ID: 1030089360

View in Genome Browser
Species Human (GRCh38)
Location 7:105843681-105843703
Sequence ATTGAAAAGAAGAGGGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 505}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030089360_1030089365 6 Left 1030089360 7:105843681-105843703 CCAGGTTCCCTCTTCTTTTCAAT 0: 1
1: 0
2: 4
3: 31
4: 505
Right 1030089365 7:105843710-105843732 TTCTGGCCATTTCATTTCTCAGG No data
1030089360_1030089366 7 Left 1030089360 7:105843681-105843703 CCAGGTTCCCTCTTCTTTTCAAT 0: 1
1: 0
2: 4
3: 31
4: 505
Right 1030089366 7:105843711-105843733 TCTGGCCATTTCATTTCTCAGGG No data
1030089360_1030089368 24 Left 1030089360 7:105843681-105843703 CCAGGTTCCCTCTTCTTTTCAAT 0: 1
1: 0
2: 4
3: 31
4: 505
Right 1030089368 7:105843728-105843750 TCAGGGCCTTCTCAAGAGACAGG 0: 1
1: 0
2: 1
3: 16
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030089360 Original CRISPR ATTGAAAAGAAGAGGGAACC TGG (reversed) Intronic
901472096 1:9464566-9464588 ATGGAACAGAATAGAGAACCCGG - Intergenic
902118134 1:14138718-14138740 ATTGGAAAGGGGAGGCAACCTGG - Intergenic
902548570 1:17205814-17205836 ATTAATATGAAGAGAGAACCTGG + Intronic
902605729 1:17568346-17568368 ATTGTATGGAAGAGGAAACCAGG + Intronic
903463194 1:23533653-23533675 ATTTTACAGATGAGGGAACCTGG + Intergenic
903521560 1:23954656-23954678 ATTGATAGGAAGAGGAAATCTGG - Intergenic
904979912 1:34491001-34491023 ATGGAACAGAAGAGAGAACTTGG + Intergenic
905794177 1:40806282-40806304 ATTGAAAGGAAGGGGAAACATGG - Intronic
906483721 1:46218860-46218882 CCTGAAAAGACTAGGGAACCAGG + Intronic
907740634 1:57162365-57162387 ATTGCAAAGAAGGAGGAAGCAGG + Intronic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
909813702 1:79963519-79963541 ATTGGAAAGAAAAGGGAAAATGG + Intergenic
909945709 1:81660686-81660708 ATTTAAAAGAAAACAGAACCTGG + Intronic
910406194 1:86893104-86893126 ATTTAATAGAAGAGGAAACTAGG - Intronic
910587545 1:88896036-88896058 AGTGAAAAAAAGAGGGTCCCTGG + Intergenic
911183597 1:94882322-94882344 AGTGTAAAGAGGAGGAAACCAGG + Intronic
911316625 1:96363544-96363566 ATTGAAAAGGGGAGAGAACTGGG + Intergenic
911538251 1:99126422-99126444 ATAGAACAGAATAGGAAACCCGG - Intergenic
911895767 1:103433139-103433161 ATTGTAGGGAAGAGGGATCCAGG - Intergenic
912103275 1:106238757-106238779 AGGGAAAAGAAGAAGGAACAAGG + Intergenic
912111607 1:106349184-106349206 ATGGAAAAAAAGAGGGAAACAGG + Intergenic
912601563 1:110939647-110939669 ATGGAACAGAACAGAGAACCTGG + Intergenic
912605584 1:110985590-110985612 ATGGAAATGAGGAGGGATCCAGG + Intergenic
912941488 1:114049087-114049109 AATGAAAAGAGGAGGAAGCCAGG - Intergenic
912960876 1:114194685-114194707 ATAGAACAGAAAAGAGAACCTGG - Intergenic
913232648 1:116754518-116754540 ATTGAAAATCAGAAGGAAGCTGG - Exonic
913964258 1:143362151-143362173 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
914958311 1:152184491-152184513 ATGGAAAAAAAGAGGAAACATGG + Intergenic
915529512 1:156495194-156495216 ATTGAAGGGAAGAGAAAACCAGG - Intronic
916187942 1:162151290-162151312 ATGGAACAGAATGGGGAACCCGG - Intronic
917106794 1:171500376-171500398 ATTAAAAAGAAGAGAAAATCTGG - Intronic
917127374 1:171699270-171699292 ATTCAACAGATGAGAGAACCGGG - Intergenic
917174053 1:172211859-172211881 ATTGAAAAGAAAATGGAACCTGG + Intronic
917447485 1:175118833-175118855 AGTGAAGAGAAGAGCAAACCCGG + Intronic
918429058 1:184439366-184439388 ACTGAACAGATGAGGAAACCAGG - Intronic
918749528 1:188255638-188255660 ATGGAACAGAATAGAGAACCTGG - Intergenic
918888027 1:190222248-190222270 ATTGAAAACAAGAGGAACCTTGG + Intronic
919015965 1:192036897-192036919 ATTAAAAAGAAAATGGAACCAGG - Intergenic
920304789 1:205011627-205011649 CTTAAAAAGATGAGTGAACCAGG + Intronic
921297181 1:213715161-213715183 ATTGTAAAGAAGTCGGAAGCAGG + Intergenic
921608331 1:217180779-217180801 TTTGGAAAGAGGAGCGAACCAGG + Intergenic
923303862 1:232670302-232670324 ATTGAAAAGAGGGGAGTACCCGG - Intergenic
924190762 1:241550071-241550093 ATTGAAAAAAAAAAGGAATCTGG - Intronic
924265839 1:242281019-242281041 ATGGAAAAGATGACGGAGCCTGG + Intronic
924650967 1:245927137-245927159 ATTGGAAAGGAGAAGGAAACGGG + Intronic
924896527 1:248342689-248342711 ATAGAACAGGAGAGAGAACCAGG - Intergenic
1063882777 10:10548169-10548191 ATTTAAGAGACGAGGGAACTGGG - Intergenic
1064453887 10:15468913-15468935 ATTGAAAAGGAGATGGAATTAGG - Intergenic
1064803995 10:19109947-19109969 ATTGCAAAGAAAAGGTAAGCAGG - Intronic
1064950987 10:20849998-20850020 ATTGAAAAAAAAAGGGGGCCAGG + Intronic
1065016146 10:21464553-21464575 AGTGGACAGAAGAGGGAATCAGG + Intergenic
1065488146 10:26254564-26254586 ACTGAAAAGAAGAGAGGACTTGG + Intronic
1065523966 10:26599048-26599070 ACTGAAAAGAAAAAGGAACATGG - Intergenic
1065788553 10:29239016-29239038 AATAAAAAGAAGAGGTCACCAGG - Intergenic
1065826422 10:29576238-29576260 ATTGAGAAGAAGAGTGCACAAGG - Intronic
1066502414 10:36006996-36007018 ATTGAAAAGAGGAGTGAAGTGGG + Intergenic
