ID: 1030081228

View in Genome Browser
Species Human (GRCh38)
Location 7:105780256-105780278
Sequence ATCCAGATGCTGATGCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 169}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030081228_1030081237 28 Left 1030081228 7:105780256-105780278 CCAACCAGCATCAGCATCTGGAT 0: 1
1: 0
2: 0
3: 21
4: 169
Right 1030081237 7:105780307-105780329 GACATGCCATGCCTCACTCCAGG No data
1030081228_1030081231 -7 Left 1030081228 7:105780256-105780278 CCAACCAGCATCAGCATCTGGAT 0: 1
1: 0
2: 0
3: 21
4: 169
Right 1030081231 7:105780272-105780294 TCTGGATGTACACAGAAGGATGG No data
1030081228_1030081232 -6 Left 1030081228 7:105780256-105780278 CCAACCAGCATCAGCATCTGGAT 0: 1
1: 0
2: 0
3: 21
4: 169
Right 1030081232 7:105780273-105780295 CTGGATGTACACAGAAGGATGGG 0: 1
1: 1
2: 0
3: 17
4: 169
1030081228_1030081238 29 Left 1030081228 7:105780256-105780278 CCAACCAGCATCAGCATCTGGAT 0: 1
1: 0
2: 0
3: 21
4: 169
Right 1030081238 7:105780308-105780330 ACATGCCATGCCTCACTCCAGGG No data
1030081228_1030081233 -5 Left 1030081228 7:105780256-105780278 CCAACCAGCATCAGCATCTGGAT 0: 1
1: 0
2: 0
3: 21
4: 169
Right 1030081233 7:105780274-105780296 TGGATGTACACAGAAGGATGGGG 0: 1
1: 0
2: 0
3: 27
4: 285
1030081228_1030081234 6 Left 1030081228 7:105780256-105780278 CCAACCAGCATCAGCATCTGGAT 0: 1
1: 0
2: 0
3: 21
4: 169
Right 1030081234 7:105780285-105780307 AGAAGGATGGGGTGCCAGCCAGG 0: 1
1: 2
2: 1
3: 36
4: 322
1030081228_1030081239 30 Left 1030081228 7:105780256-105780278 CCAACCAGCATCAGCATCTGGAT 0: 1
1: 0
2: 0
3: 21
4: 169
Right 1030081239 7:105780309-105780331 CATGCCATGCCTCACTCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030081228 Original CRISPR ATCCAGATGCTGATGCTGGT TGG (reversed) Intronic
901022941 1:6264162-6264184 ATGCAGGTGCTGGTGCTGGGAGG + Intergenic
902108579 1:14058861-14058883 TTGCACATGCTGATCCTGGTTGG - Intergenic
902858187 1:19224600-19224622 ATCCAGGTGCTGATGGTGGCTGG - Intronic
904970382 1:34414794-34414816 ATCCAGCTGATGAAGCTGGGAGG - Intergenic
907111190 1:51928026-51928048 ATATAGATGCTGAGGCAGGTGGG - Intronic
907610010 1:55859742-55859764 ATCCAAATGCTGTTCCTTGTGGG - Intergenic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
910078762 1:83313544-83313566 ATCCCGATGATGATGATGGTTGG + Intergenic
910203740 1:84726304-84726326 AGCCACATGCTGAGGGTGGTAGG + Intergenic
910465087 1:87490472-87490494 AGCCTGATCCTGATGCTGCTTGG - Intergenic
911245049 1:95507706-95507728 ATCTAGGTTCTGAGGCTGGTGGG - Intergenic
912315674 1:108665799-108665821 CTCTAGATGCTGATCCTGGCAGG - Intergenic
914397978 1:147289128-147289150 ATCCAGATCTAGATGCTGATTGG + Intronic
922823712 1:228502590-228502612 ATCCAATTGCTGTTGGTGGTAGG + Intergenic
922965836 1:229690077-229690099 ATCCTGCTGCTGCTGCTGCTGGG + Intergenic
923245635 1:232129253-232129275 CTCCACATGCTGATACTGATAGG + Intergenic
924786993 1:247208125-247208147 ATCCACAGGCAGATGCTGTTGGG - Intergenic
1063126948 10:3143893-3143915 AGCCTGGTGCTGATGCTGTTTGG - Intronic
