ID: 1030097184

View in Genome Browser
Species Human (GRCh38)
Location 7:105910765-105910787
Sequence CCACTGGTGTTGGCTGGTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 213}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030097184_1030097189 -4 Left 1030097184 7:105910765-105910787 CCGTGACCAGCCAACACCAGTGG 0: 1
1: 0
2: 1
3: 21
4: 213
Right 1030097189 7:105910784-105910806 GTGGTTCTTAAACTTCAGCCTGG No data
1030097184_1030097191 11 Left 1030097184 7:105910765-105910787 CCGTGACCAGCCAACACCAGTGG 0: 1
1: 0
2: 1
3: 21
4: 213
Right 1030097191 7:105910799-105910821 CAGCCTGGGTCTGAGTCACCTGG 0: 1
1: 0
2: 3
3: 35
4: 289
1030097184_1030097193 14 Left 1030097184 7:105910765-105910787 CCGTGACCAGCCAACACCAGTGG 0: 1
1: 0
2: 1
3: 21
4: 213
Right 1030097193 7:105910802-105910824 CCTGGGTCTGAGTCACCTGGAGG No data
1030097184_1030097194 15 Left 1030097184 7:105910765-105910787 CCGTGACCAGCCAACACCAGTGG 0: 1
1: 0
2: 1
3: 21
4: 213
Right 1030097194 7:105910803-105910825 CTGGGTCTGAGTCACCTGGAGGG No data
1030097184_1030097190 -3 Left 1030097184 7:105910765-105910787 CCGTGACCAGCCAACACCAGTGG 0: 1
1: 0
2: 1
3: 21
4: 213
Right 1030097190 7:105910785-105910807 TGGTTCTTAAACTTCAGCCTGGG 0: 1
1: 0
2: 3
3: 17
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030097184 Original CRISPR CCACTGGTGTTGGCTGGTCA CGG (reversed) Intronic
900404562 1:2486771-2486793 ACACTGGAGCTGGCTGGCCATGG + Intronic
900733746 1:4281235-4281257 CCATTGGTGTGGGCTGGGCCAGG + Intergenic
901103737 1:6739221-6739243 CTACTGGTCTGGGCTGGCCATGG + Intergenic
903388490 1:22945815-22945837 CCACTGGTCATGGCAGGGCAAGG - Intergenic
903518168 1:23926648-23926670 CAACAGGTGTTGGCTGGGCACGG - Intergenic
903926601 1:26834936-26834958 TCACTGGCAGTGGCTGGTCAGGG - Intronic
904901864 1:33863967-33863989 CCACAGGTGTTGGCTGGGATTGG + Exonic
907192410 1:52660371-52660393 TCACTGGGGTTGGCTAGTCTGGG + Intronic
910966746 1:92815619-92815641 CTACTGGTTGTGGCTGGGCATGG - Intergenic
911236934 1:95421953-95421975 CCTCTGGTGTTGGCGGGCCTGGG + Intergenic
912666659 1:111587022-111587044 CCACTGGTGTTGAGGAGTCAAGG - Intronic
913645133 1:120848179-120848201 CCTCTAGTTTTGGTTGGTCAGGG - Intergenic
914095817 1:144543641-144543663 CCTCTGGTTTTGGTTGGTCAGGG - Intergenic
914099509 1:144571475-144571497 CCTCTAGTTTTGGTTGGTCAGGG - Intergenic
914176499 1:145283906-145283928 CCTCTAGTTTTGGTTGGTCAGGG + Intergenic
914299475 1:146366202-146366224 CCTCTAGTTTTGGTTGGTCAGGG + Intergenic
914302704 1:146390328-146390350 CCTCTGGTTTTGGTTGGTCAGGG + Intergenic
