ID: 1030086033

View in Genome Browser
Species Human (GRCh38)
Location 7:105816573-105816595
Sequence TCCCCACAGCCCTCAGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 370}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030086028_1030086033 6 Left 1030086028 7:105816544-105816566 CCAAGCACAGCACTCTTGCAATG 0: 1
1: 0
2: 0
3: 13
4: 274
Right 1030086033 7:105816573-105816595 TCCCCACAGCCCTCAGGGAAGGG 0: 1
1: 0
2: 4
3: 45
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030086033 Original CRISPR TCCCCACAGCCCTCAGGGAA GGG Intronic
900479025 1:2889419-2889441 CCCCAACAGTCCTCAGGGCAGGG - Intergenic
900517868 1:3091701-3091723 ACCCCACAGCCCTGCGGGGAGGG + Intronic
900786294 1:4652852-4652874 CCCTCACACCCCTCAGGGAGAGG + Intergenic
901006372 1:6173598-6173620 TCCCCATAGCCCTGGGGGAAAGG - Intronic
901232926 1:7651269-7651291 CCCCCACAGCCCTCCAGAAAAGG + Intronic
901428673 1:9199264-9199286 TCCCCCCAGGCCTCAGAGCAGGG - Intergenic
902117047 1:14129697-14129719 TCCCAGCAGCCCACAGGAAAAGG + Intergenic
902338683 1:15768519-15768541 TCCCCACAGGCCCCAGCGGAGGG + Exonic
902354361 1:15886454-15886476 TCTCCACAGCCCTCAGTCCAGGG + Intronic
902980837 1:20121754-20121776 ATCTCACAGCCATCAGGGAAGGG - Intergenic
903025990 1:20430372-20430394 TCCTAACAGCCTTCAGGGGAAGG - Intergenic
903212843 1:21828413-21828435 TCCCCACAGGTGTCAGTGAATGG - Exonic
903648233 1:24907363-24907385 TCCCCAAAGCGGTCAGGGAACGG + Exonic
904422667 1:30404300-30404322 ACCCCACAGCACACAGGGCAGGG + Intergenic
904757190 1:32774408-32774430 TCTCCACTGCCCACAGGCAAGGG - Exonic
905352899 1:37359818-37359840 TTCCCACAGTCCTCAGGGAAGGG - Intergenic
905443782 1:38011354-38011376 CCCTCACATCCCTAAGGGAATGG - Intronic
905707529 1:40072568-40072590 TTTCCACAGGCCTCAGGAAATGG - Exonic
905733308 1:40310988-40311010 TCCCCAGAACCCACAGGGGAAGG + Intronic
905735686 1:40324275-40324297 ACACCACATCCCTCAGGGACAGG + Intergenic
905791924 1:40794263-40794285 TCCCCACTGCCCACAGGGTAAGG - Intronic
905880444 1:41459897-41459919 TCACGGCAGCCCTCAGGAAATGG - Intergenic
905889468 1:41510506-41510528 TCCCCCAAGCCCTCAGGAAGTGG - Exonic
905905073 1:41612492-41612514 TCAAAACAGCCCTCTGGGAAGGG + Intronic
906610083 1:47195380-47195402 TGTCCACAGCCCTCTGGGAAGGG - Intergenic
906691989 1:47798753-47798775 TCCCTAAAGCCTTCAGGCAAAGG + Intronic
906728643 1:48062510-48062532 TCTCCATAGCCCTCCAGGAAAGG - Intergenic
907391376 1:54160597-54160619 TCCCAAGAGCCCTCAGACAAGGG + Intronic
907407924 1:54265152-54265174 CACCCACAGCCCCCAAGGAAAGG + Intronic
907463352 1:54619265-54619287 TCCCAACAGCCCTGAAGGAGAGG + Intronic
907811924 1:57879584-57879606 TCCCCACAGGCCTCTGTGAAAGG - Intronic
910448320 1:87321026-87321048 ATCCCACAACCATCAGGGAAAGG + Intergenic
911163587 1:94705946-94705968 ACCCCACAGCTCTCAGACAACGG + Intergenic
914900321 1:151707986-151708008 TCCCCAAAGCCCTCAGGACCTGG + Intronic
915087190 1:153396825-153396847 TCCCCACTGCCCACTGGGAGGGG + Intergenic
915146765 1:153800203-153800225 TCCCCACTGCCCACTGGCAATGG + Intergenic
915437535 1:155919929-155919951 TGCTCACAGCCCACAGGTAAGGG + Intronic
915682638 1:157596208-157596230 TCCCTGCAGCACTCAGGAAAAGG + Intronic
916166447 1:161970666-161970688 TCACAGCAGCCCTCAGGCAAGGG + Intergenic
916203547 1:162294333-162294355 TCCCCACATCTCCCAGGGACGGG + Intronic
916210770 1:162357912-162357934 TACCACCAGCACTCAGGGAATGG + Intronic
916346642 1:163799364-163799386 TTCCAACAGCCCTCAGCCAAAGG + Intergenic
916863944 1:168836462-168836484 TTCCCACAGCCACCAAGGAAAGG + Intergenic
917967046 1:180185447-180185469 TCTCCGCAGCCCTCATGGAAGGG - Intronic
918475327 1:184918213-184918235 TCCCCAAAGCCCAAAGGGCAGGG - Intronic
919791940 1:201297347-201297369 GCCCCACAGACCTCAGGGAGAGG + Intronic
920314201 1:205065994-205066016 TCCCCGCAGCTTTGAGGGAAGGG - Intronic
