ID: 1030084602

View in Genome Browser
Species Human (GRCh38)
Location 7:105805767-105805789
Sequence CAGCAAGAGCAAATGCAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030084600_1030084602 -8 Left 1030084600 7:105805752-105805774 CCCGGGTCGTGGGAACAGCAAGA 0: 1
1: 0
2: 1
3: 14
4: 176
Right 1030084602 7:105805767-105805789 CAGCAAGAGCAAATGCAGTGTGG No data
1030084601_1030084602 -9 Left 1030084601 7:105805753-105805775 CCGGGTCGTGGGAACAGCAAGAG 0: 1
1: 0
2: 4
3: 66
4: 359
Right 1030084602 7:105805767-105805789 CAGCAAGAGCAAATGCAGTGTGG No data
1030084594_1030084602 18 Left 1030084594 7:105805726-105805748 CCAGGCAGTCGCAGGGGGAGGGG 0: 1
1: 0
2: 5
3: 53
4: 392
Right 1030084602 7:105805767-105805789 CAGCAAGAGCAAATGCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030084602 Original CRISPR CAGCAAGAGCAAATGCAGTG TGG Intronic
No off target data available for this crispr