ID: 1030079858

View in Genome Browser
Species Human (GRCh38)
Location 7:105767880-105767902
Sequence CTGGAGTTCGACTGGTACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030079848_1030079858 3 Left 1030079848 7:105767854-105767876 CCTTCCTCCTTCTCCAGTCCACC 0: 1
1: 1
2: 9
3: 95
4: 973
Right 1030079858 7:105767880-105767902 CTGGAGTTCGACTGGTACTCAGG No data
1030079846_1030079858 28 Left 1030079846 7:105767829-105767851 CCATGTGGGCACTGGCTTGCTCA 0: 1
1: 0
2: 0
3: 22
4: 182
Right 1030079858 7:105767880-105767902 CTGGAGTTCGACTGGTACTCAGG No data
1030079849_1030079858 -1 Left 1030079849 7:105767858-105767880 CCTCCTTCTCCAGTCCACCCCTC 0: 1
1: 0
2: 4
3: 81
4: 746
Right 1030079858 7:105767880-105767902 CTGGAGTTCGACTGGTACTCAGG No data
1030079850_1030079858 -4 Left 1030079850 7:105767861-105767883 CCTTCTCCAGTCCACCCCTCTGG 0: 1
1: 0
2: 4
3: 40
4: 437
Right 1030079858 7:105767880-105767902 CTGGAGTTCGACTGGTACTCAGG No data
1030079845_1030079858 29 Left 1030079845 7:105767828-105767850 CCCATGTGGGCACTGGCTTGCTC 0: 1
1: 0
2: 0
3: 9
4: 154
Right 1030079858 7:105767880-105767902 CTGGAGTTCGACTGGTACTCAGG No data
1030079852_1030079858 -10 Left 1030079852 7:105767867-105767889 CCAGTCCACCCCTCTGGAGTTCG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1030079858 7:105767880-105767902 CTGGAGTTCGACTGGTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030079858 Original CRISPR CTGGAGTTCGACTGGTACTC AGG Intronic
No off target data available for this crispr