ID: 1030079852

View in Genome Browser
Species Human (GRCh38)
Location 7:105767867-105767889
Sequence CGAACTCCAGAGGGGTGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030079852_1030079860 -5 Left 1030079852 7:105767867-105767889 CCAGTCCACCCCTCTGGAGTTCG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1030079860 7:105767885-105767907 GTTCGACTGGTACTCAGGGCTGG No data
1030079852_1030079862 27 Left 1030079852 7:105767867-105767889 CCAGTCCACCCCTCTGGAGTTCG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1030079862 7:105767917-105767939 CCTGCAGTGTGAAAAGACAGAGG 0: 1
1: 0
2: 0
3: 18
4: 259
1030079852_1030079859 -9 Left 1030079852 7:105767867-105767889 CCAGTCCACCCCTCTGGAGTTCG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1030079859 7:105767881-105767903 TGGAGTTCGACTGGTACTCAGGG No data
1030079852_1030079858 -10 Left 1030079852 7:105767867-105767889 CCAGTCCACCCCTCTGGAGTTCG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1030079858 7:105767880-105767902 CTGGAGTTCGACTGGTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030079852 Original CRISPR CGAACTCCAGAGGGGTGGAC TGG (reversed) Intronic
900541716 1:3206221-3206243 GGATCTCCAGAGGAGTGGCCTGG - Intronic
900692039 1:3986862-3986884 CGAACTCCAGAGAGGAGCACAGG - Intergenic
902311571 1:15585144-15585166 TGAAGTCCAGAGGGGTTGAGGGG - Intronic
902868150 1:19294737-19294759 CGCACTCCAGAGGAGGGGAAGGG + Intergenic
905959565 1:42032580-42032602 GGAAATCCAGTGGGGTGGAGAGG - Intronic
912959268 1:114180930-114180952 CGAAGTCCAGAGGTGACGACTGG + Intergenic
918458679 1:184754342-184754364 AGAACCCTAGAGGGGTGGACAGG - Intronic
922440765 1:225653380-225653402 CGAATCCCAGAGGGGTGCAGGGG - Intergenic
924739963 1:246789232-246789254 CCAACTCCAGAGGGGCCGGCTGG - Intergenic
1062838857 10:654026-654048 GGACCTCCTGAGGGGTGGATGGG - Intronic
1064550488 10:16496119-16496141 AGAACACCAGAGGAGTGGACAGG - Intronic
1067077741 10:43197689-43197711 CCAATCCCACAGGGGTGGACAGG + Intronic
1067749715 10:48962792-48962814 CTGACTCCAGATGGGAGGACAGG - Intronic
1076117362 10:127909477-127909499 AGAACTACAGAGGAGTGGCCGGG - Intronic
1076501736 10:130942625-130942647 CAAACTCCACAGGGTTGGGCGGG - Intergenic
1084116612 11:67046186-67046208 GGAACTGCAGAGGGTTGGAGAGG + Intronic
1084575930 11:69987938-69987960 CGAGGTGCAGCGGGGTGGACAGG - Intergenic
1089788028 11:120922010-120922032 CGAAGTCCAGATGGGTGGGGTGG - Intronic
1100622198 12:96288433-96288455 GGCATTCCAGATGGGTGGACTGG + Intronic
1102861312 12:116338764-116338786 CGAGCAGCAGAGAGGTGGACAGG + Intergenic
1104058030 12:125245375-125245397 CAACCTGCAGAGGGGTGGGCGGG - Intronic
1118731544 14:68670363-68670385 TGAACTGCAGAGGGGTGGGCCGG - Intronic
1122303366 14:100745022-100745044 CGAAATCCAGAGAGCTGCACTGG - Intergenic
1128004720 15:64228162-64228184 AGAACCACAGAGAGGTGGACAGG - Intronic
1132884713 16:2177588-2177610 GGAACTCCACTGGGGTGGATGGG + Exonic
1136387264 16:29936735-29936757 GGAACTGCAGAGGGGAGGAAGGG + Intergenic
1138461619 16:57151738-57151760 CCAAATCCAGAGGGGTGGGGCGG - Intergenic
1139908223 16:70381026-70381048 CGAACTCCGGACAGGTGGAGGGG - Exonic
1139952272 16:70678211-70678233 CAGACCCCAGAGGGGTGGGCTGG - Intronic
1144857615 17:18278302-18278324 CAAACTCCAGAGGCATGGTCGGG + Exonic
1151836966 17:76588121-76588143 AGAACTCCAGGTGGGTGGATAGG - Intergenic
1152814207 17:82397868-82397890 CGCACTCCAGAGGGGAGGGAGGG + Intronic