1067391674 10:45868927-45868949 ATTTAAAAAAAGAGGGGGCCGGG + Intergenic
1067403008 10:45994735-45994757 ATTTAAAAAAAGAGGGGGCCGGG - Intronic
1067871616 10:49967215-49967237 ATTTAAAAAAAGAGGGGGCCGGG - Intronic
1068755014 10:60643066-60643088 ATTAAAAATAAGATGGAGCCAGG - Intronic
1069296388 10:66850210-66850232 ATTTAAAACAACAGGGAAACAGG - Intronic
1069699539 10:70411999-70412021 ATTTAAAAAATGAGGGAATCTGG - Intronic
1069851711 10:71409583-71409605 AGTGGAAAGCAGAGGGCACCCGG + Intronic
1070408674 10:76119373-76119395 TTAAAAATGAAGAGGGAACCTGG + Intronic
1070572846 10:77653948-77653970 ATAGAAAAGAAGAGTCAGCCAGG + Intergenic
1070911135 10:80119366-80119388 TGTGAAAAGAAGGGGGAAGCTGG + Intergenic
1071053684 10:81482698-81482720 AAAGAAAAGAAAAGGGAGCCTGG - Intergenic
1072497833 10:95980153-95980175 ATCGAAAAGAAGAGGGAGGGAGG + Intronic
1072502100 10:96027800-96027822 ATGGAACAGAATAGAGAACCCGG + Intronic
1072566825 10:96623361-96623383 ATTGAAAAATAGAGGGATCTAGG - Intronic
1073596351 10:104804230-104804252 TTTGCAAAGATGAAGGAACCTGG + Intronic
1073752543 10:106545156-106545178 ATGGAAAAGAATAGAGATCCTGG - Intergenic
1075317474 10:121464554-121464576 TTTGGAAAGCAGAGGCAACCTGG + Intergenic
1075882920 10:125869876-125869898 ATTGAAAAGAAGAGAGAGAAAGG + Intronic
1075968439 10:126632661-126632683 ATTGAAAAGAGCAGGGTCCCTGG - Intronic
1076669663 10:132112503-132112525 ATTGAACAAAATAAGGAACCAGG - Intronic
1077504919 11:2925541-2925563 CTTTAAAAGATCAGGGAACCTGG + Intergenic
1079177481 11:18156302-18156324 ATTGGAAAGAACAGTGGACCTGG + Intronic
1080040163 11:27751624-27751646 ATTGGATAAAAGAAGGAACCAGG + Intergenic
1080570622 11:33553382-33553404 ATTGAAAAGAAGAGTTAATTGGG - Intronic
1081696504 11:45113280-45113302 ATGGAACAGAATAGAGAACCCGG - Intronic
1081842489 11:46212982-46213004 ATTGAGTAGAAGAGGGGAACAGG - Intergenic
1081941070 11:46942499-46942521 ATGGAAAAGAAGAGGCAACTTGG - Intronic
1082139523 11:48591977-48591999 ATGGATAAGAAGAAGGACCCAGG - Intergenic
1082221045 11:49637423-49637445 AGTGAAAAGAACATAGAACCAGG - Intergenic
1082616269 11:55363856-55363878 AAAGAAAAGAAGAGGGCACACGG - Intergenic
1083035160 11:59630174-59630196 ATGAAAAAGAACAGGGGACCAGG + Intergenic
1083058554 11:59846539-59846561 ATTTAAAAGAAGAGGGTCCTGGG - Intergenic
1083319344 11:61835685-61835707 ATTAAAAAGAAGAGGGGGCCGGG - Intronic
1083352270 11:62038676-62038698 ATGGAACAGAATAGAGAACCCGG - Intergenic
1083580890 11:63824649-63824671 CTGGAAAAGAGGATGGAACCAGG - Intronic
1084441835 11:69179057-69179079 ATTTAAAAAAAGAGGGAAGGAGG + Intergenic
1085717332 11:78884290-78884312 ATTTTATAGGAGAGGGAACCAGG - Intronic
1086192794 11:84099436-84099458 ATTTAATAGAAGAGTGAACTTGG + Intronic
1087035545 11:93752569-93752591 ATTAGAAAGAAAAAGGAACCAGG - Intronic
1087068630 11:94051967-94051989 ATGGAACAGAATAGAGAACCTGG - Intronic
1087226639 11:95608099-95608121 ATTGGAAAGTAGAGGAGACCAGG - Intergenic
1087832091 11:102830228-102830250 ACTGAAAAGATAAGGCAACCAGG + Intergenic
1088406462 11:109485218-109485240 ATGGAACAGAATAGAGAACCTGG - Intergenic
1089027293 11:115284414-115284436 ATTGAAAAGAAATGGAAGCCGGG - Intronic
1089054281 11:115572642-115572664 ATTGAAGAGATGAGGGAAAGTGG + Intergenic
1089958376 11:122593786-122593808 AGTGATAATAAGAGGGAACTGGG + Intergenic
1090483852 11:127094060-127094082 ATGAAACAGAAGAGAGAACCTGG + Intergenic
1092075102 12:5666204-5666226 ACTGAAAAGAGTAGGCAACCTGG + Intronic
1092535628 12:9384015-9384037 ATTAAAAATAAGAGTGAGCCAGG - Intergenic
1092600922 12:10063451-10063473 ATTAAAAAGAGGAGGGAATAAGG + Intronic
1092992720 12:13918612-13918634 ATTGAAAATGAAAGGGAACTGGG - Intronic
1093676299 12:21944053-21944075 ATTGAACAGAATAGGTAGCCCGG - Intergenic
1093948832 12:25140873-25140895 ATGGAACAGAATAGAGAACCTGG + Intronic
1094488267 12:30941910-30941932 ATTTAAAAGAAGTGGGAAGAAGG - Intronic
1095229058 12:39715389-39715411 ATGGAACAGAATAGAGAACCCGG - Intronic
1096018671 12:48303293-48303315 ATGGAATACAAGAGGGAACAAGG + Intergenic
1096400400 12:51301380-51301402 ATTGTATAGAAGAGGAAACATGG - Intronic
1096676563 12:53229575-53229597 AAGGAAAAGGAGAGGGACCCTGG - Intronic
1097203315 12:57298550-57298572 ATTGATAAGAAAAGGCAAACAGG - Intronic
1097591404 12:61580128-61580150 AATGAAAAGAAAAGGGATTCTGG + Intergenic
1099387039 12:82026712-82026734 ATTGAAAAGAGGAGGATTCCTGG + Intergenic
1099713937 12:86265491-86265513 ATGGAACAGAATAGAGAACCCGG - Intronic
1100061215 12:90578118-90578140 ATGGAACAGAATAGAGAACCCGG + Intergenic
1100061411 12:90580896-90580918 ATGGAACAGAATAGAGAACCCGG + Intergenic
1100226687 12:92564157-92564179 ATTTAAAACAAGAGTGAACTAGG - Intergenic
1100363415 12:93898205-93898227 ATTGAAAAGAGGAGACAAGCAGG + Intergenic
1101298385 12:103451142-103451164 ATTTAAAATAAAATGGAACCTGG - Intronic
1103065329 12:117892978-117893000 AATGAAATGAAGGGGGAAACTGG + Intronic
1104260490 12:127177645-127177667 CTAGACAAGAAGTGGGAACCTGG + Intergenic