1065225604 10:23540675-23540697 AGCCAGAAGCTGAAGTTGGTGGG + Intergenic
1066223409 10:33357980-33358002 GGCCAGATGCTGATGCTGCTGGG - Intergenic
1066480589 10:35792027-35792049 ATCCTGGTCCTGATGCAGGTAGG - Intergenic
1067540807 10:47150938-47150960 AACCAGATGCAGATGCAGGGTGG + Intergenic
1068846267 10:61678406-61678428 ATCCTGATGATGGTGGTGGTAGG - Intronic
1070821410 10:79357485-79357507 AGCCAGTTGCGGCTGCTGGTTGG - Intergenic
1072295430 10:94004830-94004852 AGCCAGATGATCATGCAGGTGGG + Intronic
1074078717 10:110151496-110151518 ATCCAGATGCTGTCACTGGAGGG + Intergenic
1074198572 10:111210468-111210490 CTCCAGAGGCTGAGGCGGGTGGG + Intergenic
1074531418 10:114301285-114301307 ATCCAGGTGTTGAGGTTGGTAGG + Intronic
1075073277 10:119333286-119333308 ATCCAGATGGTGAGGATGGTGGG - Intronic
1075710132 10:124526428-124526450 ATCCCGATTCTGACACTGGTAGG - Intronic
1077296528 11:1828981-1829003 ACCCAGATGCTCAGGCTGATGGG + Intronic
1080356500 11:31453046-31453068 ATTAAGATGCTGTTGCTGGCCGG - Intronic
1081439712 11:43066495-43066517 ATGCTGATGCTGATGTTGCTGGG + Intergenic
1081486338 11:43532731-43532753 ATCCAAATTCTGAGGCTGGGAGG - Intergenic
1081874265 11:46397874-46397896 ATCCAGAGGCTGATGGCGGAGGG - Exonic
1083593141 11:63906838-63906860 ATCCAGATGCTGCTGGTGGCAGG - Intronic
1083650888 11:64204085-64204107 ATCCAGAAGCTGATGGATGTGGG + Exonic
1087503711 11:98993584-98993606 GTGCAGATGCTGGTGATGGTTGG + Intergenic
1088207007 11:107404039-107404061 ATCCAGATGATTATGATGATGGG - Intronic
1092039013 12:5367076-5367098 ATGAAGAGGCTGATGCTGGGAGG + Intergenic
1093512473 12:19945594-19945616 ACCCAGATGCTAATGGTGCTGGG - Intergenic
1094494566 12:30981268-30981290 ATCCACGTGCTGCTGCTGGAGGG - Intronic
1096586340 12:52622764-52622786 ATCCAGAAGCTGATGGATGTGGG - Intergenic
1101808535 12:108087243-108087265 ATACATATTCTGATGATGGTAGG - Intergenic
1104544129 12:129695851-129695873 ATGCAGATTCTGATGGAGGTTGG - Intronic
1104706686 12:130952653-130952675 ATCCTGTTGCTCAGGCTGGTCGG - Intergenic
1107644227 13:42477551-42477573 ATCCACCTGCTGATGGTGATGGG + Intergenic
1108486600 13:50933188-50933210 ATACATTTGCTGAGGCTGGTTGG - Intronic
1110128142 13:71974314-71974336 ATGCTGATGATGATGCTGGTGGG + Intergenic
1110688937 13:78408563-78408585 ATGCAGATTCTGATGCTGCAAGG + Intergenic
1111559076 13:89920528-89920550 TGCAAGATGCTGATGCTGATGGG - Intergenic
1113032603 13:106010872-106010894 ATCCAGCTTCTGGTGATGGTCGG - Intergenic
1113603897 13:111591000-111591022 AGCCAGGTGCTGATCCTGGGCGG - Intronic
1120666981 14:87317705-87317727 ATCCAGATGCTGTTGCTTGCTGG + Intergenic
1122636725 14:103133444-103133466 AGCCAGCTGCTGCTGCTGCTCGG - Exonic
1122951518 14:105047633-105047655 ATCCAGCTTGTGCTGCTGGTGGG - Intergenic
1123483995 15:20667914-20667936 ATCCAAATTTTGGTGCTGGTTGG + Intergenic
1124687303 15:31793205-31793227 CTCCTGATGCTGATGCAGGCAGG - Intronic
1127717712 15:61665879-61665901 AACCATATGCAGATGCTGGTGGG + Intergenic
1127801865 15:62484056-62484078 GTCCAGCTGCTGCTGCTGCTTGG + Intronic
1128236605 15:66071900-66071922 CGTCAGATGCTGATGCTGGGTGG - Intronic