1153194966 18:2584174-2584196 GGTACTCCAGAGGGGGAGACAGG + Intronic
1153711322 18:7802417-7802439 GGAACTCCAGAGGGTTGGATGGG + Intronic
1158402901 18:57137266-57137288 GGAATTCCAGTGGGGTGGAGGGG + Intergenic
1158916634 18:62137977-62137999 TGAACTCCACAGGGCTTGACTGG - Intronic
1163662943 19:18589365-18589387 CAGACACCAGAGGGGAGGACTGG - Intronic
1167218602 19:48182551-48182573 CGAACTCCAGCGGGCAGGCCGGG - Exonic
1168406333 19:56112489-56112511 AGGCCTCCAGAGGGGTGGGCGGG - Intronic
925733529 2:6941120-6941142 AGAAATCCAGAGGGGAGGAGAGG - Exonic
927955114 2:27202525-27202547 AGAACTCCAGAGGGCAGGAAAGG + Intronic
928524947 2:32130421-32130443 CGAAATCCAGAGGTGAGGCCAGG + Intronic
930676449 2:54205736-54205758 TGAACTTCAGAGGGGTAGAGGGG - Intronic
936410331 2:112252736-112252758 CATAGTCCAGAGGGGTGGAGAGG - Intronic
948900943 2:240956622-240956644 CCAAGTCCAGGGGGCTGGACAGG + Intronic
948993606 2:241567090-241567112 TCCACTCCAGAGGGGTGGATGGG - Intronic
1168856137 20:1010499-1010521 CAAACTGCAGAGTGTTGGACAGG - Intergenic
1181285091 22:21746193-21746215 GAAACTTCAGAGGAGTGGACAGG + Intergenic
1183671403 22:39274872-39274894 TAAACTCCAGAGGGGTGGGTTGG + Intergenic
1185393976 22:50577630-50577652 CAGACACCAGAGGGGTGCACAGG - Intronic
953912516 3:46900096-46900118 CAGACTGCAGAGGGGTGGGCCGG + Intronic
961456446 3:127027014-127027036 CCCACTCCAGAGGGGTTGCCAGG + Intronic
980989376 4:139725846-139725868 AGAACACAAGAGGGGTGGAGAGG + Intronic
985132183 4:186749874-186749896 CAAACTCCAGGTGGGAGGACAGG + Intergenic
985902361 5:2806461-2806483 CGAAAACCAGAGGGGCCGACAGG + Intergenic
993149718 5:84145485-84145507 AGAACTCAAGAAGGGTGGAAGGG + Intronic
994284758 5:97951223-97951245 AGATCTCCAGAATGGTGGACGGG + Intergenic
998399523 5:141841319-141841341 AGAATTCCAGTGGGGAGGACAGG + Intergenic
1000738740 5:164938199-164938221 GGAACTCAAGTAGGGTGGACAGG + Intergenic
1002672052 5:180875486-180875508 CTAACAGCAGAGGTGTGGACTGG + Intergenic
1007260805 6:40561798-40561820 CAAGCTCCAGAGGGCTGGAGAGG + Intronic
1011191843 6:84737767-84737789 AGAATTCCAAAGGGCTGGACAGG + Intronic
1012846554 6:104396739-104396761 CCAGCTCCAGAGGGGAGGAGTGG + Intergenic
1016672472 6:146725300-146725322 CCAACTCCAGAGCCATGGACTGG + Intronic
1017354351 6:153484905-153484927 AGAACTCAAGAGGGGTAGAGAGG + Intergenic
1018898220 6:168035914-168035936 CGACCTGGAGAGGGGTGCACTGG + Intronic
1019997926 7:4736940-4736962 CCAACTCCAGTGGGGTGGAAAGG - Intronic
1025850307 7:65238999-65239021 CCAACTAGAGAGGGGTGGCCTGG - Intergenic
1030079852 7:105767867-105767889 CGAACTCCAGAGGGGTGGACTGG - Intronic
1038427564 8:27474099-27474121 GGAACTGCAGAGGGCTGGTCAGG + Intronic
1043375270 8:79641925-79641947 CGAACTCCAGTGGTGGGGAGGGG + Intronic
1045324040 8:101103604-101103626 GGCACTCTGGAGGGGTGGACAGG - Intergenic
1046139714 8:110074851-110074873 CGAACTTAAGTGGGGTGGAGGGG + Intergenic
1049792566 8:144478738-144478760 CCAATTCCTGAGGGGTGGTCCGG - Intronic
1052990315 9:34515152-34515174 GGAACTTCAGTGGGGTGGAATGG + Intronic
1060966604 9:127715348-127715370 AGAACTCCAGAAGGCTGGGCAGG + Intronic
1062206617 9:135341197-135341219 CCAGCACCAGAGGGGTGGCCCGG + Intergenic
1187922271 X:24216711-24216733 AGAACTCAAGAGGGGAGGACAGG - Intergenic
1191681601 X:63846403-63846425 GGAAATCCAGAGGGCAGGACAGG + Intergenic
1198973107 X:142303449-142303471 TGAACTCAAGAGGGATGAACTGG - Intergenic
1201128439 Y:10934510-10934532 CGAAGTGCAGAGGAGTGGAGTGG - Intergenic