1104934258 12:132356143-132356165 ATTCAAAAGCAGATGGAAGCCGG + Intergenic
1106395627 13:29378614-29378636 TTTGAAAAAAACAGTGAACCTGG + Intronic
1107003956 13:35585596-35585618 TTTGCAAAGAAGAGAGAAGCTGG - Intronic
1107083492 13:36400103-36400125 ATTAAACAGAATAGAGAACCTGG - Intergenic
1107965861 13:45597694-45597716 ATGGAGCAGAAGAGGGAGCCTGG - Intronic
1110319235 13:74141418-74141440 AATGAAAATAAGAGGAAACAAGG + Intergenic
1112530335 13:100195903-100195925 ATTGTAAAGAAGAAAGAGCCTGG - Intronic
1112632238 13:101174747-101174769 ATTTAAAAGCATATGGAACCTGG + Intronic
1112819809 13:103319143-103319165 AATGAAAAGAACTGAGAACCAGG - Intergenic
1112894812 13:104285977-104285999 GTTGGAAAGAAAAGGGACCCTGG + Intergenic
1113147962 13:107229828-107229850 AATGGAAAGAGGAGTGAACCTGG - Intronic
1113160329 13:107373174-107373196 AATGAAAGGAAGAGAGAACAGGG - Intronic
1113433738 13:110272643-110272665 AATGAAAAGAAGAAGAAAGCCGG + Intronic
1116239106 14:42318499-42318521 ATAGAATAGAATAGAGAACCCGG - Intergenic
1116349539 14:43842994-43843016 ATTGAAAAGGAGAGCGAAGCTGG - Intergenic
1116946003 14:50835800-50835822 ATTTAAAAGAAGAGTGAATGAGG - Intergenic
1116997409 14:51338001-51338023 ATTGAATACATGAGGAAACCAGG + Intergenic
1117498896 14:56332256-56332278 ATTTAAAAGATGTGGGAACTTGG - Intergenic
1117651497 14:57911321-57911343 ATTGAAAAGCAGTGGTAAGCGGG + Intronic
1117827005 14:59714494-59714516 ATGGCAAAGGAGAAGGAACCTGG - Intronic
1118083163 14:62385651-62385673 ATGGAAAAGAATAGAGAGCCTGG - Intergenic
1118689835 14:68327549-68327571 ATTAAAAGCAAAAGGGAACCAGG - Intronic
1119106114 14:71925751-71925773 ATGGAACAGAAGAGGAAGCCCGG - Intergenic
1119112979 14:71992521-71992543 ATTTAACAGATGAGGGAACTCGG + Intronic
1119133365 14:72194764-72194786 ATAGAGCAGAAGAGGGACCCTGG + Intronic
1120356048 14:83435440-83435462 ATGGAACAGAAGAGAGAACCTGG + Intergenic
1120464859 14:84843320-84843342 ATGGCTAAGAAGAGAGAACCTGG - Intergenic
1121377213 14:93423526-93423548 ATGGAACAGAACAGAGAACCTGG + Intronic
1122679550 14:103447580-103447602 CTTGCAAACAAGAGGAAACCAGG - Intronic
1123426402 15:20174434-20174456 ATTGAAAAAAAAAGTGGACCAGG + Intergenic
1123535635 15:21180961-21180983 ATTGAAAAAAAAAGTGGACCAGG + Intergenic
1123829240 15:24117016-24117038 ATTGAAATGAAGAGGAAAATGGG - Intergenic
1123844170 15:24280461-24280483 ATTGAAATGAAGAGGAAAATGGG - Intergenic
1123859251 15:24446744-24446766 ATTGAAATAAAGAGGAAAACGGG - Intergenic
1123888705 15:24753014-24753036 GTTGAAAAGGAGAGGGACACAGG + Intergenic
1123965166 15:25448771-25448793 ATTGAAAAAAAGAGAGAAATAGG - Intergenic
1124021579 15:25930155-25930177 ATTTAAAAAAAGAGTGAACAGGG - Intergenic
1126919153 15:53501348-53501370 ATGGAACAGAATAGAGAACCCGG - Intergenic
1127066528 15:55245406-55245428 TTTGAAAAGTAGAAGGAAACAGG + Intronic
1129096513 15:73214601-73214623 ATGGAACAGAATAGAGAACCTGG - Intronic
1129928676 15:79389418-79389440 ATGGAACAGAATAGAGAACCCGG - Intronic
1130541213 15:84821972-84821994 ATTGGGAAGTAGAGGGAATCTGG + Intronic
1131323039 15:91414579-91414601 AATGGGAAGAAAAGGGAACCTGG - Intergenic
1131409398 15:92194186-92194208 AGTCAAAAGAAGATGGAACTGGG + Intergenic
1131763100 15:95645763-95645785 ATTGCATAGAAGAGGGGACAGGG - Intergenic
1132958648 16:2610226-2610248 ATAGAGGAGAAGAGGGATCCTGG - Intergenic
1133323575 16:4929978-4930000 ATTGGAAAGCTTAGGGAACCAGG - Intronic
1133696470 16:8268196-8268218 ATGGAACAGAATAGGGAATCTGG - Intergenic
1133928372 16:10211956-10211978 ATTGGACAGATGAGGAAACCAGG - Intergenic
1134212809 16:12292014-12292036 AATCAAAAGAAGAGGGAAATTGG + Intronic
1134238699 16:12487877-12487899 ATCGAGAAGAAGAGAGAAACTGG + Intronic
1134694072 16:16210111-16210133 ATAAAAAAGAAAAGGGAACTTGG - Intronic
1134886113 16:17793214-17793236 ATGCAAAAGAAGAGGCAAACAGG + Intergenic
1134977767 16:18584531-18584553 ATAAAAAAGAAAAGGGAACTTGG + Intergenic
1135207302 16:20494116-20494138 CCTGAAAAGAAAAGGGGACCTGG - Intergenic
1135211583 16:20529516-20529538 CCTGAAAAGAAAAGGGGACCTGG + Intergenic
1135525931 16:23213545-23213567 AATGAAAAGGAGAGGGGGCCAGG - Intronic
1135878632 16:26229990-26230012 ATTGTACAGATGAGGTAACCTGG + Intergenic
1137512111 16:49110137-49110159 ATTGAAGGGAAAAGGGAAACTGG + Intergenic
1140903431 16:79391213-79391235 ATTGTATAGATGAGGGAACCAGG - Intergenic
1140986753 16:80165348-80165370 ATTGAATAAAAGAGGGAACTGGG + Intergenic
1140987871 16:80176362-80176384 ATGGAAATGAAAAGGGAATCTGG + Intergenic
1141287797 16:82688836-82688858 AATGGAAAGAAAAGGGAACAGGG + Intronic
1141307952 16:82884301-82884323 ATTGAGAAAAGGAGGCAACCTGG + Intronic
1141401317 16:83749570-83749592 ATTTGATAGAACAGGGAACCAGG + Intronic
1141485728 16:84339036-84339058 ATGGAACAGAATAGAGAACCCGG + Intergenic
1142559167 17:799818-799840 TTTGAAAAGAAAAGGGGGCCGGG + Exonic
1144260504 17:13515029-13515051 ATGGAAATGAAGAGGGAAAGGGG + Intronic
