ID: 1030087500 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:105829514-105829536 |
| Sequence | CTTCCTCCATGCTGGCCCAT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 226 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 19, 4: 204} |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1030087500_1030087509 | 5 | Left | 1030087500 | 7:105829514-105829536 | CCTATGGGCCAGCATGGAGGAAG | 0: 1 1: 0 2: 2 3: 19 4: 204 |
||
| Right | 1030087509 | 7:105829542-105829564 | GAAATACTGGGGCAATTTTATGG | 0: 1 1: 0 2: 2 3: 11 4: 190 |
||||
| 1030087500_1030087507 | -7 | Left | 1030087500 | 7:105829514-105829536 | CCTATGGGCCAGCATGGAGGAAG | 0: 1 1: 0 2: 2 3: 19 4: 204 |
||
| Right | 1030087507 | 7:105829530-105829552 | GAGGAAGGAGGGGAAATACTGGG | 0: 1 1: 0 2: 3 3: 46 4: 502 |
||||
| 1030087500_1030087506 | -8 | Left | 1030087500 | 7:105829514-105829536 | CCTATGGGCCAGCATGGAGGAAG | 0: 1 1: 0 2: 2 3: 19 4: 204 |
||
| Right | 1030087506 | 7:105829529-105829551 | GGAGGAAGGAGGGGAAATACTGG | 0: 1 1: 0 2: 2 3: 74 4: 851 |
||||
| 1030087500_1030087508 | -6 | Left | 1030087500 | 7:105829514-105829536 | CCTATGGGCCAGCATGGAGGAAG | 0: 1 1: 0 2: 2 3: 19 4: 204 |
||
| Right | 1030087508 | 7:105829531-105829553 | AGGAAGGAGGGGAAATACTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1030087500 | Original CRISPR | CTTCCTCCATGCTGGCCCAT AGG (reversed) | Intronic | ||