1131481863 15:92789067-92789089 AGCCAGGGGCTGCTGCTGGTTGG + Intronic
1131692001 15:94837314-94837336 ACCCAGTTGCTGCTGCTGGCTGG + Intergenic
1131993487 15:98112617-98112639 ATCCAGATGCTGTTTGAGGTGGG - Intergenic
1132715396 16:1287668-1287690 CTCCAGGTGCTGATGCTGCGGGG + Intergenic
1132990308 16:2789050-2789072 ACCCAGACCCTGATGCTGGAGGG - Intergenic
1133698061 16:8283773-8283795 ATCCAGAGACTGATGCTTCTAGG - Intergenic
1138957304 16:61986630-61986652 CTCCAGATGCTGTTGCTGTAAGG - Intronic
1139257963 16:65561393-65561415 AGGCAGATGCTGGTGCTGGCTGG - Intergenic
1139559026 16:67730022-67730044 ATCCAGAAGCTGGTGCTGGAGGG - Exonic
1141288504 16:82695127-82695149 ATCCTGAAGCGGAGGCTGGTGGG + Intronic
1142794996 17:2300783-2300805 ATCCAAATGCTAATACTGGTAGG + Intronic
1146650895 17:34605596-34605618 ATCCTGGTGCTGATGGTGGGGGG - Intronic
1149650192 17:58271754-58271776 ATCCAGATGTCGATGTTGTTGGG + Exonic
1149652115 17:58281944-58281966 ATCCAGGAGCAGATGGTGGTGGG - Intergenic
1152635275 17:81428300-81428322 AGCCAGATGCTGTGGCTGGCCGG - Intronic
1154102878 18:11492233-11492255 ATCCAGATTCTTTTGCTGGAAGG - Intergenic
1160190865 18:76713134-76713156 AACCTGATGCTGATGCTGCCGGG - Intergenic
1162885735 19:13695640-13695662 ATCAGGAAGCTGATGCTGGCCGG + Intergenic
1165337161 19:35179144-35179166 CTCCAGCTGCTGATGGTGGGAGG + Intergenic
925858911 2:8156415-8156437 CTCCAGGTGCTGCTGATGGTGGG - Intergenic
927493457 2:23536228-23536250 ATCCTGAAGCTGATGATGGAGGG + Intronic
928319378 2:30270902-30270924 ATGCAGATTCTGATTCTGGGTGG + Intronic
928687017 2:33760303-33760325 AGCCATATGCTGATGATGGCAGG - Intergenic
932476367 2:72008857-72008879 GTCCAGAGGCTTCTGCTGGTTGG - Intergenic
934077737 2:88442194-88442216 ATACTGATGCTGATGCTGACTGG + Intergenic
935253897 2:101290997-101291019 AGCCACATGCTGATACTGATTGG - Intronic
935949719 2:108317507-108317529 TTCCAGATCCTTCTGCTGGTGGG + Intergenic
936486220 2:112928174-112928196 ATCCAGTTGGTGCTGGTGGTGGG + Intergenic
936867273 2:117088839-117088861 CTCCAGAGGCTGAGGTTGGTGGG - Intergenic
937007138 2:118527477-118527499 ATCCATTTTCTAATGCTGGTTGG + Intergenic
939009363 2:136827587-136827609 ATCCAGAGCCTGAAGCTGGGAGG - Intronic
939629105 2:144513586-144513608 TTTCAGAGGCTGATGCTGGAAGG + Intronic
942658172 2:178236647-178236669 CTCCAAAGACTGATGCTGGTAGG + Intronic
945447613 2:209956536-209956558 TTCAAGATGCTATTGCTGGTTGG - Intronic
947670332 2:231931657-231931679 AGCCAGATGCTGATGAGGGCTGG + Intergenic
948962393 2:241350115-241350137 ATGCAGATGCAGATGCAGGGCGG + Exonic
1172382195 20:34504244-34504266 CTCATGATGCTGATGCTTGTTGG + Intronic
1173177654 20:40776863-40776885 CCCCAGATGTTGGTGCTGGTGGG + Intergenic
1173904105 20:46613475-46613497 CTCAAGATCCTGATGCTTGTTGG - Exonic
1174384876 20:50181512-50181534 ATGCAGAGGCTCATGCTGGAAGG - Intergenic
1177197425 21:17918113-17918135 ATGAAGAGGCTGATACTGGTGGG + Intronic
1177862416 21:26470007-26470029 ATCAGGATCCTGATGCTGCTTGG + Intronic
1181316734 22:21975377-21975399 ATCCATATGCTGGGCCTGGTGGG - Intronic