1144399322 17:14880218-14880240 ATGGAACAGAATAGAGAACCCGG - Intergenic
1144424597 17:15130036-15130058 GTTGTAAACATGAGGGAACCCGG - Intergenic
1145827283 17:27886591-27886613 ATTGAGGAGAAGGAGGAACCTGG - Intronic
1147125741 17:38366983-38367005 CAAGAAAAGAAGAGGGAACTGGG - Intronic
1147752697 17:42745939-42745961 CTTAAAAAGAAGAGGGAGGCCGG - Intergenic
1147763806 17:42819138-42819160 GTGGAAAAGAAGGGAGAACCAGG + Intronic
1149099564 17:52887541-52887563 ATTGAAAACAAGAAGGAGGCTGG + Intronic
1149610107 17:57953769-57953791 CTTGAATAGAAGAGAGACCCTGG - Intronic
1151261503 17:72919509-72919531 ATTGAAAACCCAAGGGAACCGGG + Intronic
1152383299 17:79953491-79953513 ATTGTAAAGAAGAGGCAACTGGG + Intronic
1153094750 18:1388101-1388123 ATGGAACAGAATAGAGAACCAGG + Intergenic
1153603409 18:6805778-6805800 ATTAAAAAGAAAAGGTAGCCAGG - Intronic
1154018680 18:10643645-10643667 CATGAAAAGAAAAGGGAACAGGG + Intergenic
1154029025 18:10734287-10734309 TTTTAAAAGCAGAAGGAACCTGG + Intronic
1154185548 18:12179777-12179799 CATGAAAAGAAAAGGGAACAGGG - Intergenic
1155356416 18:24958021-24958043 ATTGGGAAGGAGAGGGAACTTGG + Intergenic
1155764778 18:29614754-29614776 ATGAAACAGAATAGGGAACCTGG + Intergenic
1156708335 18:39911500-39911522 AATGAAAAGTAGAGGAAAGCTGG + Intergenic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1158648964 18:59269690-59269712 ATGGAAAAGAAAAGAGAACGCGG - Intronic
1160111871 18:76040326-76040348 CTTGAAAAGAAGAAGAAATCAGG + Intergenic
1162849659 19:13421137-13421159 GTAGAAAAGAAGAGGGCAACAGG + Intronic
1165535847 19:36443808-36443830 ATGGAACAGAATAGAGAACCTGG - Intergenic
1166027195 19:40097730-40097752 ATTGAAAAAAACAGAGAACAAGG + Intergenic
1166758827 19:45212134-45212156 ATTGACCAGACGAGGGACCCTGG + Intronic
1167607676 19:50490082-50490104 ACTGAAAACAAGTAGGAACCTGG + Exonic
1167764279 19:51469803-51469825 AGTGAAAAGAAGAAGGGTCCTGG + Intergenic
1168070413 19:53947204-53947226 ATTGATAAACAGATGGAACCAGG - Intergenic
1202698029 1_KI270712v1_random:139642-139664 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
925446686 2:3932167-3932189 ATTGCAAAAAATATGGAACCAGG - Intergenic
925776893 2:7344473-7344495 GGTGCAAAGAAGAGGGACCCGGG + Intergenic
925777569 2:7349791-7349813 GGTGAAAAGAAGAGGGACCCGGG - Intergenic
926479109 2:13366403-13366425 ATGGAACAGAACAGAGAACCTGG + Intergenic
927014979 2:18950285-18950307 ACAGAAGAGAAGAGGGAAACGGG + Intergenic
927808684 2:26170068-26170090 ATAGAAAATAAAAGGGGACCCGG + Intergenic
928605594 2:32942830-32942852 AGTGTAAAGATGAGGGAAACTGG + Intergenic
928814085 2:35268726-35268748 ATGGAACAGAAGAGAGAACCTGG - Intergenic
930182199 2:48371436-48371458 ATGGAACAGAATAGAGAACCTGG - Intronic
931033069 2:58205721-58205743 ACAGAAAAGAAGAGAGAACAAGG + Intronic
931707443 2:64958821-64958843 GTTGAAATGAAGAGAGAACCAGG + Intergenic
931798502 2:65735437-65735459 ATGGAACAGAATAGAGAACCTGG - Intergenic
932926053 2:75976170-75976192 ATGGAACAGAATAGAGAACCAGG - Intergenic
933162558 2:79041896-79041918 CTGGAAAACAAGAAGGAACCAGG - Intergenic
933234614 2:79851047-79851069 GTTGAAAAGATGAGGTAAGCAGG - Intronic
933524731 2:83421549-83421571 ATGGAACAGAATAGAGAACCCGG + Intergenic
933627281 2:84615362-84615384 ATGGAACAGAATAGAGAACCTGG - Intronic
933633600 2:84682940-84682962 AATGAAAGGGAGAGGGAGCCCGG - Intronic
933966510 2:87433957-87433979 ATAGAAAAGATGAAGGAGCCGGG - Intergenic
934279283 2:91597422-91597444 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
934693009 2:96376370-96376392 ATCCAAAGGAAGAGGGAACCAGG + Intergenic
936327285 2:111516527-111516549 ATAGAAAAGATGAAGGAGCCGGG + Intergenic
937699166 2:124844340-124844362 ATGGAACAGAATAGAGAACCTGG - Intronic
938955349 2:136292634-136292656 ATTGAACAGAAGAATGAAACTGG + Intergenic
939416968 2:141912504-141912526 AGTGAAAAGAAGATGGAGCTAGG + Intronic
940946386 2:159622990-159623012 AATGAAAGGAAGAGAGAAACAGG + Intergenic
941072470 2:160969963-160969985 AAAAAAAAGAAGAGGAAACCAGG + Intergenic
941304473 2:163845447-163845469 ATGGAAAAGAATGGAGAACCTGG + Intergenic
941318947 2:164030852-164030874 ATTGGAGGGAAGAGGGAACTGGG + Intergenic
941356883 2:164504676-164504698 ATTGAAATGAACAGGAAACATGG + Intronic
941680942 2:168398472-168398494 ATGGAACAGAATAGAGAACCTGG - Intergenic
941925259 2:170887947-170887969 ATTGTAAAGATGAGGGGACTGGG + Intergenic
942114842 2:172718071-172718093 ATGGAAAAGTAGAAGAAACCAGG + Intergenic
942321121 2:174736758-174736780 CTGGAAAAGAAAAGGGCACCTGG + Intergenic
943742922 2:191430409-191430431 ACTTAAAGGAAGAGGGAAACAGG - Intergenic
944073217 2:195696114-195696136 ATGGAATAGAAGAGAGAGCCTGG - Intronic
944896505 2:204170891-204170913 ATTGAAAAGAGGTCTGAACCAGG + Intergenic
945180166 2:207083564-207083586 ATTGAGGAGAAGAGAGAACTGGG + Intronic
945378135 2:209104032-209104054 ATGGAACAGAATAGAGAACCCGG + Intergenic
945416256 2:209576591-209576613 ATGGAAAAAAAGTGGGAAACAGG - Intronic