914517100 1:148383356-148383378 CCTCTGGTTTTGGCTGGTCAGGG - Intergenic
914531227 1:148525385-148525407 CCTCTAGTTTTGGTTGGTCAGGG + Intergenic
914637163 1:149562355-149562377 CCTCTAGTTTTGGTTGGTCAGGG - Intergenic
915284840 1:154846051-154846073 CAGCTGGTGTTGGCTGGTGTGGG - Intronic
915547017 1:156605857-156605879 CAAATGGTGTTGGCCGGGCATGG + Intergenic
916272051 1:162953517-162953539 CCACTACAGTTGGCTGGGCACGG - Intergenic
916561210 1:165935304-165935326 CCAGTGCTGTTGGGTGGACAGGG - Intergenic
916824262 1:168429110-168429132 CAGCTGGTGTTGTCTGGTCAGGG - Intergenic
917001558 1:170367072-170367094 CCACTGGTATTAGCAGGTCCAGG + Intergenic
919183411 1:194114692-194114714 CCACTGCTGGTGGCTGGGCAAGG + Intergenic
923109621 1:230880185-230880207 TCACTGGTGATGGCTGGTGAAGG - Intergenic
923740179 1:236647594-236647616 CCTCTGTTGTTTGCTGGTGAGGG - Intergenic
923812603 1:237336563-237336585 AAACTTGTGTTGGCTGGGCACGG + Intronic
1062842564 10:682254-682276 TCACTGGTGTTGCAAGGTCAGGG - Intronic
1063888953 10:10609205-10609227 CCACATGTGTTTGCTGGCCAAGG + Intergenic
1067551983 10:47242713-47242735 CCACTGGTTGTGGTTGTTCAGGG - Intergenic
1070671408 10:78380096-78380118 CCACTGTTCTTGGCTGCACATGG - Intergenic
1071038877 10:81282465-81282487 CCATTAGTGTTGGCTGCTAATGG + Intergenic
1071519171 10:86318443-86318465 CCCCTGGTGTGGGCTGGCCCTGG - Intronic
1072283383 10:93891052-93891074 CCACTGGTCTTTGCATGTCAGGG - Intergenic
1073439311 10:103543357-103543379 CCACTGGTGCTGCGAGGTCACGG + Intronic
1074297990 10:112208955-112208977 CCACTGGCGTTGGCTGGAGAAGG + Intronic
1074998383 10:118777213-118777235 CCACTAGTTTTGGTTGGTCTGGG - Intergenic
1076180234 10:128401548-128401570 CCCCTGGTGTTAGCAGCTCAGGG - Intergenic
1079062146 11:17258476-17258498 TCCTTGGTGTTGGCTGGACATGG - Intronic
1080633589 11:34104183-34104205 CAACTGGTGTTGGGTAATCAAGG - Intergenic
1081119389 11:39246724-39246746 CCCCTAGTTTTAGCTGGTCAGGG - Intergenic
1084275877 11:68050677-68050699 CCACTGGCCTGGGCTGCTCAAGG + Intronic
1084419381 11:69052734-69052756 CCAGTGGCGTGGGCGGGTCATGG + Intronic
1084783307 11:71425654-71425676 CCACTTTTGTTGTCTGATCAGGG + Intergenic
1085288094 11:75377236-75377258 CCACAGATGTTGGCTGGGCATGG + Intergenic
1085542815 11:77288353-77288375 GCACTGGTGTTAGCAGGTCGAGG - Intronic
1087244236 11:95815657-95815679 TCACTGGTTCTGGCTGGGCAGGG + Intronic
1087643666 11:100783143-100783165 ACACTAGTCTTGGCTGGTCATGG + Intronic
1088446138 11:109930593-109930615 TCCCTGGACTTGGCTGGTCATGG + Intergenic
1089569168 11:119391350-119391372 TCACTGGTTTTGTCTGCTCAGGG + Intergenic