920341754 1:205279557-205279579 TTCCCACAGCCCCCAGGGCTTGG - Intergenic
920692724 1:208159152-208159174 TCCCCAGAGCCTCTAGGGAAGGG - Intronic
920698948 1:208203305-208203327 TCCCCAGAGCCTGCATGGAAGGG - Intronic
920977602 1:210800657-210800679 TCCCCACTGCACTCAGAGAGAGG - Intronic
921562007 1:216670457-216670479 AGCCCACAGCCTTCAGGCAAGGG - Intronic
921930914 1:220753570-220753592 TGACCAGAGCCATCAGGGAAAGG - Intronic
922791134 1:228311727-228311749 ACCCCACACCCCACAGGCAAGGG - Intronic
922822737 1:228495115-228495137 TCCCCCCAGGCCCCAAGGAAAGG - Exonic
923242207 1:232097059-232097081 TCCTCACAGGCCTAAGAGAAAGG + Intergenic
923671217 1:236042907-236042929 TCCCCACTGCCTCCAGGGAGGGG + Intronic
924815107 1:247434663-247434685 TCCCAGAAGCACTCAGGGAAGGG - Intronic
1062860658 10:806779-806801 CCCCCACTGGCCTCAGGAAACGG + Intergenic
1064144895 10:12819668-12819690 ACCCCACTGCCCAAAGGGAAAGG - Intronic
1064193714 10:13228838-13228860 TCCCCACAGCCCCAAGCCAATGG + Intronic
1064600372 10:16986467-16986489 TCCCCCCAGCCATCCGGTAAAGG + Intronic
1065968095 10:30784990-30785012 TCCCCAGAGCGCGCAGGGAGCGG + Intergenic
1067752736 10:48982681-48982703 TCCCCACAGTTCTCAAGGAAGGG + Exonic
1069568365 10:69478947-69478969 TGCCCACATCCCACATGGAAGGG + Intronic
1069609991 10:69766562-69766584 CCCCCACAGCCCTGTGGGGAAGG + Intergenic
1069793908 10:71040459-71040481 TCCCCAGAGCCCACATGGGAAGG + Intergenic
1072527825 10:96289624-96289646 TGCTCCCAGCCCTGAGGGAAAGG - Intergenic
1072609194 10:97005174-97005196 TCCCCAAGGCCCACAGGGCAAGG - Intronic
1074121321 10:110496337-110496359 TGCCCCCAGCCCAGAGGGAAGGG - Intergenic
1074545883 10:114402374-114402396 TCCCCAAATTCCTCAGTGAAAGG + Intronic
1075317693 10:121465833-121465855 TCCCCTCAGCCTTCAAGTAAGGG - Intergenic
1077058008 11:605339-605361 TGCCCACAGCCCCCAGGGAGAGG - Intronic
1077435071 11:2535027-2535049 TCTGCACAGCCCCCAGGGCACGG + Intronic
1078549695 11:12271567-12271589 TCCCAACAGCCCTAAGAGAACGG - Intergenic
1079242327 11:18729560-18729582 TCCCCTCGGCCCTCAGTGCAGGG - Exonic
1079349886 11:19683533-19683555 TCCCCACAGGCCTCTTGGATGGG - Intronic
1080424305 11:32142284-32142306 GCCCCGCAGGCCTAAGGGAAGGG + Intergenic
1081747082 11:45480904-45480926 TCCCCAAGGCCCTCAGAGAATGG + Intergenic
1082030966 11:47603070-47603092 TCCACCCAGCCCACAAGGAATGG - Intergenic
1082991221 11:59208662-59208684 TCCCCACAGACCCCAGGCTAAGG + Exonic
1083240549 11:61384773-61384795 TCCCCAAAGCCCTCCAGGCATGG - Intergenic
1083597040 11:63922893-63922915 ACCCAGCAGCCCTGAGGGAAGGG - Intergenic
1083600455 11:63944306-63944328 TCTCCAGAGAGCTCAGGGAAAGG + Intronic
1083718814 11:64593877-64593899 ACTCCCCAGCCCCCAGGGAAAGG - Intronic
1085030368 11:73267387-73267409 ACCTCACAGCTCTCAGGGGACGG + Intronic
1085660705 11:78363957-78363979 TACCCACAGACCTAAGGGAAAGG + Intronic
1088661589 11:112052765-112052787 TACCCACTGACCTAAGGGAAAGG - Intronic
1088754980 11:112878283-112878305 TCCCCACAGACCTGAGGAAGAGG + Intergenic
1089158478 11:116420313-116420335 TCCCCAGGGCCTCCAGGGAAGGG - Intergenic
1089173667 11:116533525-116533547 TGCCGGCAGCCCTGAGGGAATGG - Intergenic
1090187440 11:124747506-124747528 CCCTCACCGCCCTCAGGGATCGG + Exonic
1090335585 11:125961018-125961040 TCAGCACAGCCCTCGGGGACAGG + Exonic
1090831445 11:130423552-130423574 TCCCCACAGCATGCAGGTAAGGG + Intronic
1091187726 11:133661600-133661622 TCCACACAGCCGTCTGGGAATGG - Intergenic
1091316105 11:134615161-134615183 GCCCCTCAGCTCTCAGGGCAGGG + Intergenic
1091568844 12:1667050-1667072 TACCCACTGGCCTCAGGCAAAGG - Intergenic
1091704415 12:2684075-2684097 TCCCCACACTCCTCAGGGTGGGG - Intronic
1091710989 12:2740425-2740447 TCCCCACACTCCTCAGGGTGGGG - Intergenic
1092912929 12:13164280-13164302 TTCCAACAGCCCTCAGAGAGGGG - Intergenic