946777874 2:223162574-223162596 ATTTAAAAGAAAAGGAAAACGGG + Intronic
947018582 2:225648716-225648738 ATTGAGAAGAAGCTGGAACTTGG + Intronic
947468477 2:230376877-230376899 ATGGAATAGAATAGGGAACCCGG + Intronic
948173016 2:235921001-235921023 AACTAAAAGAAGATGGAACCTGG - Intronic
948767663 2:240231827-240231849 TTTGAAAAAAAAAGGGAAGCAGG + Intergenic
1168920809 20:1534226-1534248 ATGAAACAGAAGAGAGAACCTGG + Intergenic
1170209284 20:13831910-13831932 ACTTAAAAGAAAAGGGATCCTGG - Intergenic
1170868100 20:20178179-20178201 AAACAAAAGGAGAGGGAACCTGG - Intronic
1172761068 20:37322502-37322524 ATTGAAAAGAACAAAGAGCCTGG - Intergenic
1173280653 20:41624169-41624191 ATTGACAGCAAGAGGGAACAAGG - Intergenic
1173834264 20:46114821-46114843 ATTCAAAAGAGTAGGGAGCCAGG - Intergenic
1173991906 20:47310084-47310106 ATTAAAAAGAAAAAGAAACCTGG - Exonic
1174853737 20:54022651-54022673 ATTGAACAGAGGAGAGAACTTGG - Intronic
1174854900 20:54034947-54034969 ATGGAACAGAATAGAGAACCCGG + Intronic
1175038087 20:56019545-56019567 TTGGAAAAGAAGAGGGTCCCTGG - Intergenic
1175122016 20:56723101-56723123 CTTAAAAAGAAGAGGGCTCCAGG - Intergenic
1177109404 21:17006532-17006554 ATAGAAAAGAAGAGAGAACCAGG + Intergenic
1177700493 21:24633056-24633078 ATTGGGAAGAAAAGGGATCCTGG - Intergenic
1178228178 21:30749016-30749038 TTGAAAAAGAAGAGAGAACCCGG + Intergenic
1179080296 21:38164606-38164628 AATAAAGAGAAGAGGAAACCTGG + Intronic
1181181781 22:21073598-21073620 CTTGAAAAAAAGATGCAACCAGG + Intergenic
1181358712 22:22318666-22318688 ATGGAGAAGAAGAGGAGACCTGG + Intergenic
1183000530 22:34855081-34855103 ATTGTATAGATGAGGAAACCTGG - Intergenic
1184031842 22:41899829-41899851 CCTGAAAAGCAGAGGGACCCAGG - Intronic
1184538621 22:45104816-45104838 ATTGAATATAACAGGAAACCAGG + Intergenic
1185201472 22:49508331-49508353 ATTGAACAGAAGAGGGGGACCGG + Intronic
949119351 3:366911-366933 ATTGAAAAGTAGAAGGAAAATGG - Intronic
949345198 3:3070154-3070176 AGTGAAAAGAACAGGGATGCTGG - Exonic
949634586 3:5968877-5968899 ATTGAAAAGATGAAGCACCCTGG + Intergenic
950292531 3:11797309-11797331 ATGGAACAGAACAGAGAACCCGG + Intronic
950782037 3:15400292-15400314 ATGGAAAGGAATAGGGGACCTGG - Intronic
951060769 3:18204470-18204492 AATGAAAAGGAGTGGGAAACAGG - Intronic
951185539 3:19708252-19708274 TTTGATAAGAAGTGGGAAGCAGG + Intergenic
951390099 3:22092079-22092101 ATTGAATAGAAGAGTGAATATGG + Intronic
951569234 3:24044612-24044634 ACTGAAAAGAAGAGGGTAAACGG - Intergenic
951643705 3:24864303-24864325 AAGGAAAAGAACAAGGAACCAGG - Intergenic
951959890 3:28306014-28306036 ATGGAACAGAACAGAGAACCTGG - Intronic
953670105 3:44955279-44955301 CTTGAAAAGAAAAGGGAAGTGGG - Intronic
953979682 3:47407387-47407409 CTTCACAAAAAGAGGGAACCAGG - Intronic
954018361 3:47716113-47716135 GTTCAAAAGAATATGGAACCTGG + Intronic
954456896 3:50604568-50604590 CAAGAAAAGAAGATGGAACCTGG + Intergenic
955108957 3:55928937-55928959 ATAGAACAGAATAGAGAACCTGG - Intronic
955212571 3:56955501-56955523 CTTGCAAAGAAAAGGGATCCAGG - Intronic
955328032 3:58024605-58024627 TTTTAGAAGAAGAGGCAACCTGG + Intronic
955658779 3:61274204-61274226 ATGGAACAGAATAGAGAACCCGG - Intergenic
956508489 3:69968778-69968800 ATTAAAAAAAAAAGGCAACCAGG - Intergenic
957724037 3:84041746-84041768 ATTGTAAAGAACAGGAAACTAGG + Intergenic
958137578 3:89515771-89515793 ATTGCAAAGAAGGGGGATTCTGG - Intergenic
958501197 3:94911220-94911242 ATTGAAAAGAAGATGTAGACAGG + Intergenic
959036304 3:101368976-101368998 ATTGAAAAGAAGAAATAAACTGG - Intronic
959374810 3:105575847-105575869 ATTGAAAGGAAAAGGAAAACTGG + Exonic
960165896 3:114400852-114400874 ATTGAAAGGCAGAGGGTATCAGG + Intronic
960195861 3:114767493-114767515 ATTGAAAAGAAAAAGGAAGAAGG + Intronic
960392896 3:117101042-117101064 AGTGCAAAGAAGAAAGAACCAGG + Intronic
960561975 3:119094583-119094605 ATTGAAAAGAATAGGAAAAAAGG + Intronic
960938371 3:122917309-122917331 ACTGCAAAGAAGATGGAGCCTGG + Intronic
961954232 3:130784422-130784444 AGTGAAAAGAAGTGATAACCTGG - Intergenic
962125895 3:132617398-132617420 ATTGAAAAGATGAAGGAAGGAGG - Intronic
962635924 3:137331388-137331410 ATGGAAAAGAAGAGTGAGCCAGG - Intergenic
962821218 3:139048982-139049004 ATGGAACAGAATAGAGAACCTGG - Intronic
962904196 3:139787250-139787272 ATAGAAGAGAAGAGAGAGCCAGG - Intergenic
963504073 3:146162465-146162487 TTTTAAAAGAAGAGGAAAACTGG + Intronic
964166293 3:153709837-153709859 ATGGAACAGAATAGAGAACCTGG + Intergenic
965046303 3:163582865-163582887 ATTGAAAAAAATAGAGAACCTGG + Intergenic
965111520 3:164430329-164430351 ATAGAAAGGAATAGAGAACCCGG - Intergenic
965132142 3:164714810-164714832 ATTGACAGGAAGGTGGAACCAGG + Intergenic
965845275 3:172953805-172953827 CTTGAAAAGGAGAAGGAAGCTGG + Intronic
966101192 3:176270408-176270430 ATTGAAAACAAGAGGGGACGGGG - Intergenic
966304827 3:178519724-178519746 ATTAAAAAGAATAGGAATCCTGG - Intronic
966502082 3:180654083-180654105 ATGGAACAGAATAGAGAACCCGG + Intronic
