ID: 1030096659

View in Genome Browser
Species Human (GRCh38)
Location 7:105906639-105906661
Sequence GGCCATTGGTCATGGTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030096653_1030096659 -7 Left 1030096653 7:105906623-105906645 CCTCATTTTACCCCAGGGCCATT 0: 1
1: 0
2: 2
3: 12
4: 191
Right 1030096659 7:105906639-105906661 GGCCATTGGTCATGGTGTCCTGG 0: 1
1: 0
2: 0
3: 10
4: 122
1030096650_1030096659 4 Left 1030096650 7:105906612-105906634 CCTGTGCTCTTCCTCATTTTACC 0: 1
1: 0
2: 1
3: 25
4: 276
Right 1030096659 7:105906639-105906661 GGCCATTGGTCATGGTGTCCTGG 0: 1
1: 0
2: 0
3: 10
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030096659 Original CRISPR GGCCATTGGTCATGGTGTCC TGG Intronic
900118456 1:1038587-1038609 TGCCCTTGGCCATGGTGTCAGGG + Intronic
901231292 1:7642872-7642894 GCCCCTTGGACATGGTGTGCAGG - Intronic
901465128 1:9416607-9416629 GGGCAGGGGGCATGGTGTCCTGG + Intergenic
902035628 1:13456096-13456118 GTCCATTTTTCAAGGTGTCCTGG - Intergenic
902668074 1:17953275-17953297 GGGCATTGGTCAGGGTCTCTGGG + Intergenic
903141953 1:21344530-21344552 GGCCTTTGCTCTTGGGGTCCAGG + Intronic
903777944 1:25805236-25805258 TGCTCTTGGTCATGGTCTCCGGG - Exonic
915495938 1:156282668-156282690 GGCCTTGGCTCATGGTGCCCGGG + Exonic
919732231 1:200920679-200920701 GGCCACTGGACAGGGTGTCTAGG + Intergenic
922681696 1:227603592-227603614 CGCCATTGCTCATGGGCTCCAGG + Intronic
922779618 1:228241065-228241087 GTCCCTTGCCCATGGTGTCCTGG - Intronic
924402428 1:243700120-243700142 AGCCATTGGTCATAGTGTTTAGG - Intronic
1062866960 10:863854-863876 TGCCAATGGTGATGGTGACCAGG - Exonic
1063728274 10:8664943-8664965 GATCATCAGTCATGGTGTCCAGG + Intergenic
1068115045 10:52728015-52728037 AATCATTGGTCATTGTGTCCAGG - Intergenic
1069449181 10:68502536-68502558 GGGCATTTGTCATGTTGCCCAGG - Intronic
1069572036 10:69500120-69500142 GGTCATAGGTCATCTTGTCCAGG + Intronic
1071602283 10:86964230-86964252 GGCCACTGGCCAGCGTGTCCTGG + Intronic
1072629271 10:97134386-97134408 GGCCATTGTTCCTGGTTGCCAGG - Intronic
1074247979 10:111713867-111713889 TGCCACTGTTCATGGTGCCCAGG + Intergenic
1075184970 10:120247786-120247808 GGCTACTGGTCATCCTGTCCAGG + Intergenic
1076516559 10:131048451-131048473 GGCCCTTGGTTCTGCTGTCCTGG - Intergenic
1079184152 11:18221302-18221324 TGCCACTGTTCATGGTGCCCAGG + Intronic
1082767590 11:57181463-57181485 GGCCATTTGTCCTGGTGGCCTGG - Intergenic
1093765000 12:22952706-22952728 TGCCACTGTTCATGGTGTCCAGG + Intergenic
1096519938 12:52179327-52179349 AGCCAGTGGGCATGGTGCCCTGG + Intronic
1098704066 12:73665113-73665135 GGCCATTGGTGAGTGTGTGCTGG - Intergenic
1099227384 12:79985922-79985944 GGCCATTGGCCATCAGGTCCAGG - Intergenic
1102864910 12:116366751-116366773 GGCCAGTGGCCATGCTGTGCTGG + Intergenic
1104964529 12:132502962-132502984 GACCATTGGTGACGGTGTCATGG - Intronic
1105837283 13:24222965-24222987 GGGCAGTGGTCATGTTCTCCAGG - Exonic
1106799713 13:33243636-33243658 GGCCAGGGATAATGGTGTCCCGG + Intronic
1108959924 13:56214191-56214213 GGGCACTGGTCTTGGTCTCCTGG + Intergenic
1108962998 13:56260510-56260532 GGCCCTTGGTAATTGTGTGCAGG + Intergenic
1118200131 14:63663748-63663770 TGCCACTGTTCATGGTGCCCAGG + Intergenic
1120216416 14:81685216-81685238 GGCCAGTGGTCCTGGTTTTCAGG + Intergenic
1120590018 14:86364022-86364044 TGCCACTGTTCATGGTGCCCAGG - Intergenic