1090202760 11:124867899-124867921 CCACTTTTGTTGGCTGGACTAGG + Intronic
1090484617 11:127101953-127101975 CCACTGGTCTTGACAGGTGAGGG + Intergenic
1090974327 11:131668961-131668983 CCACTGGTGGTGGCCGGTAGGGG + Intronic
1095138097 12:38631069-38631091 CCATTGGTGTTGGATGTTAATGG + Intergenic
1095357887 12:41297704-41297726 CCACTGGGGTTGGCTGGAGAAGG - Intronic
1097201384 12:57281774-57281796 CCTGTGCTGTTGGCTGGGCATGG - Intronic
1100776507 12:97980025-97980047 GCACTGGTGTTGGCAGGTCCAGG - Intergenic
1102280460 12:111614791-111614813 CAACTGGGGTTGGATGGTCTAGG + Intergenic
1102566476 12:113800590-113800612 CTGCTGGTTTTGGCTGGGCACGG + Intergenic
1102698374 12:114817656-114817678 CCAGTCGTGTTGGCTTGGCAGGG + Intergenic
1106848265 13:33761145-33761167 CCACTGGGGTTCGGTGGTCTCGG + Intergenic
1108274244 13:48791591-48791613 TCCCTGGTGTGGGCTGGTCTGGG + Intergenic
1114203573 14:20546667-20546689 CCTCTGGTTTTGGCTGGAAATGG - Intergenic
1115758014 14:36549141-36549163 CCACTGATGTGGCCAGGTCAAGG - Intergenic
1119507797 14:75187917-75187939 CCACTGATGCTGGCTGGGCACGG + Intergenic
1119936285 14:78595138-78595160 CAACTGTAGTTGGGTGGTCAGGG + Intronic
1120349112 14:83330255-83330277 CCACTGCTGTGGGCTGAACAAGG - Intergenic
1121235899 14:92391085-92391107 CCACCGGTGAGAGCTGGTCACGG + Intronic
1122245052 14:100396579-100396601 CCACTTGTGTTGGCTTCTCTTGG - Intronic
1123047014 14:105522773-105522795 CCATTAGTGATGGCTGGGCACGG + Intergenic
1123196817 14:106624977-106624999 CCCCTGGAGATGCCTGGTCAAGG - Intergenic
1124336127 15:28858436-28858458 ACAACGGTGTTGGCTGGTCCTGG + Intergenic
1124456136 15:29844486-29844508 CCACTGATGCTGTCTGGTCCAGG - Intronic
1127152897 15:56096406-56096428 GCACTGGTGTTCGCTGGTTTGGG + Exonic
1127193194 15:56554757-56554779 CCCCTGGTTTTAGTTGGTCAGGG - Intergenic
1127410216 15:58697766-58697788 GCACTGGTGTTAGCAGGTCCAGG - Intronic
1127844366 15:62856684-62856706 ACAGTGGTGTTGGCAGGTGAGGG + Intergenic
1129239740 15:74244370-74244392 CCACTGGTGTGGGGTGGGGAGGG - Intronic
1129477485 15:75795891-75795913 TCACTGTTGTTGGCTATTCAGGG + Intergenic
1129613483 15:77080189-77080211 CTACTGTTTTTGGCTGGGCACGG + Intronic
1130882231 15:88065253-88065275 CCCCTGGTGTTGGATGCTCCTGG - Intronic
1132253284 15:100350365-100350387 CCACTGGAGTTGCCTTTTCAAGG - Intergenic
1132959437 16:2613749-2613771 CCTGGGGTGGTGGCTGGTCAGGG + Intergenic
1132972498 16:2695724-2695746 CCTGGGGTGGTGGCTGGTCAGGG + Intronic
1134252892 16:12587169-12587191 CCACTGGTGTTAGGTGGTCCCGG + Intergenic
1134629366 16:15745875-15745897 CAGCTGGTGTAGGCTGGGCATGG - Intronic
