ID: 1030082848

View in Genome Browser
Species Human (GRCh38)
Location 7:105792220-105792242
Sequence CACTTCCCTCTAGGGAAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030082848_1030082853 28 Left 1030082848 7:105792220-105792242 CCTAGTTTCCCTAGAGGGAAGTG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1030082853 7:105792271-105792293 TGTCTCCTGTGGAAAGTGAGAGG No data
1030082848_1030082852 17 Left 1030082848 7:105792220-105792242 CCTAGTTTCCCTAGAGGGAAGTG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1030082852 7:105792260-105792282 TGATCTGAGCATGTCTCCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030082848 Original CRISPR CACTTCCCTCTAGGGAAACT AGG (reversed) Intronic
900252438 1:1678148-1678170 CACTTCTCCCCCGGGAAACTGGG + Intronic
901175879 1:7298641-7298663 CACTTCTCTCTGGGGGAATTAGG + Intronic
903688205 1:25148205-25148227 CACTTCACTGTAGCCAAACTGGG + Intergenic
905514997 1:38556144-38556166 GACTTCCCTCTGAGGAATCTGGG - Intergenic
908639512 1:66206213-66206235 CAGTTTCCTTCAGGGAAACTTGG + Intronic
909595874 1:77405696-77405718 CAACTCCCCCTAGGAAAACTTGG + Intronic
910350679 1:86294099-86294121 CACTTGCCTGTGAGGAAACTGGG - Intergenic
910863879 1:91769558-91769580 CACTTCACTCTAGCCAGACTTGG + Intronic
915087616 1:153398791-153398813 CATTTCCCCCTTAGGAAACTGGG - Intergenic
915971770 1:160360262-160360284 CCCTTCCCCCCAGGGGAACTTGG - Intergenic
921198571 1:212781282-212781304 AATTTCCCTCTAAAGAAACTTGG - Intronic
922088702 1:222375284-222375306 CACTTTCCTCTAAGGAAAATGGG + Intergenic
924589366 1:245388599-245388621 CACTTCTCTCTAGGGAAGGCGGG - Intronic
1063585338 10:7347213-7347235 CACCTCCCACTAGCAAAACTCGG - Intronic
1065484320 10:26222303-26222325 TATTTAACTCTAGGGAAACTTGG - Intronic
1069793538 10:71038691-71038713 CACTTCCCATCAGAGAAACTTGG + Intergenic
1073498071 10:103912140-103912162 CACCTCCATCCAGGAAAACTTGG + Intronic
1073686317 10:105758266-105758288 CACCTTCCTCTAGGGAAAAAAGG + Intergenic
1076873547 10:133205091-133205113 CCCTTCCCTCTAGGGGTACAGGG - Intronic
1077846998 11:6036378-6036400 CGATTCCATCTTGGGAAACTTGG + Intergenic
1078542538 11:12223444-12223466 CACTACCCTCTCGAGAGACTGGG + Exonic
1079416744 11:20244874-20244896 CACCTCTCTCTGGGGAAACCAGG + Intergenic
1080788468 11:35498084-35498106 CACATTCCACTAGGAAAACTTGG - Intronic
1083380616 11:62265330-62265352 TACTTTCCTGGAGGGAAACTGGG - Intergenic
1084945901 11:72638297-72638319 CAGCTCTGTCTAGGGAAACTGGG - Intronic
1085024103 11:73226576-73226598 CACTTCCAGCTTGGGAACCTGGG + Intronic
1085817846 11:79759999-79760021 CACTCCCTTCCAGGGAAACCAGG + Intergenic
1089629176 11:119773236-119773258 CACTGCCCTCTATGGAGACACGG - Intergenic