967345518 3:188451209-188451231 ATGGAAAAGAAGCAGAAACCAGG - Intronic
967597833 3:191348630-191348652 ATTGGAAAGAACAGGGAATTTGG + Intronic
968259936 3:197312838-197312860 ATGGAACAGAATAGAGAACCTGG - Intergenic
968423445 4:504671-504693 AATGAAAATAAACGGGAACCTGG - Intronic
968743530 4:2344124-2344146 ATGGAACAGGAGAGGGAACTCGG + Intronic
968824519 4:2884735-2884757 ATTTAGGAGAAGAGGGAAGCAGG + Intronic
969031472 4:4218471-4218493 ATGGAAAAGGAGAGGGAAGAAGG + Intronic
969330553 4:6471698-6471720 CTGGAGAAGAAGAGGGACCCGGG - Intronic
970345773 4:15150671-15150693 ATGGTCAAGAAGAGTGAACCTGG - Intergenic
970600451 4:17637519-17637541 ATTTTAAAGGAGAGGGAACTGGG - Intronic
970631846 4:17955365-17955387 ATTGAAAAGAGAAGGGAAGGTGG + Intronic
970767127 4:19563216-19563238 ATTTTACAGAAGAGGGAACTGGG - Intergenic
971807530 4:31378982-31379004 ATTATTAATAAGAGGGAACCAGG + Intergenic
972109079 4:35532587-35532609 ATAGAAAATAATAGGGAGCCTGG + Intergenic
972265157 4:37453076-37453098 GTTGAAAAGAAGAGAGAAGAGGG + Intergenic
972875074 4:43349171-43349193 ATTGCAAAAATGAGGGAAACAGG + Intergenic
973659657 4:53090369-53090391 ATGGAAAAGGAAAGGTAACCAGG + Intronic
973946701 4:55963826-55963848 ATTAAAAAGAATAGGAAACTGGG - Intronic
974316728 4:60291983-60292005 ATAGAAAATAAGAGGGAAACAGG + Intergenic
974794684 4:66732898-66732920 AATGGAAAGAAGAGGGTGCCAGG - Intergenic
975948760 4:79742426-79742448 ATTGAAGAGAGGAGGGAAGTGGG + Intergenic
976426733 4:84912787-84912809 ATAGAAAAGAAGTGAGCACCAGG + Intronic
976678626 4:87730710-87730732 ATTGAAAAGAGGAGGAAATGAGG + Intergenic
978552068 4:109938579-109938601 TTGGAAAAGAAGAGGCAATCTGG + Intronic
979144650 4:117228409-117228431 ATTTAAAAGAAGAGATCACCTGG - Intergenic
979168182 4:117563346-117563368 ACTGAAAATAAGAGGGAAATAGG + Intergenic
979625451 4:122840026-122840048 CTTTATAAGAAGAGGAAACCTGG - Intronic
979677589 4:123427033-123427055 AGTGAACAGAATAGAGAACCCGG - Intergenic
979744135 4:124188748-124188770 ATTGAAAGGAAAATGGAAACAGG - Intergenic
980517651 4:133885481-133885503 ATTGGAAAGATCAGGGAAGCAGG - Intergenic
980773610 4:137411151-137411173 ATTGAGAAGCAGAGAGAACTTGG - Intergenic
981147763 4:141345268-141345290 ATTTAAAAGAATAGTGAAACTGG + Intergenic
981301231 4:143187792-143187814 ATTAAAAAGAAAAGGGAACATGG - Intronic
981500568 4:145447112-145447134 AGAGAAAAGAGGAGGGAAGCGGG + Intergenic
981626618 4:146763822-146763844 ATTGAAAAGAAGAGGCTTTCTGG - Intronic
982017613 4:151170830-151170852 ATAGGAGAGAACAGGGAACCTGG - Intronic
984513239 4:180705030-180705052 ATAGAAAAGATGAAGAAACCAGG + Intergenic
985105788 4:186498798-186498820 AATGAAAAGCAGAGGCAGCCAGG + Intronic
985179466 4:187240917-187240939 ATAGAAAAGGAGAGAGAAGCTGG + Intergenic
985471307 5:48595-48617 AATGAAAACACAAGGGAACCTGG + Intergenic
985483316 5:132721-132743 ATGGAACAGAATAGAGAACCCGG - Intergenic
985884960 5:2670618-2670640 ATTGAAAAGAAAAGGAACACTGG + Intergenic
986630766 5:9770238-9770260 ATTAAACAGAATAGAGAACCTGG - Intergenic
986647202 5:9929168-9929190 ATTTAAAAGAAAACAGAACCTGG - Intergenic
986898433 5:12400369-12400391 CTTGTAAAGAAGAGGAAATCAGG + Intergenic
987372727 5:17207865-17207887 AGAGAAAGGAAGAGGCAACCTGG - Intronic
987500353 5:18700936-18700958 ACTGACAAGAAAAGGGAAGCTGG - Intergenic
987776315 5:22372305-22372327 AAAGCAAAGGAGAGGGAACCAGG + Intronic
988054817 5:26081037-26081059 ATGGAAAAAAAGAGGGAAACAGG + Intergenic
988600714 5:32637382-32637404 ATTGAAAAAAAGAAGGAACAAGG - Intergenic
988920931 5:35941757-35941779 ATTAAAAAGAAGAGTAAGCCTGG + Intergenic
990017822 5:51087346-51087368 ATGGAACAGAAGAAAGAACCTGG - Intergenic
990464177 5:56056612-56056634 AAAGAAGAGATGAGGGAACCGGG + Intergenic
990775744 5:59303718-59303740 ATGGAACAGAATAGAGAACCCGG - Intronic
991017763 5:61949727-61949749 ATTCAAAAGAAGTGGGAAAAAGG + Intergenic
991191209 5:63876128-63876150 ATAGAAAAGAAGAGTGAATCAGG - Intergenic
992467418 5:77020697-77020719 AGTGGAAAGAAGAGGGTAACTGG - Intergenic
992569318 5:78038600-78038622 ATTGAAAAGTGAAGGGAAACAGG + Intronic
993315661 5:86402967-86402989 TTTGAAAAGAAAGAGGAACCTGG - Intergenic
993625178 5:90215318-90215340 ATTGCAAATGACAGGGAACCTGG - Intergenic
994232636 5:97325368-97325390 ATTGAAAACAAGTGGGGACAGGG + Intergenic
995174268 5:109156602-109156624 ACTGAAAAGAAAAGAGCACCTGG + Intronic
995300398 5:110574286-110574308 ATGGAATATAAGAGGGAAGCAGG + Intronic
995336200 5:111002396-111002418 ATAGGAAAGAAGAGGGTATCAGG - Intergenic
995452123 5:112313654-112313676 CTTGAAAAGAAAAGGCAACCAGG + Intronic
995752549 5:115469481-115469503 CTTAAAAACAAGAGGCAACCAGG - Intergenic
996128914 5:119757409-119757431 ATGGAAAAGTAGAGTGAGCCAGG + Intergenic
997637639 5:135426094-135426116 ATTGCAAAGGAGATGGAAGCTGG + Intergenic
997925602 5:138028491-138028513 ACTGAAAAAAAAAGGGAAGCTGG + Intronic
998203464 5:140143469-140143491 ACTGCAAAGAAAAGGAAACCTGG + Intergenic
1000630812 5:163588296-163588318 AATGAAAATAACAGGAAACCAGG - Intergenic