1134898984 16:17917481-17917503 CATCTGGTAATGGCTGGTCAAGG + Intergenic
1135113325 16:19707493-19707515 GCAGTGGTGTTGGCTGGACCTGG - Intronic
1135413303 16:22250907-22250929 GCCCTGGTGTTGGGAGGTCAAGG + Intronic
1136052369 16:27661026-27661048 TCCCTTGTGTGGGCTGGTCAGGG - Intronic
1137624338 16:49898174-49898196 CCCCGGGGGTGGGCTGGTCATGG + Intergenic
1138140799 16:54566944-54566966 CAACTGGGGATGGCTGGTCATGG - Intergenic
1138545955 16:57719796-57719818 TGACTGGTGTTGGTTGGGCATGG - Intronic
1139349987 16:66328830-66328852 CCCCTGGAGTAGGCTGGGCACGG + Intergenic
1141255263 16:82396341-82396363 ACACTGATGTTCACTGGTCAAGG - Intergenic
1142684717 17:1571244-1571266 CCCCTGGGGTGGGGTGGTCAGGG - Intronic
1143166010 17:4897616-4897638 CCACTGCTGCTGACTGGGCAGGG + Exonic
1143410654 17:6706533-6706555 CCACTGGTGAGGGCTGGCCATGG - Intronic
1148994054 17:51692920-51692942 CCACTGGTTTTGAATGGTCTTGG + Intronic
1149093178 17:52808758-52808780 CCACTGATTTTAGGTGGTCAGGG - Intergenic
1152367407 17:79864498-79864520 CCACAGGTGTCGGCCGGGCATGG + Intergenic
1152755624 17:82085855-82085877 CTACAGGTGCTGGCTGGCCACGG - Exonic
1158748137 18:60226313-60226335 CCAGTGGTGTTGGTGGGTCCAGG + Intergenic
1160254344 18:77235085-77235107 CCACTGGTGGAGTCCGGTCACGG - Intergenic
1160322101 18:77905685-77905707 CCCCTGGTCCTGGCTGGCCATGG - Intergenic
1163060192 19:14755141-14755163 ACACAGGTGTGGGCTGGGCATGG + Intronic
1164010608 19:21200527-21200549 CCACTGGTTTCGGCTGGCTATGG + Intergenic
1164608796 19:29618452-29618474 CCAGTGGTGATGGCAGCTCAGGG - Intergenic
1166953998 19:46449598-46449620 CCCCTGATTTTAGCTGGTCAAGG - Intergenic
925151585 2:1618844-1618866 TCACGGGTGGTGGCTGCTCACGG + Intergenic
925994046 2:9277272-9277294 CCACTGGTGCTGGCTGAGCCTGG + Intronic
927720581 2:25379403-25379425 CCCCTGGGGTGGGTTGGTCAGGG - Intronic
928106156 2:28471828-28471850 CCTGTGGTGCTGGCTGGTCCTGG + Intronic
928300814 2:30122354-30122376 CCACTGGCCTTTGCTGGTGAGGG - Intergenic
929644070 2:43609937-43609959 GCTCTGGTGTTGGCTTGGCAAGG + Intergenic
929874780 2:45787412-45787434 CCAGAGGTGATGACTGGTCAGGG - Intronic
929928797 2:46236252-46236274 CCACTGGTCTGGGCTTCTCATGG + Intergenic
936785849 2:116094001-116094023 GCACTGGTGTTAGCAGGTCCAGG + Intergenic
939173505 2:138723245-138723267 CCACTGCTGTTTGCTTTTCAAGG - Intronic
939208424 2:139139645-139139667 TCCCTGCTGTTGGCTGGGCATGG + Intergenic
940759842 2:157726069-157726091 CCTCTGTGGTTGGGTGGTCAAGG - Intergenic
943676161 2:190718095-190718117 CCTCTGGTGGGGGCTGGCCAGGG + Intergenic
944048656 2:195440875-195440897 GCACTGGTGTTAGCAGGTCCAGG - Intergenic