1092989900 12:13886617-13886639 TTCCCGCAGCCAGCAGGGAAAGG + Intronic
1093022192 12:14214109-14214131 TCCCCACAGTCCTCAAGAAAAGG + Intergenic
1095824983 12:46521422-46521444 TCCCCACAGCCCTGACAGATGGG + Intergenic
1096130591 12:49155879-49155901 TCCCCCAAGACCTCAGGGAAGGG + Intergenic
1096263075 12:50104896-50104918 TCTCCTCAGTCCTCAGGAAAGGG - Intronic
1096346163 12:50848737-50848759 TGACCACAGCTCTCTGGGAAAGG - Intronic
1096500650 12:52062222-52062244 TCCACACTGGCCTCAGGGAAGGG - Intergenic
1096557454 12:52412056-52412078 TCCCCGAGGCTCTCAGGGAAGGG - Intergenic
1096571568 12:52526376-52526398 TGCACACAGCCCTCGGGAAATGG - Intergenic
1100981510 12:100166180-100166202 TCCCCACAGCCATCAGAGCAGGG + Intergenic
1103843750 12:123887074-123887096 ACCCCGGAGCCCGCAGGGAAGGG + Intronic
1104320676 12:127748004-127748026 TGCCCACAGCCCTCTAGGCAGGG - Intergenic
1104378796 12:128288811-128288833 TTCCCTCAGCCCTCACTGAAGGG - Intronic
1104415605 12:128594723-128594745 TCCCCACAGCCCTCAGTCCAGGG + Intronic
1104948761 12:132429338-132429360 TTCCCACAGGCCCCATGGAAAGG - Intergenic
1105509691 13:21040814-21040836 GCCCCACAGACATGAGGGAAAGG + Intronic
1106022551 13:25929277-25929299 TCCCATCTGCCTTCAGGGAAGGG - Intronic
1106182485 13:27381164-27381186 GCCACTCAGCACTCAGGGAATGG - Intergenic
1106553399 13:30790328-30790350 TCCTCACACACCTCTGGGAAGGG - Intergenic
1107790564 13:43998147-43998169 CCCCCACAACCCTGGGGGAATGG + Intergenic
1108065474 13:46573020-46573042 TCCCCAAAGCCCTCTGTGACAGG - Intronic
1108623520 13:52206170-52206192 TTCCCACAGCCCCAAGGGGATGG + Intergenic
1109856706 13:68138932-68138954 TCACAACAGCCCTCAGAGATTGG + Intergenic
1110166616 13:72449959-72449981 GCCCCACAGCCCTCAGCCACAGG + Intergenic
1112706948 13:102080976-102080998 TCCCAACATCCCTCATGCAAAGG - Intronic
1114126243 14:19729801-19729823 TCCCCAAAGCCCACTGGGAGAGG - Intronic
1116178500 14:41505613-41505635 TCTCCTCTGCCCTCAGGGACTGG + Intergenic
1119378572 14:74214415-74214437 TCCCCACAGCGCTCAGCCATGGG + Intergenic
1119623716 14:76152270-76152292 TCGCCCCAGCCCTCAGGGACGGG + Intronic
1119666986 14:76491777-76491799 TGCCCACAGGCCCCAGGGATGGG - Intronic
1119853473 14:77882589-77882611 GCCTCAGGGCCCTCAGGGAAGGG - Intronic
1121311411 14:92937378-92937400 TCCACACAGCCCTGGAGGAAGGG + Exonic
1121348837 14:93156834-93156856 TCCCTCCAGCCCTAGGGGAAGGG + Intergenic
1122018651 14:98818671-98818693 TCCCGCCAGCCCTCAGTGAAGGG + Intergenic
1122266282 14:100548429-100548451 TACCCACAGCCCTCGGGAAGAGG + Intronic
1122905122 14:104798059-104798081 GCCCCACACCGATCAGGGAAGGG - Intergenic
1124124797 15:26929544-26929566 GCCCCACAGCTCTCTGGGACTGG + Intronic
1126640613 15:50821681-50821703 TCCCCACAGGCACCAGGCAAGGG - Intergenic
1127710928 15:61597382-61597404 TCCTCACAGAGCTCCGGGAAAGG - Intergenic
1128888611 15:71311060-71311082 TCCACACAGTCCTCAGGGCCTGG + Intronic
1128996296 15:72298846-72298868 TCCCCAAATCCCTCAGACAATGG - Intronic
1129475720 15:75783487-75783509 CCCCCACAGCCATCAGAGCAAGG - Intergenic
1129839548 15:78735261-78735283 CCCCCACAGCCATCAGAGGAGGG - Intergenic
1131227546 15:90637806-90637828 TCCCCACAGGGCTCTGGGACTGG - Intronic
1131853692 15:96569585-96569607 TCCCCACAGCCCTCCGTGAGGGG + Intergenic
1132668861 16:1094652-1094674 ACCCAACAGCCCACAGGGAGTGG - Intronic
1132975348 16:2708421-2708443 TCCCCACAGCCAGCTGAGAAAGG - Exonic
1133305393 16:4805053-4805075 TCCCCACCGGCCTCAGGGGAAGG + Exonic
1136009237 16:27352123-27352145 TCACCACAACCCTGCGGGAAGGG + Intronic
1136182356 16:28562421-28562443 GCCATACAGCCATCAGGGAAAGG - Intronic
1136280822 16:29210166-29210188 ACCCCCCAGCCCTCTGGGAGTGG - Intergenic
1136552172 16:30987634-30987656 TCCCCACAGCAGCCTGGGAAAGG - Intronic
1136617985 16:31410400-31410422 TCCCCACAGCCCCCAGGAAGAGG - Exonic