1121313659 14:92948693-92948715 GGCCATTTTTCTTGGTGACCAGG - Intronic
1121587277 14:95070871-95070893 GGGCAGTGGTCATAATGTCCGGG + Intergenic
1129099867 15:73251317-73251339 GGCGTTTTGTCATGTTGTCCAGG - Intronic
1129199177 15:73988661-73988683 GGGCCTTGGTCATGGCGTTCTGG + Exonic
1129519176 15:76175364-76175386 AGCCTTCGCTCATGGTGTCCAGG - Intronic
1131143064 15:89993374-89993396 GCACATGGGTCTTGGTGTCCAGG - Intergenic
1131262333 15:90893831-90893853 GGCCTCTGGCCATGGAGTCCAGG - Intronic
1139299935 16:65936247-65936269 GGCCATTGGGAAAGGTTTCCTGG + Intergenic
1141819401 16:86434707-86434729 GGCCAGTGGTCAGGGACTCCTGG - Intergenic
1143611543 17:8020655-8020677 GTCCATGGGTCATGGAGTCATGG - Intergenic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1146063459 17:29618743-29618765 GGCCACTGGTCAAGGGGTTCTGG + Intronic
1148051071 17:44770135-44770157 GGCCACTGGAGATGGGGTCCTGG + Intronic
1148151329 17:45397954-45397976 GGCCATTGCTCAGGGCATCCAGG - Exonic
1151633352 17:75326359-75326381 GGCCTTTGGGCTTGGTGTACGGG + Intronic
1156395529 18:36696220-36696242 AGCCATTTGTCATGGAGTCATGG + Intronic
1158139503 18:54241858-54241880 TGCCATTGTTCATGATGCCCAGG + Intergenic
1158350739 18:56562750-56562772 GGCAATTGGTCCTGGTGATCGGG - Intergenic
1160355755 18:78226999-78227021 GGACATCGGTCATGGGGTTCAGG + Intergenic
1161490258 19:4557440-4557462 GGCCATGGGACATGGTGTTGGGG - Intronic
1163184059 19:15623966-15623988 GGCCACTGGCCGTGGTGTCATGG - Exonic
1163192148 19:15685069-15685091 GGCCACTGGCCGTGGTGTCATGG - Exonic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1164867601 19:31617689-31617711 AGCCATTGGTCATGGGTCCCTGG - Intergenic
925059322 2:878882-878904 AACCTTTAGTCATGGTGTCCTGG - Intergenic
926599898 2:14831004-14831026 GGCCGTGGGCAATGGTGTCCTGG - Intergenic
927613608 2:24566681-24566703 TACCATTGTTCATGGTGCCCAGG + Intronic
932123696 2:69124577-69124599 GGCCATCGTTCATGCTGACCTGG - Exonic
935414056 2:102796662-102796684 GGCCACTTGGCATGGTTTCCAGG - Intronic
936014093 2:108944677-108944699 GGCCCTGGGTCCTGGTGTCTGGG + Intronic
942114383 2:172713405-172713427 TGCCACTGTTCATGGTGCCCAGG + Intergenic
944719640 2:202410174-202410196 GGGATTTGGTCATGTTGTCCAGG + Intronic
947668810 2:231924147-231924169 GGCCATGGGCCAGGGTGTGCTGG + Intronic
1169094761 20:2887423-2887445 GGCCAGTGATGATGGTGTTCTGG + Intronic
1169430676 20:5533275-5533297 GGCCAGTGGTCTTGCTGTGCTGG - Intergenic
1175698624 20:61121469-61121491 GGACAGGGGTCATGCTGTCCTGG - Intergenic
1181175333 22:21031961-21031983 GGCCCCTGGTGAGGGTGTCCAGG - Intronic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
950042936 3:9931922-9931944 GGCCCTTGATCTTGCTGTCCTGG - Intronic
950886483 3:16366935-16366957 GGCTCCTGCTCATGGTGTCCAGG - Intronic
952590881 3:34952605-34952627 GGCCATTTGGCTTAGTGTCCTGG - Intergenic
952670040 3:35955337-35955359 TGCCATTGGTGGTGGTGTTCAGG - Intergenic
954082006 3:48217940-48217962 GGGCCTGGGACATGGTGTCCGGG - Intergenic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
967891852 3:194369449-194369471 GGCTGGTGGTCCTGGTGTCCAGG + Intronic
968838366 4:2981813-2981835 TGCCCTTGTTCATGGTGCCCTGG + Intronic
969135556 4:5025961-5025983 GGTCATGGGACATGGTGTCCTGG - Intergenic
971724043 4:30285058-30285080 GTCCATTCCTCATGCTGTCCAGG - Intergenic
