151439685-151439707 CCAGAAGGAAGGAGTGGAGATGG + Intronic
1034503859 7:151469715-151469737 AAAGTGGGGTGGACAGGAGATGG + Intronic
1035039654 7:155918246-155918268 CCAGAGCGAGGGATTGGAGAGGG + Intergenic
1035372251 7:158386972-158386994 CCACAGGGGTGGGCTGAGGATGG + Intronic
1035707469 8:1688217-1688239 AGGGAGGGGAGGACTGGAGAAGG - Intronic
1036377544 8:8213724-8213746 CCAGAGTTGGGGACTGCAGAGGG - Intergenic
1036651325 8:10645980-10646002 CCTGAGGGAAGGAATGGAGAGGG - Intronic
1036852020 8:12209424-12209446 CCAGAGTTGGGGACTGCAGAGGG + Intergenic
1036873386 8:12451946-12451968 CCAGAGTTGGGGACTGCAGAGGG + Intergenic
1037473008 8:19229121-19229143 GCAGAGAGGGGAACTGGAGAGGG + Intergenic
1037815020 8:22107575-22107597 GCAGAGGGGTGGCATGAAGATGG - Exonic
1038215998 8:25562192-25562214 CCAGAGAGGGGAGCTGGAGAGGG + Intergenic
1038216018 8:25562304-25562326 CCAGAGAGGGGAGCTGGAGAGGG + Intergenic
1038296131 8:26291956-26291978 CCAGAGGGGTGGGGTGGGGGCGG + Intronic
1038504908 8:28075845-28075867 GCAGAGGGGAGGAAGGGAGAGGG - Intronic
1039906060 8:41787159-41787181 CCAGAGGGGTGGGCTGGGCTTGG + Intronic
1042078090 8:65018153-65018175 CCAGAATGATGGACTGTAGATGG - Intergenic
1042818168 8:72901110-72901132 CCAGAGTGGAGGAGTGCAGAGGG - Intronic
1046686088 8:117228340-117228362 TCAGAGCGGAGGACTGGCGAAGG + Intergenic
1046886477 8:119372939-119372961 CCAGAAGAGTGGGCTGCAGATGG - Intergenic
1046905327 8:119566215-119566237 CCAGAGGGGCAGAATGGAAATGG + Intronic
1048257693 8:132917606-132917628 CAAGGGGAGTGGGCTGGAGATGG + Intronic
1048701326 8:137093152-137093174 TGAGAGTGGTGGAATGGAGATGG - Intergenic
1049280714 8:141742761-141742783 CAAGTGGGGTGGAGGGGAGAGGG - Intergenic
1049391019 8:142371367-142371389 CCATAGGGATGGACTGCAGGGGG + Intronic
1049452968 8:142672272-142672294 ACAGAGGTGTGGATTGGGGAGGG - Intronic
1049459548 8:142718356-142718378 CCACAGAGGTGGAGTGGGGATGG + Intergenic
1050184828 9:2962172-2962194 CAAGTGGGGTGGCGTGGAGAAGG - Intergenic
1052162376 9:25280729-25280751 CCAGAGGGGAGAGCTGGGGATGG + Intergenic
1052995565 9:34550153-34550175 CCAGAGGTGGGGCCTGGTGAGGG - Intergenic
1053789180 9:41674376-41674398 CCAGAGAGGGGCACTGGGGATGG + Intergenic
1054155959 9:61640385-61640407 CCAGAGAGGGGCACTGGGGATGG - Intergenic
1054177461 9:61885729-61885751 CCAGAGAGGGGCACTGGGGATGG + Intergenic
1054660070 9:67695079-67695101 CCAGAGAGGGGCACTGGGGATGG - Intergenic
1057008447 9:91581310-91581332 GCAGGGGGATGGATTGGAGAGGG - Intronic
1057075674 9:92136969-92136991 CCAGAGTTGTGGACTGGGCAGGG + Intergenic
1057378485 9:94545745-94545767 CAAGAGGGGTGGGCTAGGGAGGG + Intergenic
1057787250 9:98096319-98096341 CCAGAGCGCTGGAATGGAGCTGG + Intronic
1057822637 9:98344228-98344250 GGAGAGGTGTGGGCTGGAGATGG - Intronic
1057861032 9:98641047-98641069 CAATAGGGGTGGAGGGGAGAAGG - Intronic
1057875884 9:98754253-98754275 CCAGAGAGGAGGAATGCAGATGG + Intronic
1061606249 9:131713042-131713064 CCTGAAATGTGGACTGGAGATGG - Intronic
1062316212 9:135968310-135968332 CCAGAGAGGGGCACTGGAAATGG + Intergenic
1062524167 9:136971618-136971640 CCTGAGGGCTGGGCTGGGGAGGG + Exonic
1186673135 X:11787680-11787702 CCAGCAGGGGGCACTGGAGAGGG + Intergenic
1187528150 X:20072413-20072435 CCTGATGGATGGACTGGAAAGGG - Intronic
1188514801 X:30973785-30973807 CCTGAGGAGTGGACTAGAGAGGG - Intronic
1188953367 X:36404639-36404661 TCAGATCAGTGGACTGGAGATGG - Intergenic
1189852493 X:45191438-45191460 GCAGAGGGGTGGACTGGCAAGGG + Intronic
1190220959 X:48512032-48512054 CCAGTGGGGTGGGCAGGTGAGGG - Intronic
1190708522 X:53049277-53049299 CCGGAGGGGTGCACTGGGTAGGG - Exonic
1190968266 X:55323424-55323446 CCAGAGGGCTGGCCTGGTGCTGG + Intergenic
1192142617 X:68658788-68658810 CCAGAGGGATGGAGTTGAGGAGG - Intronic
1197325693 X:125090705-125090727 GCCTAGGGGTGGACTGGAAAAGG + Intergenic
1198310953 X:135425388-135425410 CTAGAGGGGCTGACTGGGGAGGG + Intergenic
1199582989 X:149379070-149379092 CCAGAGGGGTCGAGAGAAGAGGG + Intergenic
1200042030 X:153377919-153377941 CTGGAGGTGTGAACTGGAGAAGG + Intergenic