1001285479 5:170420082-170420104 ATTGAAAAGAAAAAGGAACCAGG + Intronic
1002062622 5:176635100-176635122 AGTGAAAAGAAGAGAGTGCCCGG + Intronic
1003248873 6:4406721-4406743 ATTTAAGAGAAGAGGCACCCTGG - Intergenic
1004707381 6:18136983-18137005 AGTGAGAAAAAGAGGGAAACAGG + Intronic
1005159398 6:22841617-22841639 AATGAACAGAATAGAGAACCCGG + Intergenic
1006321060 6:33319788-33319810 AATGAAAAGAACCTGGAACCTGG - Exonic
1007154410 6:39728532-39728554 ATTGAGAAGAAGAGAGAACCAGG + Intergenic
1007352637 6:41284967-41284989 AGTGAACAAATGAGGGAACCAGG - Intronic
1007521510 6:42453914-42453936 CCTGAAAAGAGGAGGGGACCCGG + Intergenic
1008678304 6:53844901-53844923 ATTAAAAGAAAGAGTGAACCTGG + Intronic
1008927541 6:56902778-56902800 ATTAAGGAGAAGAGGGAACTGGG + Intronic
1009285374 6:61809743-61809765 ATTGAAAAGAAGAGGTTGTCAGG - Intronic
1010060064 6:71612402-71612424 ATTAAAAAGAAGAAAGAAACAGG - Intergenic
1010062961 6:71646100-71646122 AATGAAAAGAAAGGGGAAACTGG + Intergenic
1010389884 6:75324750-75324772 ATGGAACAGAATAGAGAACCTGG + Intronic
1011122972 6:83974750-83974772 ACTGATAAGAAGAGCGACCCTGG - Intergenic
1012527099 6:100191065-100191087 ATTGGAAAAAAGATGGAACAGGG + Intergenic
1013580652 6:111531004-111531026 ACTGAACAGAAGAGGGCAGCGGG - Intergenic
1013620103 6:111879715-111879737 AAAAAAAAAAAGAGGGAACCAGG + Intergenic
1013688530 6:112613132-112613154 ATTCAAAAGCAGAGAGAACTCGG - Intergenic
1014177741 6:118348838-118348860 GTTGGAAATAAGAGGGAACATGG + Intergenic
1014840418 6:126213098-126213120 ATGGAACAGAATAGAGAACCTGG - Intergenic
1015019248 6:128452289-128452311 AGTGAAAAGAAGAGAGGACTCGG - Intronic
1016180680 6:141144137-141144159 ATGGAACAGAATAGAGAACCCGG - Intergenic
1016197061 6:141357139-141357161 ATGGAACAGAATAGAGAACCCGG - Intergenic
1016651733 6:146469648-146469670 ATGGAAAAGAACAGAAAACCTGG - Intergenic
1016760683 6:147733260-147733282 ATTGGAAAAAAGAAGAAACCTGG - Intronic
1017375536 6:153763393-153763415 ATGGAACAGAATAGAGAACCTGG + Intergenic
1017396598 6:154007547-154007569 ATGGAACAGAATAGAGAACCTGG + Intergenic
1017594789 6:156016868-156016890 ATTGAAAGGTATAGGGACCCTGG + Intergenic
1019999800 7:4749282-4749304 ACAGAAGAGAAGAGGGACCCAGG - Intronic
1021190124 7:17610610-17610632 ACTTAAAAGAAGAGGGAATTTGG + Intergenic
1021355664 7:19651059-19651081 AGTGAAGAGAAGTGGGAACGGGG - Intergenic
1022124162 7:27339699-27339721 AGTGAAAAAAAAAGGGAACTAGG + Intergenic
1023019924 7:36002453-36002475 ACAGAAAATACGAGGGAACCAGG - Intergenic
1024104842 7:46072467-46072489 ATTGGAAAGATGAAGGAAGCTGG - Intergenic
1024567713 7:50695978-50696000 AGTGAAAAAAACAGGGAAACAGG - Intronic
1026615699 7:71901582-71901604 ATGGAACAGAATAGAGAACCTGG + Intronic
1026814151 7:73496247-73496269 ATCAAAAAGAAGAGGGAAACTGG + Intronic
1026951535 7:74350567-74350589 ATTAAAAAAAAGAGTGAGCCAGG + Intronic
1028036809 7:85994299-85994321 ATGGAACAGAATAGAGAACCTGG - Intergenic
1028644384 7:93078680-93078702 ATTGGAAAGAAGAAAGAAGCAGG + Intergenic
1029008168 7:97231736-97231758 ATTGAAAAGAATGGTGAAGCTGG + Intergenic
1029359189 7:100075875-100075897 ACTGGAGAGAAGAGGGGACCTGG - Intronic
1030089360 7:105843681-105843703 ATTGAAAAGAAGAGGGAACCTGG - Intronic
1031246122 7:119313976-119313998 CTTTAAATGAAGAGGGAACATGG + Intergenic
1031792721 7:126129932-126129954 ATGGAACAGAATAGAGAACCCGG + Intergenic
1032280981 7:130501047-130501069 ATAGAAAATAAGAGTGAAACTGG + Intronic
1033427871 7:141261746-141261768 AGTGAAAAGAAGTGGGAGACAGG + Intronic
1033629540 7:143142873-143142895 AATAAAAAGAAAAGGGAAACAGG + Intergenic
1038062895 8:23931794-23931816 CCTAAAAAGAAGAGGGAACTGGG - Intergenic
1038169122 8:25112833-25112855 CTTGAAATGAGGAGGGAAACAGG - Intergenic
1039444931 8:37623399-37623421 AATAAAAAGAAGAGGTAGCCAGG + Intergenic
1041023661 8:53661904-53661926 ATTAAAGAAAAGAGGTAACCTGG + Intergenic
1041524838 8:58793665-58793687 ATGGAACAGAATAGAGAACCCGG + Intergenic
1041791388 8:61699892-61699914 GTTGAACAGCAGAGGGAACTGGG + Intronic
1041935689 8:63329290-63329312 ATTTAAAAGGTGATGGAACCAGG - Intergenic
1042188496 8:66161354-66161376 ATGGAACAGAATAGAGAACCCGG - Intronic
1042254039 8:66785162-66785184 GTTGAAGAGAAGAGAGCACCAGG - Intronic
1042358029 8:67850815-67850837 ATGGAATAGAATAGAGAACCTGG - Intergenic
1042953204 8:74221913-74221935 ATTGGAAGAAAGAGGGAAACGGG - Intergenic
1043379768 8:79690003-79690025 AAAAAAAAGAAGAGGAAACCAGG + Intergenic
1043571323 8:81606137-81606159 TTTGAAGTGAAGAGTGAACCTGG - Intergenic
1044192611 8:89336931-89336953 ATGGAACAGAATAGAGAACCTGG - Intergenic
1044224291 8:89701987-89702009 ATGGAAAAGAAGAGGGAATTGGG - Intergenic
1044424080 8:92031175-92031197 ATTGAAAAGATAAGGCATCCTGG - Intronic
1044498359 8:92919051-92919073 ATAGAATAGAACAGAGAACCCGG - Intronic
1045011094 8:97958948-97958970 AGTAAACAGAAGAGGGAAGCAGG - Intronic
1045065547 8:98440526-98440548 ATTGAATAGAAAACTGAACCAGG - Intronic