972479670 4:39485580-39485602 GGGAATTGGTCCAGGTGTCCCGG - Intergenic
977797100 4:101179410-101179432 GACCAGTGGTGGTGGTGTCCAGG - Intronic
978301087 4:107270241-107270263 TGCCACTGTTCATGGTGCCCAGG + Intronic
982969516 4:161965727-161965749 GGCCCTTGTTCATGCTGTGCTGG + Intronic
985644146 5:1077209-1077231 GGGCCTAGGGCATGGTGTCCAGG - Intronic
985824997 5:2185227-2185249 GGGGATTGTTCCTGGTGTCCTGG - Intergenic
986098469 5:4583649-4583671 GGCCATTGGTCTTTGAGGCCAGG - Intergenic
986199875 5:5570813-5570835 GGACACTGGTCAGGGTGTCTGGG - Intergenic
987861551 5:23493401-23493423 GGCCATTGGTGGTGGTGGTCAGG + Intergenic
988597167 5:32605892-32605914 GGCCATTGGTGGTGGTGACAAGG + Intergenic
990460637 5:56028125-56028147 GGCTATGAGTTATGGTGTCCAGG + Intergenic
997402456 5:133612881-133612903 GGCCATTGCTCGTGGAGTCCAGG + Intergenic
999262194 5:150245052-150245074 GGGCCTTGCTGATGGTGTCCTGG - Intronic
999430574 5:151521891-151521913 GGCTATAGGTCAGCGTGTCCTGG + Exonic
1001426260 5:171624674-171624696 GGCCATTCCACATGGTGTGCAGG + Intergenic
1002390862 5:178910599-178910621 GGCCCATGGTACTGGTGTCCCGG + Intronic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1008607390 6:53153371-53153393 GGGGATTCGTCATGTTGTCCAGG + Intergenic
1009534331 6:64861120-64861142 TGCCACTGTTCATGGTGTCCAGG + Intronic
1009821661 6:68810351-68810373 GGCCATTGTTGATAGTGTCCAGG - Intronic
1016715426 6:147222361-147222383 GGCCTTTGGTAATGGTGTGGGGG + Intronic
1020586744 7:10078922-10078944 TGCCAGTGTTCATGGTGCCCAGG - Intergenic
1024281308 7:47721905-47721927 GGCCACTGGTCAGAGTCTCCTGG + Intronic
1024291192 7:47805736-47805758 GGCCTCTGGTCTTGGGGTCCTGG - Intronic
1024826934 7:53401256-53401278 ATCCATAGGTCATAGTGTCCTGG + Intergenic
1028527438 7:91801458-91801480 TGCCACTGTTCATGGTGCCCAGG + Intronic
1030096659 7:105906639-105906661 GGCCATTGGTCATGGTGTCCTGG + Intronic
1035082391 7:156227828-156227850 TGCCATTGGTCAAAGGGTCCTGG - Intergenic
1036732136 8:11275239-11275261 GGCCACTCTTCATGGTCTCCTGG - Intergenic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1044015390 8:87044378-87044400 GGTCATTGGTCATGTTTTCTGGG + Intronic
1046914656 8:119667123-119667145 GGCCATATGTCCTGGTTTCCTGG - Intronic
1048883977 8:138893848-138893870 GGTCAGTGGACATGGTGTCATGG + Intronic
1049542647 8:143215505-143215527 GGCCGTGGGTCAGGGTCTCCTGG - Intergenic
1051328260 9:15996954-15996976 GTGGATTGGTCATTGTGTCCTGG + Intronic
1052288689 9:26818082-26818104 GGCGTTTGGTCATGTTGGCCAGG - Intergenic
1053652153 9:40179563-40179585 GAACATTGGTCATTATGTCCTGG - Intergenic
1053902547 9:42808877-42808899 GAACATTGGTCATTATGTCCTGG - Intergenic
1054532431 9:66196643-66196665 GAACATTGGTCATTATGTCCTGG + Intergenic
1060445194 9:123681030-123681052 GGTCATTGGGCATAGTGTGCTGG + Intronic
1060749729 9:126161397-126161419 GGCGATTTGCCATGTTGTCCAGG + Intergenic
1061797788 9:133098412-133098434 TGCCATTGGTCAGGCTGACCTGG - Exonic
1186953777 X:14657512-14657534 GCCCTCTGGGCATGGTGTCCTGG + Intronic
1192565123 X:72157187-72157209 GACCATTGGTCCTGGTTCCCAGG - Intergenic
1192960388 X:76124315-76124337 GGCCTTTGGACTAGGTGTCCAGG - Intergenic
1193680503 X:84513389-84513411 GGCTATTGGCCATTGTTTCCAGG - Intergenic
1197141463 X:123121933-123121955 GGCCATGGGTGATTGTGTGCAGG - Intergenic
1199787756 X:151120070-151120092 ATCCATGGGTCATGGTGTCATGG - Intergenic