ID: 1030087500

View in Genome Browser
Species Human (GRCh38)
Location 7:105829514-105829536
Sequence CTTCCTCCATGCTGGCCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 204}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030087500_1030087509 5 Left 1030087500 7:105829514-105829536 CCTATGGGCCAGCATGGAGGAAG 0: 1
1: 0
2: 2
3: 19
4: 204
Right 1030087509 7:105829542-105829564 GAAATACTGGGGCAATTTTATGG 0: 1
1: 0
2: 2
3: 11
4: 190
1030087500_1030087507 -7 Left 1030087500 7:105829514-105829536 CCTATGGGCCAGCATGGAGGAAG 0: 1
1: 0
2: 2
3: 19
4: 204
Right 1030087507 7:105829530-105829552 GAGGAAGGAGGGGAAATACTGGG 0: 1
1: 0
2: 3
3: 46
4: 502
1030087500_1030087506 -8 Left 1030087500 7:105829514-105829536 CCTATGGGCCAGCATGGAGGAAG 0: 1
1: 0
2: 2
3: 19
4: 204
Right 1030087506 7:105829529-105829551 GGAGGAAGGAGGGGAAATACTGG 0: 1
1: 0
2: 2
3: 74
4: 851
1030087500_1030087508 -6 Left 1030087500 7:105829514-105829536 CCTATGGGCCAGCATGGAGGAAG 0: 1
1: 0
2: 2
3: 19
4: 204
Right 1030087508 7:105829531-105829553 AGGAAGGAGGGGAAATACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030087500 Original CRISPR CTTCCTCCATGCTGGCCCAT AGG (reversed) Intronic