1045251407 8:100486100-100486122 TAGGAAAAGAAAAGGGAACCCGG + Intergenic
1045769136 8:105713787-105713809 ATGGAACAGAATAGAGAACCTGG - Intronic
1046255763 8:111694488-111694510 AATGAAAAGAAGTGGGAATTGGG + Intergenic
1046877289 8:119269625-119269647 ATGGAAAAGAAAACGGAAGCAGG - Intergenic
1046885217 8:119359597-119359619 ATGGAAAAGAAGAGGGAAAATGG - Intergenic
1047431702 8:124798713-124798735 CTTCCAGAGAAGAGGGAACCTGG - Intergenic
1047773904 8:128053117-128053139 ATAGTAAAGAGGAGGGGACCTGG + Intergenic
1048531959 8:135257729-135257751 ACTGAAAATAATAGGGATCCTGG + Intergenic
1048662547 8:136621702-136621724 ATTGCAAAGAAGTCGGAACCAGG - Intergenic
1049963562 9:758565-758587 ATTAAAAAGAAGAGTGAAGTAGG - Intergenic
1050065578 9:1756081-1756103 GTTGAAAAGAAGAGTGCACTGGG - Intergenic
1050285196 9:4094157-4094179 ATGGAAGAGAAGAGGAAAGCAGG + Intronic
1051277493 9:15411072-15411094 ATGGAACAGAATAGAGAACCTGG - Intergenic
1055933172 9:81580698-81580720 AATGAAATGAAGAGGGAATTTGG + Intergenic
1057020510 9:91693711-91693733 ATTGGAGAGTTGAGGGAACCAGG + Intronic
1057454497 9:95195444-95195466 ATGGAACAGAACAGAGAACCTGG - Intronic
1057516124 9:95722989-95723011 AATGGTAAGAAGAGGGGACCGGG - Intergenic
1057540812 9:95967811-95967833 ATTGATATGAAAAGGGAAACTGG - Exonic
1057698260 9:97342680-97342702 ATTGAGAAGGAGAGAGAACCAGG - Intronic
1057737869 9:97682264-97682286 GTTGAAAAGAAATTGGAACCTGG - Intronic
1058328205 9:103725116-103725138 ACTGAAAAGAAGAGAGAAGGTGG + Intergenic
1058845779 9:108957819-108957841 ATTAAACAGAAGTAGGAACCCGG + Intronic
1059181681 9:112220268-112220290 ACTGAAAAGAACAGAGAGCCAGG + Exonic
1059223621 9:112650619-112650641 ATGGAAAAGAAGAGGAAAAAAGG + Intronic
1059633700 9:116153041-116153063 AGGGAAAAGAAGAGGGAAAGAGG + Intergenic
1059932612 9:119275984-119276006 AGTGAAAAGAACAGAGAAACTGG - Intronic
1060110733 9:120904693-120904715 AATGAGAAGAAAATGGAACCAGG - Exonic
1060320004 9:122549690-122549712 AATGGAAAGAATAGAGAACCTGG - Intergenic
1060423737 9:123487730-123487752 ATTGAAAAAAAGAGGGGGGCTGG + Intronic
1061531603 9:131218497-131218519 TTTGAAAGGCAGAAGGAACCAGG - Intronic
1061554047 9:131355595-131355617 ATTAAAAAGTAGAGTCAACCTGG - Intergenic
1062133150 9:134911074-134911096 CTTGGAAAGCAGAGAGAACCTGG - Intronic
1185598781 X:1325005-1325027 CTTTAAAAGAAGAGAGAACCTGG - Intergenic
1185686940 X:1937141-1937163 ATTTTATAGAAGAGGGAACTAGG + Intergenic
1186042042 X:5491274-5491296 TTGGAAAAGAAAAGGGACCCTGG - Intergenic
1186068045 X:5787779-5787801 AAAGAAAAGAAAAGGGAAACAGG + Intergenic
1186097684 X:6119671-6119693 ATTGAAAAGATTTGGGAACATGG - Intronic
1186192161 X:7076591-7076613 TTTAACAAGAAGAGGGAGCCAGG + Intronic
1186907681 X:14129198-14129220 ATGGAACAGAACAGAGAACCTGG - Intergenic
1187405356 X:18999145-18999167 ATTAAAAAGAAGAAGCAACTGGG - Exonic
1187473261 X:19588178-19588200 AGTGAAGAGCAGAGGGAGCCTGG + Intronic
1187913132 X:24128962-24128984 ATTGAAAAAAAGAATCAACCTGG + Intergenic
1187985996 X:24811580-24811602 ATTAAAAACAAGAGGGGGCCAGG - Intronic
1188233760 X:27700034-27700056 AAAGAAAAGAAAAGGGAACATGG + Intronic
1188376089 X:29429600-29429622 AATGAAAAGCAAAGGGAGCCAGG + Intronic
1188398353 X:29714295-29714317 ATTGAATAGAAGAGGAAGACAGG - Intronic
1188581874 X:31723759-31723781 TTTGAAAAGCAGAAGGAAGCTGG - Intronic
1189686668 X:43571537-43571559 AATGAAAAGGAGAGGGATGCTGG - Intergenic
1190600232 X:52084546-52084568 ATGGAACAGAATAGGGAACCCGG - Intergenic
1192724528 X:73734263-73734285 AATGAACAGAATAGAGAACCTGG - Intergenic
1192746377 X:73943077-73943099 ATCTAAAAGAAGAGGGAGGCTGG + Intergenic
1193690902 X:84641336-84641358 ATGGAACAGAATAGAGAACCCGG + Intergenic
1193779951 X:85689131-85689153 ATGGAACAGAATAGGGAACCTGG + Intergenic
1193988165 X:88272927-88272949 ACTGATAAGAAGAGGGAATGTGG - Intergenic
1194379571 X:93176783-93176805 CCTGAAAAGAAAAGGGGACCTGG - Intergenic
1194412081 X:93569701-93569723 ATGGAATAGAATAGAGAACCCGG - Intergenic
1194692436 X:97004116-97004138 ATGGAACAGAATAGAGAACCTGG - Intronic
1195695920 X:107667362-107667384 GTAGAGAAGAAGAGGGAATCTGG - Intergenic
1196589861 X:117473677-117473699 ATTGATATGAAGAGAGAGCCAGG - Intergenic
1196701003 X:118668772-118668794 ATTGATAAGGAGAAGGATCCTGG + Intronic
1197082077 X:122430548-122430570 ATGGAACAGAATAGAGAACCAGG - Intergenic
1197096538 X:122603595-122603617 ATCAAAAAGAAAAGGGAATCAGG + Intergenic
1198481612 X:137046490-137046512 ATTAAAAAGGAGAGGGAATGAGG + Intergenic
1198608360 X:138369533-138369555 ACTGAAAGGAAGAGCGAACAAGG + Intergenic
1199327479 X:146515872-146515894 GTGGAAAAGAACAGAGAACCTGG - Intergenic
1200333973 X:155328787-155328809 GTGGAAAAGAATAGAGAACCTGG + Intronic
1201461332 Y:14228466-14228488 ATTAGAAAGAACAGGTAACCAGG + Intergenic
1202183527 Y:22159414-22159436 ATAGAAAAGAGGATAGAACCTGG - Intergenic
1202207832 Y:22426987-22427009 ATAGAAAAGAGGATAGAACCTGG + Intergenic