944260114 2:197667875-197667897 GCACTGGTGTTAGCAGGTCCAGG + Intronic
946226726 2:218267840-218267862 GCATTGGTGTTGGGTGGTGACGG - Intronic
946431465 2:219629000-219629022 ACACAGGTGTTGGGGGGTCATGG + Intronic
947912215 2:233808846-233808868 CCACAGGTGATGGGTGGTCTGGG + Intronic
948795390 2:240399817-240399839 TCCCTGGTGTGCGCTGGTCAGGG - Intergenic
1170745537 20:19095451-19095473 TCCCTGGTATTGGCTGGTAATGG + Intergenic
1173011962 20:39191051-39191073 CCAGTGCTGTTGGCTGCTAAGGG + Intergenic
1175159982 20:57001115-57001137 GCTCTGGAGTTGGGTGGTCATGG - Intergenic
1175200602 20:57274373-57274395 CCACTGGGGTTGCTAGGTCAGGG + Intergenic
1175918739 20:62440039-62440061 GCACAGGTGTGGGCTGCTCAGGG - Intergenic
1175970150 20:62682150-62682172 CTACTGGTGTTAGCTTGTCAGGG + Intronic
1176067391 20:63205350-63205372 CCACCAGTGTTGGCTGGTGTTGG - Intronic
1176113691 20:63422051-63422073 CCGCTGGTGTCAGCTGGTCTTGG - Intronic
1176378585 21:6100360-6100382 CCACCGGGGGTGGCTGGGCATGG + Intergenic
1176385012 21:6134816-6134838 CCAGTGATGTGGGCTGGCCACGG + Intergenic
1177584988 21:23079842-23079864 ACATTCGTGTGGGCTGGTCAAGG - Intergenic
1178919792 21:36731174-36731196 CCACGGGAGGTAGCTGGTCAGGG + Intronic
1179032011 21:37729201-37729223 ACACTGATGTTGGCTGCCCATGG + Intronic
1179738461 21:43403436-43403458 CCAGTGATGTGGGCTGGCCACGG - Intergenic
1179744890 21:43437877-43437899 CCACCGGGGGTGGCTGGGCATGG - Intergenic
1181037103 22:20174976-20174998 CCATTGGTGTTGGGTGGACATGG + Intergenic
1182871130 22:33648610-33648632 CCTTTGGTCTTGGCTGGTCTGGG - Intronic
1183072598 22:35406826-35406848 CCACTGGGATGGGCTGGGCAGGG + Intronic
1184722561 22:46323550-46323572 CCCCTGGGGTGGGCTGGGCACGG - Intronic
950216189 3:11161453-11161475 CCACAGGTGTGGGCTGGTGGTGG - Intronic
950532894 3:13563309-13563331 CCACAGGTGCTGGCTGCTGATGG + Intronic
952160204 3:30685773-30685795 CCACAGGTGTTGGCTCATAAGGG - Intronic
952390598 3:32876291-32876313 CCACTGGTGTCAGCAGGGCACGG + Intronic
954386427 3:50246365-50246387 CCCCTGGTGGTGGCGGGGCATGG + Intronic
954725107 3:52601693-52601715 GCACTGGTGTTAGCAGGTCCAGG + Intronic
961377068 3:126474352-126474374 CCACTGCTGGTGGCTGGGCGCGG - Intronic
962183395 3:133232408-133232430 CCACTGGTGGTGGAAGGTAAAGG - Intronic
962743990 3:138383904-138383926 GGTCTTGTGTTGGCTGGTCAAGG + Intronic
965543258 3:169891063-169891085 CCACTGATGTTCGCTGGCAAGGG - Intergenic
966639504 3:182174059-182174081 CCACTGTCATTGGTTGGTCATGG + Intergenic
966878149 3:184335283-184335305 CCCCTGCTGTTGCCTGGGCAGGG + Exonic
970235895 4:13957695-13957717 CCACTCGTGGTGGCAGGTGAAGG - Intergenic