1137319626 16:47367366-47367388 TCCCCACAGCCTCCAGGAATGGG - Intronic
1137624146 16:49897014-49897036 TCCATACAGCCCTCAGCCAATGG + Intergenic
1138007882 16:53354791-53354813 GCCCCCCAGCCCCAAGGGAATGG + Intergenic
1138194131 16:55040137-55040159 CCCCCACAGCCTGGAGGGAACGG + Intergenic
1139523539 16:67499190-67499212 TCCCCAGGGTCCTCAGGCAACGG - Intergenic
1141034919 16:80618532-80618554 TCCCCAGAGCCCCCACCGAATGG - Intronic
1141757090 16:85998501-85998523 TCTCCAGAGCCCTCAGGGGCAGG + Intergenic
1141856051 16:86682212-86682234 TTCCCATTGCCTTCAGGGAAGGG + Intergenic
1142085178 16:88176088-88176110 ACCCCCCAGCCCTCTGGGAGTGG - Intergenic
1142640171 17:1280883-1280905 GCCCCGGAGCCCTCAGGGTACGG - Intronic
1142743493 17:1943447-1943469 TCCCCGCAGCCCCCTGGGCAGGG + Intronic
1143270138 17:5669296-5669318 TCCCCTGAGCCCTGAGTGAAGGG + Intergenic
1144802630 17:17941155-17941177 TCCCCAAAGTTCTCAGAGAAGGG - Intronic
1145206587 17:20987687-20987709 TGCCCAGTGCCCTCTGGGAAGGG - Intergenic
1146523083 17:33541668-33541690 TCCCCAGAAGCCTCATGGAAAGG + Intronic
1146790282 17:35747060-35747082 CCCCCAGACCCCGCAGGGAACGG - Exonic
1147979313 17:44264991-44265013 TCCCCACAGCCCCCAGTGCTCGG - Intronic
1147979335 17:44265050-44265072 TCCCCACAGCCCCCAGTGCTCGG - Intronic
1148724562 17:49779429-49779451 AGCCTACAGCCCTCAGGCAAGGG + Intronic
1148918127 17:51001816-51001838 TTCCCACAGCCCAGAGGAAACGG - Exonic
1151632206 17:75318686-75318708 TCAACACAGCCCACTGGGAAGGG + Exonic
1151924671 17:77186262-77186284 GACCCACAGCCCCCAGGGGAGGG - Intronic
1152050106 17:77967614-77967636 TGCCCAGAGGCCTCAGGAAAAGG - Intergenic
1152930514 17:83107405-83107427 TTCCCAAAGCCCTCAGTGCAAGG - Intergenic
1153190447 18:2532219-2532241 TCCCCAGAGCCTTCAGAAAATGG + Intergenic
1153700066 18:7683831-7683853 TCCCCAGAGCCTCCAGGTAAAGG - Intronic
1155046473 18:22107847-22107869 TCCCCACTGCCCACAGAAAAAGG - Intergenic
1155224120 18:23713452-23713474 TCCAAACAACCATCAGGGAAGGG - Intronic
1155347816 18:24875990-24876012 TCCCCAGTGGCCTGAGGGAAGGG - Intergenic
1157310163 18:46546792-46546814 TTCCCAGAGCCCACAGGGGAGGG + Intronic
1157405465 18:47419076-47419098 TCCCAACAGCCCTCTGGAATTGG + Intergenic
1158878210 18:61752649-61752671 TCCTCAGGCCCCTCAGGGAACGG - Intergenic
1159971848 18:74665305-74665327 GCCCCACTGCCCTCAGAGCAGGG + Intronic
1160752649 19:741663-741685 TTCCCAAAGCCCTCAGGACACGG - Intronic
1161076719 19:2289515-2289537 GCCCCACAGCCCCAAGGGGAGGG - Intronic
1161399912 19:4062648-4062670 TCCTCTCAGCCCCCAGGGTAGGG - Intronic
1161414723 19:4139592-4139614 ACCCCACAGATATCAGGGAAAGG + Intergenic
1161468548 19:4445304-4445326 TCCCCACAGCCCCCAAGGGATGG + Exonic
1161719294 19:5894347-5894369 AGCCCACAGCGCTGAGGGAAGGG + Intronic
1161766432 19:6211374-6211396 TCCCCAGAACTCTCGGGGAAAGG - Intergenic
1162528775 19:11223218-11223240 TCACCACAGCCCACAGACAAAGG - Intronic
1163099939 19:15089304-15089326 TCCCCACAACCCCCAGTCAAGGG + Intergenic
1165103751 19:33456615-33456637 TCAACACAGCCTTCAGAGAAAGG + Intronic
1165849443 19:38840670-38840692 GCCCCACAGCCCTCGAGGAAGGG - Intronic
1166160716 19:40950892-40950914 CCCCCACAGCCCACAGAAAATGG + Intergenic
1166219201 19:41354073-41354095 TCCCTTCAGCCCTGGGGGAAAGG + Intronic
1166253730 19:41587746-41587768 TCCCCAGGGCCCTCAGGGAAGGG - Intronic
1166749930 19:45159792-45159814 TCCACACAGGCCTCAGGGTTTGG + Intronic
1166881572 19:45933602-45933624 TGCCCAGAGCCCTGGGGGAAAGG + Intergenic
1166932240 19:46308431-46308453 TCCCCATAGACCCCAGGGCAGGG - Intronic
1167686153 19:50958025-50958047 TCCCCAGTGCCCTCAGGAGAAGG + Intergenic
1168725421 19:58578572-58578594 CCCCCACCTCCTTCAGGGAAAGG - Intergenic
926701895 2:15809570-15809592 TCCCCAAAGTCCTCGGGGAAGGG - Intergenic