1181358513 22:22317285-22317307 ATCAAAATGCTGATGGTGTTAGG - Intergenic
1182657537 22:31902698-31902720 AGCCAGATGCTGGTGGAGGTGGG - Intronic
1182856524 22:33522346-33522368 ATTCTGTTGGTGATGCTGGTGGG - Intronic
1183400955 22:37604114-37604136 TTCCAGATGCTGCTGCTGACTGG - Intergenic
949468661 3:4370360-4370382 ATCCACATTCAGATGCTGGCAGG - Intronic
950010869 3:9722896-9722918 AGCCAGGTGGTGATGGTGGTGGG - Intronic
950520699 3:13496173-13496195 CTCCAGCTGCTGAGGCTGGGGGG - Intronic
950626231 3:14249160-14249182 ATGCAGCTGCTGGGGCTGGTGGG - Intergenic
952739382 3:36720824-36720846 ATCCTGATGCTTCTGCTGCTGGG + Intronic
952742358 3:36746921-36746943 ATGCTGATGCTGATGCTGTTGGG + Intergenic
953094606 3:39762620-39762642 ATGCAGATGCTGAGGCTAGCAGG + Intergenic
954214836 3:49118817-49118839 ATCCAGAAGATGGTGCTGTTGGG - Intronic
957828618 3:85485916-85485938 ATCCTGATCCTGATGCTAGCAGG - Intronic
960029304 3:113041621-113041643 TTCCAAATGCTGATCCTGGCAGG + Intergenic
962130379 3:132667068-132667090 ATCCTGATGCTGATGTTGCTAGG + Intronic
962611341 3:137079136-137079158 ATGCTGATGATGATGCTGGTTGG - Intergenic
966920981 3:184611187-184611209 ATAGAGATGCTGATGGTGGCGGG - Intronic
971634971 4:29046668-29046690 ATACACATGCTCATGCTGCTGGG - Intergenic
974385644 4:61200473-61200495 ATGCAGATGCTGCAGCTGGTCGG + Intergenic
974781415 4:66558796-66558818 ATGCAGATGCTGATGTCTGTGGG - Intergenic
978723615 4:111944534-111944556 ATGCAGATGCTGATTGTGGTTGG - Intergenic
983955056 4:173687719-173687741 TTCCAGATGAAGGTGCTGGTAGG - Intergenic
984018139 4:174450559-174450581 ATCCAGCCGCTGCTGCTGTTGGG + Intergenic
990711794 5:58589941-58589963 ATCCAGTTGCTGGTGGTTGTAGG - Intronic
992621388 5:78596760-78596782 AGCCACATTCTGATGCTGGTAGG + Intronic
993208716 5:84920831-84920853 ACCCAAATGCTGATGGTGATAGG + Intergenic
993812673 5:92501837-92501859 AGGCATATGCTGATGGTGGTTGG + Intergenic
994597698 5:101860426-101860448 ATCCACACGCTCGTGCTGGTAGG - Intergenic
994683228 5:102916230-102916252 ATCCAAATGCTGAGTCTGATTGG + Intronic
996360734 5:122642775-122642797 TTCCAGATGCTGAGGCGGGTGGG - Intergenic
999088694 5:148915684-148915706 ATCCAGCTTCAGATGCTGGGAGG - Intergenic
1002186550 5:177457373-177457395 GGCCAGAGGCTGATGCAGGTGGG + Exonic
1002632244 5:180590061-180590083 ATCCAAATGCTGATCCCTGTGGG - Intergenic
1003665836 6:8110487-8110509 ATCCACATGCTGATGTTGAAGGG + Intergenic
1004162006 6:13222448-13222470 AACAAGATGCTGATGCTCGTGGG - Intronic
1004463695 6:15863066-15863088 ATCCAGATGGTGATGCCAGAGGG + Intergenic
1005893100 6:30156007-30156029 ATGCAGCTGCTGCTGCTGGTGGG + Intronic
1006114806 6:31769908-31769930 ATCTAGGTGCTGAAGGTGGTGGG + Intronic
1006955930 6:37871910-37871932 ATTTAGCTGCTGATGGTGGTGGG - Intronic
1007270303 6:40630991-40631013 TTACAGATGCTGAGCCTGGTGGG + Intergenic
1007524106 6:42475987-42476009 ATGCTGATGCTGTTGCTGGTTGG - Intergenic
1010910178 6:81544306-81544328 ACTCAGAGGCTGAGGCTGGTGGG - Intronic
1011038024 6:82999252-82999274 ATCCTGCTCCTGAGGCTGGTCGG + Intronic
1012411117 6:98958346-98958368 ATGCAGATTCTGATTCTGGGTGG + Intergenic