1092218024 12:6695831-6695853 CCCTGCCCTCTAGGGGAGCTTGG + Intronic
1097005735 12:55916451-55916473 CCATACCCTCTAGTGAAACTGGG - Intronic
1097104997 12:56616893-56616915 AACTTCTCTCTGGGGGAACTAGG + Intronic
1107108550 13:36672734-36672756 CACTTCCCTCCGGGCACACTTGG - Intergenic
1110657117 13:78013170-78013192 CCCTTCCCTCAAGGCAAACCAGG - Intergenic
1115092949 14:29600595-29600617 AACTTCCCTCTAGGAAAAGTTGG - Intronic
1118270630 14:64339118-64339140 CACTTGCCCCTAGGGAATGTTGG + Intergenic
1118680749 14:68239183-68239205 CACTTCCCTCCTGGGCACCTGGG + Intronic
1122344988 14:101052966-101052988 CACCGCCCTCTGGGGAGACTTGG + Intergenic
1124344623 15:28913956-28913978 CACACCCCTCTAGGAACACTGGG + Intronic
1133173935 16:3999519-3999541 CAGGTCACTCTAGGGAAACAAGG - Intronic
1133263090 16:4564992-4565014 CATTTCCCTCCACGGAAACGAGG - Intronic
1134466904 16:14486948-14486970 CACTCACCTCCAGGGAAACAGGG - Intronic
1134799823 16:17073261-17073283 CCTGTCCCTCTAGGGAACCTCGG + Intergenic
1140881779 16:79205012-79205034 CACTTCCTTCTAGCCAGACTCGG + Intronic
1142591148 17:1006666-1006688 CTCTTCCCTCGTGGGAAGCTGGG - Intronic
1144788645 17:17845528-17845550 CTCTTCCCTCTGAGGACACTGGG + Intronic
1144815602 17:18032312-18032334 GACTTCCCTCTTGGGAAACCTGG - Intronic
1145264594 17:21373759-21373781 CACTTCCCTCTCTGTAAAATGGG - Intergenic
1146514999 17:33482289-33482311 CACTTGCCTCTAGTCAAACATGG + Intronic
1147377937 17:40033845-40033867 CACTCTCCTCTGGGGGAACTGGG + Intronic
1150228835 17:63538855-63538877 AACTTCCCTCTCAGGAAAATGGG - Intronic
1150459410 17:65335242-65335264 CACTTCCCTCAAAGGAGGCTGGG + Intergenic
1154375871 18:13809278-13809300 CACTTCTCTCTGGGGAGACCTGG - Intergenic
1160532368 18:79572987-79573009 CACTTCCCTCAGGGGAGACCAGG + Intergenic
1162340027 19:10086610-10086632 CATTTCGCTCTGGGGAAACGTGG - Intronic
925972186 2:9113485-9113507 CTCTTCCCTCTAGGGAGGCGGGG - Intergenic
932079971 2:68705097-68705119 GGCTTCCCTTTAGGGAAACCAGG - Intronic
933745889 2:85571028-85571050 CACTTCCCTATAGGGAGACCAGG + Intronic
935769266 2:106401351-106401373 CACATCCTTGCAGGGAAACTGGG + Intronic
935910826 2:107894572-107894594 CACATCCTTGCAGGGAAACTGGG - Intergenic
935968952 2:108511411-108511433 CACATCCTTGCAGGGAAACTGGG - Intergenic
936023951 2:109016919-109016941 CACTGCCCCCTATGGAAACTCGG + Intergenic
936132613 2:109859612-109859634 CACATCCTTGCAGGGAAACTGGG - Intergenic
936212084 2:110511873-110511895 CACATCCTTGCAGGGAAACTGGG + Intergenic
936421224 2:112366435-112366457 CACATCCTTGCAGGGAAACTGGG + Intergenic
939410855 2:141823061-141823083 CACTTTCCACTATGGAAACAGGG + Intronic