927079151 2:19610590-19610612 TCCCCACAGCCCTTGGGCCAGGG - Intergenic
927211631 2:20642451-20642473 TGAAAACAGCCCTCAGGGAAAGG + Intronic
927505297 2:23609449-23609471 TCCCCACAGCCCTCAGGATGTGG - Intronic
931364086 2:61603719-61603741 TGCTCACAGCCCCCTGGGAAAGG - Intergenic
932436770 2:71706367-71706389 CCCCCACCGCCCTCAGAGGAAGG - Intergenic
933791099 2:85884162-85884184 TCACCACAGCCCTCAGTGTTTGG - Intronic
933796104 2:85921062-85921084 AACCCACAGCCCTGAGGGCAAGG - Intergenic
934036841 2:88095461-88095483 TCACCTCAGACCACAGGGAAGGG + Intronic
934558114 2:95298018-95298040 TCCCCACAGCCCTACTGAAAGGG - Intronic
936413381 2:112280844-112280866 TCCCCACATCCTTCAGGGTCTGG - Intronic
936417628 2:112331931-112331953 TCATCACAGCCCTCAGGGGCAGG + Exonic
937025346 2:118692960-118692982 TCCCCTCAGCCTGCAGGGAGAGG + Intergenic
937066408 2:119021057-119021079 TCTCCAAAGCCCTCAGAGATGGG - Intergenic
938135872 2:128755989-128756011 TCCCCACAGCCCACAGGATGGGG - Intergenic
940321895 2:152386215-152386237 TCCCCAGTGCTCTCAGTGAAAGG + Intronic
940913007 2:159225405-159225427 TCCCCACATCCCACCCGGAAGGG + Intronic
942454859 2:176130589-176130611 TCCCCGCCGCCCTCCGGGACTGG + Exonic
945040293 2:205738488-205738510 GCTCCACAGCTCTCAGGAAAGGG - Intronic
945067567 2:205960049-205960071 TCCACACACCCCACAGGGAGAGG + Intergenic
945542483 2:211105725-211105747 CCCCCATTGCCATCAGGGAAGGG - Intergenic
946153843 2:217794144-217794166 TCCCCAGAGGCCTAAGGAAATGG + Intergenic
947853316 2:233306147-233306169 TCCCAAGAACACTCAGGGAATGG - Intergenic
948099179 2:235359881-235359903 TCCCCACAGCCCTCTGGAAGGGG + Intergenic
948189390 2:236046213-236046235 TCCCCACAGCACTCGGTGATGGG + Intronic
948439592 2:237978240-237978262 TGCCCACAGCCCTCACTGAGGGG + Intronic
948457739 2:238114650-238114672 TCCCAGCAGCCCCCGGGGAAGGG + Intronic
948789523 2:240370109-240370131 TCCCCACAGCCCCCACCGCAGGG - Intergenic
948895845 2:240926501-240926523 TCCCAACAGCCCTCCAGCAAAGG + Intronic
949047143 2:241877401-241877423 CCCCCACGGCCTGCAGGGAAGGG - Intergenic
1169021846 20:2336221-2336243 TCCCCACAGCCCAGGGTGAAGGG + Intronic
1169143077 20:3236964-3236986 TACCCAGAGCCCTCAGGACATGG - Intronic
1169146290 20:3254715-3254737 TCCCCAAACCCCTCAGGAAAAGG + Intronic
1169356761 20:4913188-4913210 CCCCCACATCCTTCAGGGGAAGG + Intronic
1169666436 20:8041824-8041846 TCCCCCCAGTCGCCAGGGAATGG + Intergenic
1170406748 20:16045899-16045921 TCTCATCAGCCCTCAGGGTATGG - Intronic
1170841831 20:19930127-19930149 TCCCCACATCCAGCAGGGAAGGG + Intronic
1171382073 20:24741818-24741840 CCCCCACAGCCCACTGGGCATGG - Intergenic
1171542902 20:25978182-25978204 TCAGCACAGCTCTCTGGGAAAGG - Intergenic
1171943138 20:31350230-31350252 TTCCCATTGCCTTCAGGGAAAGG - Intergenic
1172121004 20:32598704-32598726 TCACCTCAGCTCCCAGGGAAGGG - Intronic
1172195559 20:33089351-33089373 TCACCACAGCCCTGTGGGGAAGG - Intronic
1172330942 20:34075689-34075711 TCCCAACAGCCATCAGGGTCCGG + Intronic
1172997162 20:39079494-39079516 ACACCACAACACTCAGGGAAGGG - Intergenic
1173583898 20:44167134-44167156 TTCCAGCAGCACTCAGGGAATGG - Intronic
1174195775 20:48771792-48771814 TCACCACAGCCCTGTGGGCAGGG + Intronic
1175384828 20:58587489-58587511 CAGCCACAGCCCTCAGCGAATGG - Intergenic
1175687634 20:61043313-61043335 CGCCCACTGCCCTCAGGGAGCGG + Intergenic
1175914533 20:62419527-62419549 TCTCCACAGCCCTCACCTAAGGG - Intronic
1176380084 21:6107994-6108016 CCCCCTCCACCCTCAGGGAATGG - Intergenic
1178826819 21:36024283-36024305 TCCCCACAGCACTGAGGTCAAGG - Intergenic
1179743390 21:43430244-43430266 CCCCCTCCACCCTCAGGGAATGG + Intergenic
1179788719 21:43743517-43743539 TCCCCACAGTGCTCAGGGGCTGG - Intronic
1179788737 21:43743568-43743590 TCCCCACAGTGCTCAGGGGCAGG - Intronic
1179816258 21:43908277-43908299 TCCCCAGAGTCCTCAGGGCTGGG - Intronic