970251936 4:14125923-14125945 CCACTGGTGTTTGGAGGGCAGGG + Intergenic
971727068 4:30327788-30327810 CCACTGCTCTTTGCTGGGCAGGG - Intergenic
974630427 4:64480846-64480868 CCACTGGGATGGGCTAGTCATGG + Intergenic
980132414 4:128829165-128829187 CCACTGGTGTTTCTTGGTTATGG + Intronic
981288504 4:143047073-143047095 GCACTGCTGTTGCCTTGTCAGGG - Intergenic
982645088 4:158013694-158013716 CCACTGGGGTTGGGTTGACAAGG + Intergenic
984776601 4:183486666-183486688 CAATTGGTTTTGGCTGGGCATGG + Intergenic
985032085 4:185799684-185799706 CTACTGGTGTTGGTTGTTCCTGG - Intronic
985140107 4:186831300-186831322 CCACTGCTGTCGGCAAGTCAGGG + Intergenic
985310331 4:188590408-188590430 CCACTTGGATTGGCTGGGCACGG - Intergenic
986063728 5:4215785-4215807 CCTATGGTGCTGGCTAGTCAGGG + Intergenic
988478582 5:31610307-31610329 CCAGTGCTATTGGCTGGGCACGG + Intergenic
990570326 5:57071900-57071922 AGACTGGTGGTGGCTGGGCATGG - Intergenic
991979230 5:72214407-72214429 CCAAGGGTGTTTCCTGGTCATGG + Intergenic
992027278 5:72682436-72682458 ACACTGGTGTTGGATGTGCATGG + Intergenic
992369607 5:76129188-76129210 CCATTGGGGTTAGCTGGTGAAGG - Intronic
996302816 5:122008238-122008260 CCACTGATGTTGGCCTGTCTTGG + Intronic
997782009 5:136668098-136668120 GCACTGGTGTTAGCAGGTCCAGG - Intergenic
1000572647 5:162934991-162935013 CCCATGGTGTTGGTTGGTTAGGG + Intergenic
1001265625 5:170272364-170272386 CAACTGGTTTTGTCTGCTCAGGG - Intronic
1002417857 5:179130155-179130177 CCACTGGTTTGGGCTGGTCGGGG + Intronic
1003526510 6:6902413-6902435 ACACTGGTGTAGACTGGACATGG - Intergenic
1004162601 6:13228166-13228188 GCTCTGGTGTTGACTGGTCCTGG + Intronic
1004687493 6:17961264-17961286 TCACTAGTGTGGGCTGGTAAGGG + Intronic
1006411248 6:33875110-33875132 CCAGTGGGGTTGGCTGGTCTAGG + Intergenic
1006669627 6:35721742-35721764 CCACTATTGTCGGCTGGGCATGG - Intronic
1010138463 6:72583660-72583682 CAAATGGTGTTTGCTGGTTAAGG - Intergenic
1013356323 6:109348791-109348813 AAACTGGTCTTGGCTGGACACGG + Intergenic
1016189480 6:141245715-141245737 ACACTGGTGATGGTTGGGCAAGG + Intergenic
1016425816 6:143934882-143934904 GCACTGGTGTTAGCAGGTCCAGG + Intronic
1018069818 6:160154384-160154406 CCACAGGTGATGACAGGTCATGG + Intronic
1018230921 6:161674417-161674439 CCACAGTTGGTGGCTGTTCAAGG + Intronic
1019922442 7:4171647-4171669 CCACTGGTGGTGGCCAGTGAAGG + Intronic
1023916730 7:44595470-44595492 GGATTGGTGTTGGCTGGGCAAGG - Intergenic
1026508928 7:71011211-71011233 CCAGAGGTGTTGGCTGGGGAAGG - Intergenic
1028420709 7:90629572-90629594 CTACTGGTGTTTGGTGGGCAGGG + Intronic
1029229506 7:99054594-99054616 CAACTGGAGTTGGCTGGGCGTGG - Intronic