940369249 2:152881713-152881735 CACATCCCCCTGGGGAAGCTGGG + Intergenic
941575152 2:167220759-167220781 AACTTCCATTTAGGGAAACAAGG - Intronic
943566763 2:189525384-189525406 CACTTTCTTCCATGGAAACTTGG + Intergenic
944694701 2:202190394-202190416 ATCTTCCATCTAGAGAAACTTGG - Exonic
945944943 2:215986526-215986548 CACTTCATTCTTGGGAAACTAGG - Intronic
946387787 2:219395739-219395761 CACTTCCCTCTGGAGATGCTAGG - Intronic
948351755 2:237346556-237346578 CTGCTCCCTCTAGGGAAATTCGG - Exonic
1168801610 20:647011-647033 CACTGCCCTCTAAGGGAACTTGG - Exonic
1170174000 20:13447159-13447181 CATTTCCCCATAGGGAAAATAGG - Intronic
1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG + Intronic
1172316638 20:33960598-33960620 CAGTTTCCTCTGGGGAGACTGGG - Intergenic
1173247186 20:41344901-41344923 GGCTTCCCACCAGGGAAACTGGG + Intronic
1175448347 20:59042290-59042312 CACCTCCCTCTTGGGATCCTCGG + Intronic
1176236141 20:64054405-64054427 CACTGCCCTCCAGGGACCCTGGG - Intronic
1177434735 21:21036693-21036715 CACCCACCTCCAGGGAAACTTGG - Intronic
1180971404 22:19817996-19818018 CACTTCCTTCAAGGGCCACTTGG + Intronic
1181366353 22:22380114-22380136 CTCTTCCCTCTAGGGTGCCTTGG - Intergenic
1182135715 22:27901096-27901118 CACTTACCTCAAGGTAAACATGG + Intronic
1184410882 22:44325669-44325691 CTCTCTCCTTTAGGGAAACTTGG + Intergenic
1184665040 22:45983889-45983911 GAATTCCATCTTGGGAAACTGGG - Intergenic
1185085234 22:48737352-48737374 CACCTCCCACTAGGGCAGCTCGG - Intronic
950766646 3:15277906-15277928 CACTTTCTTCTAGAGAAAGTTGG + Intronic
952670308 3:35958983-35959005 CAATTCACTGTAGAGAAACTTGG + Intergenic
955971526 3:64442967-64442989 CACTTAACAGTAGGGAAACTGGG + Intronic
963054504 3:141174794-141174816 CCCTTGCTGCTAGGGAAACTGGG - Intergenic
965487918 3:169301363-169301385 CAATCCACTCTAGGGAAAGTTGG + Intronic
967979385 3:195056517-195056539 CACTTACCCCAAGGGAACCTGGG + Intergenic
969193767 4:5544570-5544592 CTCTTCCCTCTTGGGGACCTGGG - Intronic
974170912 4:58266345-58266367 CACTTTCTTCTAGGGTAACAAGG + Intergenic
980374321 4:131923716-131923738 CACTCCCCTCCAAGAAAACTTGG + Intergenic
980738184 4:136917808-136917830 CCCTGCACTCTAGGGAACCTGGG + Intergenic
982068480 4:151674860-151674882 CAGTTCCCTCCAGGAAAACCAGG + Intronic
985961334 5:3305579-3305601 CACTCTCCTCCAGGGAAACGCGG - Intergenic
986501904 5:8409588-8409610 CACTTCCCTCATGGGAATGTGGG - Intergenic
986746007 5:10745870-10745892 AATTTCCCTCTAGGAAACCTGGG - Intronic
991215483 5:64154256-64154278 CACTTCCCTTGTGGGAAATTAGG - Intergenic
995037558 5:107552386-107552408 CACTTCCCTCATGGGTCACTTGG - Intronic
996284702 5:121775274-121775296 CACATCCCTTTATGGAACCTAGG - Intergenic