1179885976 21:44314440-44314462 CCCCGACCGCCCTCAGGGGAAGG - Intronic
1179959099 21:44758362-44758384 CCCACTCAGCCCTCAGGGATAGG + Intergenic
1180106605 21:45622912-45622934 TCCCCACACCCCTCACTGCATGG + Intergenic
1180836847 22:18934233-18934255 TCCCCACAGCCCAGAGGGTGAGG + Intronic
1181168360 22:20995043-20995065 CCCTCCCAGCCCCCAGGGAAGGG - Intronic
1181459658 22:23078628-23078650 TCCCCAGGGACCACAGGGAATGG + Intronic
1181577745 22:23806234-23806256 TTCCTACAGCCCTCAGGAAGAGG + Intronic
1181694293 22:24585256-24585278 CCACCACAGCCCTCTGGGCAGGG - Intronic
1182364220 22:29767048-29767070 TTCCCAAAGCTCTCTGGGAAGGG - Intergenic
1182606036 22:31504683-31504705 TCCCCTGAGCCTTCAGGGAGAGG - Intronic
1182786410 22:32911512-32911534 CCCCCACAGGCATCAGGGCAAGG - Intronic
1183303470 22:37069861-37069883 TCCCCACTGCCCTCAGGTAGAGG - Intronic
1183356728 22:37363767-37363789 TCCCCACATGCCTGAGGGAGGGG + Intergenic
1183538743 22:38417678-38417700 TCCCCACTGCCTACAGGAAAAGG + Intergenic
1183564599 22:38604488-38604510 TCCCCACAAACCTCAGTGGATGG - Intronic
1184068560 22:42134603-42134625 TGGCCACAGCTCGCAGGGAATGG - Intergenic
1184748848 22:46472775-46472797 GACCCCCAGCCCCCAGGGAAAGG - Intronic
1184818543 22:46891046-46891068 TCCCGACAGCACTCAGGAAGGGG - Intronic
1184878655 22:47291304-47291326 TCCACACAGCCCCCTGGGATGGG + Intergenic
1185029195 22:48432710-48432732 CCCCCTCTGCCCTCGGGGAAAGG - Intergenic
1185068572 22:48644202-48644224 GCCCCACAGCCTTCGGGGAGGGG + Intronic
1185133073 22:49051724-49051746 TCCCCACAGGCTGCAGGGACCGG - Intergenic
1203286940 22_KI270734v1_random:159532-159554 TCCCCACAGCCCAGAGGGTGAGG + Intergenic
949111923 3:271155-271177 TCCCCACAATCCTTAGGAAATGG - Intronic
950004771 3:9684655-9684677 TACTCACAGCCCACAAGGAAAGG - Exonic
950707034 3:14789231-14789253 TGCCGACAGCCCTCAGTGCAGGG - Intergenic
950774646 3:15338925-15338947 TCCCCAGAGCCCTCATGGTAAGG + Intronic
952160873 3:30691714-30691736 TCCCCACAGCTTACAGGGAGGGG - Exonic
952781941 3:37109320-37109342 TACCAACAGCCCTCTGTGAAAGG + Intronic
952933208 3:38375662-38375684 TCCCGACGGCTCTCATGGAAGGG + Intronic
953236748 3:41113637-41113659 CCACCACTGCCCTCGGGGAAGGG - Intergenic
954211120 3:49097991-49098013 TCCAGACAGCCATCAGGGAAAGG - Exonic
954417248 3:50399295-50399317 TCTGCACAGCCCAGAGGGAAAGG + Intronic
956700761 3:71956636-71956658 ACCCTACAGCCCTCAGCCAATGG - Intergenic
958915748 3:100048171-100048193 GCTGAACAGCCCTCAGGGAAGGG + Intronic
961357265 3:126346927-126346949 TCCTCACAGTCCTCAGGAATAGG - Intronic
967303395 3:188038397-188038419 TCCCCACCCCACTCAGGAAAGGG - Intergenic
967481765 3:189980917-189980939 CACCCACAGACCTCTGGGAAAGG + Intronic
968289278 3:197526253-197526275 TTCCCACAGCCCTCAGGGCTGGG - Intronic
968920748 4:3521178-3521200 TTCCCCCAGCCCCCAGGAAAGGG - Intronic
969548289 4:7846521-7846543 ACCACACAGCCCTCAGGGCTCGG + Intronic
970961134 4:21872123-21872145 TCTCTGCAGCCCTCAGAGAAGGG + Intronic
971378950 4:26078940-26078962 TCACTACAGCCCTCTAGGAAAGG - Intergenic
973262935 4:48182939-48182961 TCCCCACCACACACAGGGAAAGG + Intronic
974033839 4:56799977-56799999 TTCCCACAGCCATCAGGAAGAGG - Intergenic
975743158 4:77450241-77450263 TCCCCACCACCTCCAGGGAAAGG + Intergenic
977517926 4:98045412-98045434 TTTCCACAGGCCTCAGGAAATGG - Intronic
978407673 4:108397062-108397084 CACCCTGAGCCCTCAGGGAAGGG - Intergenic
983062427 4:163174641-163174663 ATCCCTCAGCCCTCATGGAAAGG + Intergenic
985636056 5:1036448-1036470 TTCCCACAGCCCTGAGTGCAGGG + Intronic
985675920 5:1231296-1231318 GCCCCACAGGCCCCAGGGCAGGG - Intronic
986448999 5:7848562-7848584 TGCCTACAAGCCTCAGGGAAAGG - Intronic
988678377 5:33458028-33458050 GCCCAAAAGCCCTCAGGGAAGGG - Intronic
989592102 5:43121421-43121443 TACCCACACCCCTCAGTGGATGG - Intronic