1029542416 7:101191907-101191929 TCACTCTTGTTGGCTGGGCACGG + Intergenic
1030097184 7:105910765-105910787 CCACTGGTGTTGGCTGGTCACGG - Intronic
1032191641 7:129769273-129769295 CCACAGGGGTTGGTGGGTCATGG + Intergenic
1035450023 7:158971386-158971408 CAGCTGGGGATGGCTGGTCAGGG - Intergenic
1036294788 8:7527136-7527158 AAACTGGAGTTGGCTGGTCTAGG - Intergenic
1036327775 8:7793855-7793877 AAACTGGAGTTGGCTGGTCTAGG + Intergenic
1038447985 8:27617094-27617116 CCACTGGCATTGGCTAGTCCAGG - Intergenic
1039586625 8:38712557-38712579 GCACTGGTGGTGGCTGGGAAGGG + Intergenic
1041549988 8:59089872-59089894 CTTCTGGTTTTGGCTGGGCATGG - Intronic
1042028256 8:64446827-64446849 CCACTGGGTTTGGCTGATGATGG - Intergenic
1047427495 8:124759985-124760007 ATACTGGTCTTGGCTGGACATGG - Intergenic
1049300048 8:141864762-141864784 TCACAGGTGCTGGCTGCTCAGGG + Intergenic
1049447318 8:142637291-142637313 CCACTGTTGTTGGCACGTCAGGG - Intergenic
1049673986 8:143881691-143881713 CCATTGGTGGTGGTTGGTTAGGG + Intergenic
1053440321 9:38110866-38110888 GCACTGGTGTTGGCTGGGACGGG - Intergenic
1054766129 9:69044011-69044033 ACACTGATCTTGGCTGGGCATGG - Intronic
1055647036 9:78371049-78371071 CCACTGCTGGTGGGTCGTCAGGG - Intergenic
1055821452 9:80269662-80269684 CTATTTGTGTTGGGTGGTCAAGG - Intergenic
1055824099 9:80303348-80303370 CCACTATTCTTGGCTGGGCATGG + Intergenic
1057701966 9:97369962-97369984 CCAAGTGTGTTGGCTGGTGATGG + Exonic
1059610481 9:115887264-115887286 GCACTGCTCTTGGCTGTTCAAGG + Intergenic
1059724367 9:116991683-116991705 CCACTGGTGGAGGCTGAGCAGGG - Intronic
1062011183 9:134267672-134267694 CCACATCTGTTGGCTGGACATGG + Intergenic
1185786175 X:2892815-2892837 CCACTTCTGTTGCCTGGTCCAGG + Intergenic
1185987444 X:4851301-4851323 CCACTGGCGTTGGCCACTCAGGG - Intergenic
1186249385 X:7649914-7649936 CTGCTTGTGTTGGCTGGGCATGG + Intergenic
1186668493 X:11744449-11744471 CCCCTAGTTTTAGCTGGTCAGGG - Intergenic
1186735464 X:12458683-12458705 CCATTGGTGAAGGCAGGTCAGGG + Intronic
1190255473 X:48759183-48759205 CTGATGGTGTTGGCTGGGCATGG - Intergenic
1191902728 X:66055806-66055828 CCACTGAAGCTGGCTGATCAGGG + Intergenic
1194009268 X:88538243-88538265 CCACTAGTTTTAGTTGGTCAGGG - Intergenic
1197989264 X:132299371-132299393 CCACTAGTGTTGGGTGGTGATGG - Intergenic
1198278953 X:135123620-135123642 TCACTGCTTTTGGCTGGACATGG + Intergenic
1198292005 X:135248900-135248922 TCACTGCTTTTGGCTGGACATGG - Intronic
1200406564 Y:2817895-2817917 GCACTGGATTTGGCTGGGCATGG - Intergenic
1201692977 Y:16789673-16789695 CCACTGGTGATACCTGGGCAAGG + Intergenic