997251814 5:132394453-132394475 CACCTTCCTCTAGGGACACTGGG + Exonic
1000558396 5:162755721-162755743 CACATCCCTCTATAGAAGCTAGG + Intergenic
1005347761 6:24907377-24907399 TAATTCCCTCTAAGGAAACCGGG - Intronic
1005574660 6:27179937-27179959 TACTTCCCTCAAGGGAAAAAAGG - Intergenic
1006652812 6:35565635-35565657 CACTTCCCTTAAGGGAAAAAGGG + Intergenic
1006933377 6:37700667-37700689 CACTTCTCTCTAGGAAGACAGGG - Intergenic
1008468394 6:51855529-51855551 CACTTCTCTCTAGGGTAAATTGG + Intronic
1009406423 6:63319049-63319071 CACTTTCCCTAAGGGAAACTGGG - Intronic
1009759092 6:67980345-67980367 CACTACCTTCTAGGACAACTCGG + Intergenic
1011457297 6:87565460-87565482 CAGTTCTCTCTAGGGAAGCAGGG + Intronic
1012270832 6:97208527-97208549 CACTTGCCTCTTGGGGAACCTGG + Intronic
1014727576 6:124990951-124990973 CACCTCCCTCTCGGGTAGCTAGG - Intronic
1017061726 6:150491035-150491057 CAGTTCCCTGTATGGACACTGGG + Intergenic
1022269172 7:28788901-28788923 TATTTCCCTCTAGGGAGCCTGGG - Intronic
1027914505 7:84298528-84298550 CCATTCACTCTAAGGAAACTGGG + Intronic
1029539916 7:101176595-101176617 CTCTTCCCCATAGGGAGACTTGG + Intronic
1030082848 7:105792220-105792242 CACTTCCCTCTAGGGAAACTAGG - Intronic
1030557977 7:111050308-111050330 CACTTCCCCCTTCTGAAACTTGG + Intronic
1031308034 7:120158629-120158651 CACTTCCCTCTCCTGAAACATGG - Intergenic
1031959388 7:127975187-127975209 CACGTCCTTGTAGGGAAATTTGG - Intronic
1032299412 7:130672870-130672892 GACTTTCCTGTAGGGAAACGAGG + Exonic
1033568498 7:142602853-142602875 CACTGACCTCCAGGGAAAGTTGG - Intergenic
1033726341 7:144122703-144122725 GGCTCTCCTCTAGGGAAACTAGG + Intergenic
1036997239 8:13672596-13672618 CACTTTCCTTTAGGGATGCTAGG - Intergenic
1037061438 8:14515063-14515085 AACTTTGCTCTAGGGAAAATAGG + Intronic
1037556585 8:20030792-20030814 TACTTCCCTGGAGGGAAACTGGG + Intergenic
1041419203 8:57647621-57647643 CACATCCTTCTGGGGAAACTTGG + Intergenic
1044467627 8:92525819-92525841 CACATACCTTCAGGGAAACTGGG + Intergenic
1049029319 8:140022712-140022734 CACTTGCCCCTGGGGAAGCTTGG - Intronic
1050305446 9:4300823-4300845 GACTTCCATCTTGGGAATCTAGG + Intronic
1051023500 9:12575522-12575544 CACTTCACTGTAGGGAATGTAGG - Intergenic
1055027747 9:71740394-71740416 CATTTCCTTCTAGGAGAACTAGG - Intronic
1057213228 9:93212641-93212663 CACTTCCCTCTCTGTAAAATGGG + Intronic
1058895120 9:109393682-109393704 TACATCCCTGTAGGGCAACTTGG - Intronic
1191892436 X:65957675-65957697 AACTTCCCTCCAGGCAAGCTGGG - Intergenic
1194126317 X:90021483-90021505 CATTCCCCTCTATGGAAGCTAGG + Intergenic
1195004554 X:100673000-100673022 CTCTTCCCTCCAGGGAAATATGG + Intergenic
1197236693 X:124073911-124073933 CAGTTATCTCTAGGGAAAATGGG - Intronic