990874060 5:60464615-60464637 TTCCCACAGATCTCAGGGATGGG + Intronic
991145481 5:63297828-63297850 TCCCCACAGCCAACAAGAAATGG + Intergenic
991633641 5:68681392-68681414 TGAACAAAGCCCTCAGGGAATGG - Intergenic
996776974 5:127143192-127143214 TCCCCACAGCCACCAGGACACGG + Intergenic
997341045 5:133144812-133144834 TCCCCAGGGCCCTCAGGGATGGG - Intergenic
998473338 5:142400499-142400521 TCCCCACCGCCATCTGGCAAAGG - Intergenic
999512927 5:152271633-152271655 TACCCACAGCTCTCAGAGAGAGG + Intergenic
1000100601 5:158012742-158012764 GCCCCAAAGACCTTAGGGAACGG - Intergenic
1002277683 5:178114157-178114179 TCCCGGCAGGCCTCAGGGAGGGG + Intronic
1006404314 6:33835289-33835311 GCCCCACAGGCCACAGGGATTGG - Intergenic
1006478668 6:34274244-34274266 TACCCACAGCTTTCAGGGTAAGG - Intergenic
1006744406 6:36331197-36331219 CCCCCAAAACCCTCGGGGAATGG + Intronic
1007203708 6:40132212-40132234 TGGCCACAGACCTCAGTGAATGG + Intergenic
1007212486 6:40206500-40206522 TCAGCTCAGCCCTCAGGGGAGGG + Intergenic
1008960786 6:57263349-57263371 TCCCTACAGCCTTCAGAGAGAGG - Intergenic
1013020788 6:106215351-106215373 TACCCTCACCCCTCAAGGAATGG + Intronic
1013196495 6:107848980-107849002 TTCCCACAGCCTTGAGGGAAGGG - Intergenic
1013637394 6:112041962-112041984 TCCCTGCAGCCCACAGGCAATGG - Intergenic
1014277017 6:119398987-119399009 TCCCCACTGCCTTCCTGGAAAGG - Intergenic
1018028100 6:159821291-159821313 GCCCCTCACCCCTCAGGAAAGGG - Intergenic
1018698577 6:166409649-166409671 TCTCCACACCGCTCAGGGACCGG + Intronic
1019225000 6:170501951-170501973 GTCCCACAGCCATCAGGGAAAGG + Intergenic
1019225052 6:170502199-170502221 GTCCCACAGCCATCAGGGGAAGG + Intergenic
1019225235 6:170503063-170503085 GTCCCACAGCCATCAGGGGAAGG + Intergenic
1019486927 7:1293642-1293664 TCCCCGCAGCCCCCAGGGTCCGG - Intergenic
1019729415 7:2622207-2622229 TTCCCACAGCTCTCAGGGCAAGG - Intergenic
1021202467 7:17741794-17741816 TCCCTACTGCCCTCAGGCAAGGG + Intergenic
1024200801 7:47103919-47103941 TCCACAGAGCCCTCAGTGGAAGG + Intergenic
1024524631 7:50337411-50337433 TGCACAGAGCCCTGAGGGAAGGG - Intronic
1026878803 7:73895079-73895101 TCCCCACAACCCCCAGGGAGGGG + Intergenic
1028673160 7:93428249-93428271 TCACAACAGCCCTATGGGAAGGG + Intronic
1029284768 7:99457962-99457984 TGCCCACAGCACTCATGGCAAGG + Intronic
1029601102 7:101563899-101563921 TCTCCACAGCCCCTGGGGAAAGG + Intergenic
1030086033 7:105816573-105816595 TCCCCACAGCCCTCAGGGAAGGG + Intronic
1030145098 7:106344931-106344953 TTACCACAGATCTCAGGGAAGGG - Intergenic
1032912286 7:136446962-136446984 TGCCCACAGAGTTCAGGGAAAGG + Intergenic
1034273283 7:149813422-149813444 TCCCCTCCACCCTCAGGGAGGGG + Intergenic
1034808078 7:154106068-154106090 TCTCCACAGCCCCCATGGAGAGG + Intronic
1035238406 7:157515033-157515055 TTCCCACAGAAATCAGGGAATGG + Intergenic
1035395317 7:158531215-158531237 ACCCTACAGCGCTCAGGTAACGG + Intronic
1035861414 8:3032422-3032444 TGCCAACAGCCCCCACGGAATGG + Intronic
1035872659 8:3152895-3152917 TCCCACGAGCCCTAAGGGAAAGG - Intronic
1037777482 8:21845152-21845174 TCCCCTCACCCCTTTGGGAAAGG + Intergenic
1037951252 8:23019790-23019812 TTCCGACAGCTCTCGGGGAATGG - Intronic
1038421649 8:27437660-27437682 CTCCCACCGCCCCCAGGGAAGGG + Intronic
1039038991 8:33389062-33389084 TTCTGACAGCTCTCAGGGAACGG - Exonic
1040320271 8:46290868-46290890 TCCCCAGAGGCTTCTGGGAAGGG + Intergenic
1041405987 8:57500208-57500230 TACACACAGCTCTCAAGGAAGGG + Intergenic
1041678713 8:60564288-60564310 TACCCACAGCACCAAGGGAAAGG - Intronic
1042963701 8:74329100-74329122 CCCACACAGCCCTCAAGAAAAGG - Intronic
1045239995 8:100391787-100391809 ACCCCACAGCACTCAGGAACTGG - Intronic
1045379597 8:101610194-101610216 TCCCCACAGCACTTTGGGAGGGG - Intronic
1046724072 8:117655533-117655555 TCCCCACAGATCACAGGGAATGG - Intergenic