1013152351 6:107459020-107459042 ATGCAGGTGCGGAAGCTGGTGGG - Exonic
1013653081 6:112216117-112216139 AACCAGCTGCTGAGGGTGGTGGG + Intronic
1015372228 6:132467011-132467033 ATCCAGATGCTCAATCTTGTTGG - Intronic
1016425869 6:143935124-143935146 CTGCAGATGCTGGTGGTGGTGGG + Intronic
1020497388 7:8873184-8873206 ATCCAGATGTTGATACTGAAAGG - Intergenic
1021528102 7:21611274-21611296 AACCAGATGCTGAGGGTGGGAGG - Intronic
1023649181 7:42350885-42350907 ACCCAGCTGCTGATGCTTGGAGG - Intergenic
1023658578 7:42450716-42450738 ATGCCAATGCTGCTGCTGGTTGG + Intergenic
1024478458 7:49839155-49839177 TTCCAGATGCAGATACAGGTGGG - Intronic
1026319845 7:69258925-69258947 ATACAGATTCTGATTCTGTTAGG + Intergenic
1026878365 7:73892915-73892937 CTTCAGATGTTGATGCTCGTAGG - Intergenic
1027296538 7:76778819-76778841 ATCCCGATGATGATGATGGTTGG + Intergenic
1028090887 7:86699334-86699356 ATCCAGATGCAGAATCTGGATGG + Intronic
1030081228 7:105780256-105780278 ATCCAGATGCTGATGCTGGTTGG - Intronic
1030316467 7:108119970-108119992 ATCCAGAGGTTGATGGGGGTTGG - Intronic
1030417315 7:109261979-109262001 CTCCAGATGATGATGCTGTGAGG + Intergenic
1033591291 7:142810666-142810688 ATTCAGATGCTGATTCTGTAGGG - Intergenic
1034768135 7:153746993-153747015 CTGTAGATGCAGATGCTGGTTGG - Intergenic
1038180351 8:25221640-25221662 ATGGAGATGATGATGATGGTAGG - Intronic
1039759888 8:40563117-40563139 ATTCAGATGAAGATGCCGGTGGG - Intronic
1041292135 8:56318099-56318121 ATCCAAATGATGATGGTGGGAGG + Intronic
1041303867 8:56439707-56439729 ATCCACATGATCATGCTGTTAGG - Intronic
1042890889 8:73609007-73609029 ATCCAGCTGCTGAAACTGCTGGG - Intronic
1044304830 8:90627174-90627196 ATCCAAGTGCTGAGGGTGGTTGG + Intronic
1044668606 8:94655947-94655969 CTCCAGAGGCTGAAGCTGGAGGG + Intronic
1045721183 8:105112608-105112630 ATCCAGCTGCTGCTGCAGATGGG + Intronic
1048489121 8:134875702-134875724 ATCAAGATGCTAAAGCTGGCTGG - Intergenic
1056561387 9:87732961-87732983 CTGCAGATGCTGGTGCTGGCTGG + Intergenic
1056941870 9:90962826-90962848 GCCCAGCTGCTGATGCTGGAAGG + Intergenic
1059164775 9:112067403-112067425 TTCCACATGCTTAAGCTGGTTGG + Intronic
1059463855 9:114452953-114452975 ATCCTGATGCTTCTGCTGGGAGG + Intronic
1059614750 9:115937189-115937211 ATATAGAAGCTGATGCAGGTGGG + Intergenic
1060471854 9:123954692-123954714 CAGAAGATGCTGATGCTGGTGGG + Intergenic
1060484096 9:124036396-124036418 AGGCAGGTGCTGAGGCTGGTAGG + Intergenic
1061963695 9:134001352-134001374 AGACAGAAGCTCATGCTGGTGGG - Intergenic
1062382379 9:136292656-136292678 CTCCAGCTGCTGCTGCTGCTCGG - Intronic
1187373091 X:18726555-18726577 ATGGAGATGATGATGCTTGTGGG + Intronic
1187722194 X:22162832-22162854 ATCTACATGCTGAAGATGGTGGG - Intronic
1190035133 X:47015879-47015901 ATTAAGATGCTGAGACTGGTTGG - Intronic
1193274624 X:79570914-79570936 ACCCACAGGCTGATGCTGCTTGG + Intergenic
1193814088 X:86084731-86084753 ATCCAGAAGCTGATGGATGTGGG - Intergenic
1195389150 X:104342933-104342955 AGCCAGAGGCTGAAGCTGGCAGG + Intergenic
1198506186 X:137303431-137303453 AGACAGATGCTGATGTGGGTCGG + Intergenic