1047360732 8:124166530-124166552 TCACCACAGCGCACAGAGAAAGG + Intergenic
1048255912 8:132905032-132905054 TCCCCACAACCCTATGGGATAGG - Intronic
1048350035 8:133608577-133608599 CAACCACACCCCTCAGGGAAGGG - Intergenic
1048539590 8:135330719-135330741 TCCCCACAGCCCTTAGGCAGAGG + Intergenic
1048784430 8:138035347-138035369 TCACAACAGCCCTCTGGGAAAGG - Intergenic
1049288245 8:141788169-141788191 GCCCCACAGACCTCAGGGCCAGG + Intergenic
1049303292 8:141883212-141883234 TTCCCAGAGCCCCCAGGGCAGGG - Intergenic
1049379702 8:142305817-142305839 TCCCCACAGGGCTCAGGGCCTGG + Intronic
1049601007 8:143507672-143507694 ACCCTGCAGCCCTCAGGGCAGGG + Intronic
1049624063 8:143612288-143612310 TCCCCAGAGCCCTCAGGCTGAGG + Intergenic
1049685358 8:143937229-143937251 TCCCCACAGCCCCGGGAGAAGGG - Exonic
1050312794 9:4370356-4370378 ACCCCATGGCTCTCAGGGAAGGG - Intergenic
1052999205 9:34568265-34568287 TGCCCACAGCCCACAGGACAAGG - Intronic
1053196267 9:36121413-36121435 ACCGCACAGCCCTCAGCGGAAGG - Intronic
1053457490 9:38242749-38242771 CCCCCACCGCCCTCCCGGAAGGG - Intergenic
1053484448 9:38441592-38441614 TCACAACAGCCCTATGGGAAAGG - Intergenic
1054743430 9:68830911-68830933 GAGCCACAGGCCTCAGGGAAAGG - Intronic
1057695334 9:97318889-97318911 TCCCCAGTGCCCTCAGAAAAAGG - Intronic
1057796430 9:98161221-98161243 TCCCCACTGCCCTCAGAGTCCGG - Intronic
1058892232 9:109371032-109371054 TCCCCACACCCCTGAGAGGAAGG + Intergenic
1059522037 9:114951801-114951823 TCCCAACAGCCCTGGGAGAATGG + Intergenic
1060488135 9:124062554-124062576 GACCCACTGCCCTCTGGGAAAGG + Intergenic
1060724507 9:125998038-125998060 TCCACACAGAGCTCAGGGTAGGG + Intergenic
1060779511 9:126401099-126401121 TCCCCACAGACCCCAGGCCATGG + Intronic
1060782350 9:126422114-126422136 TCGCCACAGCACTTAGAGAAGGG + Intronic
1060903068 9:127278765-127278787 TCCCCACGGCCCTCAGAGGGAGG - Intronic
1061284629 9:129615130-129615152 TCCCCACAGCCTACAGGGGCTGG - Intronic
1061309272 9:129751820-129751842 CCGCCACAGCCCTGAGGGCAGGG - Intronic
1062178145 9:135175772-135175794 TCCCCACAGCCCCCAGAGCCAGG + Intergenic
1062543019 9:137049834-137049856 TCCGCACAGCCCTGAAGGAGTGG + Intronic
1186320131 X:8415175-8415197 TCCCCACAGCTCTGAGGCTAAGG + Intergenic
1186782144 X:12923930-12923952 TTCCCACTGCCCTCAGCAAAGGG + Intergenic
1187562830 X:20418637-20418659 ACCCCACAGCCCCCAAGGAGAGG - Intergenic
1187972577 X:24673765-24673787 AACCCAAAGCCTTCAGGGAAGGG - Intergenic
1188537343 X:31212347-31212369 CCCCCACAGCCCTCATGCATAGG - Intronic
1189672201 X:43423204-43423226 TCTCAGAAGCCCTCAGGGAAAGG - Intergenic
1190094343 X:47466958-47466980 TCCCCAGAGACCTGGGGGAAAGG + Intronic
1190635975 X:52434303-52434325 CACCCACAACCTTCAGGGAAGGG + Intergenic
1190704811 X:53018719-53018741 ATCCCCCAGCCCTCAGGGAAGGG + Intergenic
1190708788 X:53050563-53050585 TACACACACCCATCAGGGAAGGG - Intronic
1190955622 X:55190043-55190065 CACCCCCAACCCTCAGGGAAGGG - Intronic
1192369947 X:70504831-70504853 TCCCCATAGCCCTCTGAGGAGGG + Exonic
1192530206 X:71876922-71876944 TCCCCACCTCCCTCCGGGATGGG + Intergenic
1195799770 X:108694867-108694889 TCCCCATTGTCCTCAGGGATGGG + Exonic
1196692622 X:118576559-118576581 TCCCCACAGCCCTTGGAGACAGG - Intronic
1196736036 X:118981787-118981809 GCCCCAGAGCCCTCAGGCTATGG - Intronic
1197138498 X:123090349-123090371 ACCCCAGAGACCTCAGGGTACGG - Intergenic
1198936714 X:141907144-141907166 TCCTCAGAGCCCTCAGGGGGAGG + Exonic
1199763058 X:150919993-150920015 TCCAAACAGCCCACAGGAAATGG - Intergenic
1199879011 X:151958205-151958227 GCTCCACAGCCATCAGTGAAGGG + Intronic
1200002168 X:153067656-153067678 TCCCCACAGCCCTCAGGATAAGG + Intergenic
1200005565 X:153082369-153082391 TCCCCACAGCCCTCAGGATAAGG - Intergenic
1201538076 Y:15073054-15073076 TCCCCATAGCCTTCCTGGAAAGG - Intergenic