ID: 1030098148

View in Genome Browser
Species Human (GRCh38)
Location 7:105919912-105919934
Sequence CTGTGACATGACATCAATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030098139_1030098148 30 Left 1030098139 7:105919859-105919881 CCTGGAATCCATTGGCTTCTTTG 0: 1
1: 0
2: 0
3: 19
4: 236
Right 1030098148 7:105919912-105919934 CTGTGACATGACATCAATCTTGG 0: 1
1: 0
2: 0
3: 7
4: 107
1030098143_1030098148 22 Left 1030098143 7:105919867-105919889 CCATTGGCTTCTTTGATGGGGAT 0: 1
1: 0
2: 0
3: 18
4: 186
Right 1030098148 7:105919912-105919934 CTGTGACATGACATCAATCTTGG 0: 1
1: 0
2: 0
3: 7
4: 107
1030098147_1030098148 -10 Left 1030098147 7:105919899-105919921 CCTGGGACTATTGCTGTGACATG 0: 1
1: 0
2: 2
3: 8
4: 89
Right 1030098148 7:105919912-105919934 CTGTGACATGACATCAATCTTGG 0: 1
1: 0
2: 0
3: 7
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030098148 Original CRISPR CTGTGACATGACATCAATCT TGG Intronic
902107932 1:14053117-14053139 CTGTGACATTACATCACACAGGG + Intergenic
905166326 1:36085266-36085288 CTGTGTCAGGGCATCGATCTCGG - Exonic
909840652 1:80318297-80318319 CAGTGACAGTACATCATTCTGGG + Intergenic
912128163 1:106566637-106566659 TTGTGACAAGACATCATGCTTGG - Intergenic
912683784 1:111746080-111746102 CTGTGATTAGACATCAACCTTGG + Intronic
914407340 1:147389370-147389392 CTGTGACCTGACCTCAAGCAAGG + Intergenic
918132653 1:181643316-181643338 ATATCACATGACATCAATGTTGG + Intronic
922226133 1:223647329-223647351 CTGTGAAATTACAACTATCTGGG - Intronic
923824948 1:237489866-237489888 CAAAGACATGTCATCAATCTAGG + Intronic
1065991477 10:31014185-31014207 CTGTGACATGACATGATTAGAGG - Intronic
1069580879 10:69565840-69565862 CTGCTCCATGACATCATTCTGGG - Intergenic
1073350139 10:102813673-102813695 CTGTGCCCTGACATGATTCTTGG + Exonic
1074070631 10:110065241-110065263 CTGTGACAAGATGTCAGTCTAGG - Intronic
1078387112 11:10902265-10902287 CCGAGATATGAAATCAATCTAGG - Intergenic
1079370608 11:19848876-19848898 CTGTGACATGAGATCTCTCAGGG - Intronic
1084027408 11:66460344-66460366 GTGTCACATGACTTCAATCAAGG + Intronic
1084027476 11:66460928-66460950 GTGTCACATGACTTCAATCAAGG + Intronic
1094057904 12:26285351-26285373 CTGTGCCATGAAATCATTCAAGG - Intronic
1095088590 12:38084422-38084444 CTGTGACATGACACAAGTCAGGG - Intergenic
1096454299 12:51772498-51772520 CAGTGACATGAGATCAGTCTTGG + Intronic
1097585300 12:61508178-61508200 CTGTGACATGAGGTCAAGTTTGG + Intergenic
1099182238 12:79482263-79482285 GAGTGACATGACTTGAATCTAGG - Intergenic
1099753258 12:86805627-86805649 CAGAGACATGAAATCAACCTAGG - Intronic
1103047647 12:117750917-117750939 CAAAGACATGAAATCAATCTAGG - Intronic
1103706780 12:122879184-122879206 CTGTAACATGACCACAAACTGGG - Intronic
1103959777 12:124602113-124602135 CAGTGGCATGATCTCAATCTTGG + Intergenic
1104576176 12:129967835-129967857 CTGTGACATGACATGTGTCTAGG - Intergenic
1107572568 13:41678384-41678406 CTGTGATATAAGGTCAATCTTGG + Intronic
1108179236 13:47824593-47824615 CTGTTACATGATATAAATTTTGG + Intergenic
1109286481 13:60415140-60415162 CTGTTATAAAACATCAATCTTGG - Intronic
1118939065 14:70315861-70315883 CTGTGGCCTGACATAGATCTGGG + Intergenic
1123765526 15:23474399-23474421 CTGTAACATGACTCAAATCTTGG + Intergenic
1123878715 15:24653288-24653310 CAGTGACATGGAATCAACCTAGG + Intergenic
1124949454 15:34303218-34303240 CTGTAACATGAAATCAATATAGG - Intronic
1127219322 15:56861233-56861255 CCAAGACATGAAATCAATCTAGG + Intronic
1135813029 16:25607021-25607043 CAAAGACATGAAATCAATCTAGG - Intergenic
1138782692 16:59808193-59808215 CTGTTAGCTGACATCAATGTTGG - Intergenic
1147507728 17:41036641-41036663 GTGTGTCATGACAACAATCTCGG + Intergenic
1148975511 17:51524764-51524786 CTGTTGCAGGACAACAATCTTGG + Intergenic
1149854727 17:60071252-60071274 CTGAGTCAAGAAATCAATCTTGG - Intronic
1150727445 17:67662945-67662967 CAAAGACATGAAATCAATCTAGG - Intronic
1150865143 17:68841302-68841324 CTTTGACATCAGATCAATGTGGG + Intergenic
1155427911 18:25725251-25725273 CTGAAACAGGATATCAATCTGGG + Intergenic
1156680708 18:39585415-39585437 CTGTACCATGCCATCAGTCTAGG + Intergenic
1156971179 18:43158453-43158475 CTTTGAAATGACACCAGTCTGGG - Intergenic
1163080644 19:14939326-14939348 CTGTGCCATGACAGCAAGCAGGG - Intergenic
1163560665 19:18017485-18017507 CTTTGACCTGGCATCAAGCTTGG + Intergenic
1163670623 19:18626069-18626091 CTCTGACATGACATCATGCCTGG + Intergenic
1164509675 19:28887026-28887048 ATGTGAAATGACAGCTATCTGGG + Intergenic
1165100053 19:33433955-33433977 TTGTGAGATGTCATCAATCTGGG - Intronic
1166577951 19:43862034-43862056 CTAAGACATGAAATCAACCTGGG + Intergenic
925565998 2:5255092-5255114 CCTTGACTTGACTTCAATCTGGG - Intergenic
930379652 2:50611931-50611953 CTCTGACATCCCAGCAATCTAGG + Intronic
930658140 2:54027344-54027366 CTGTTACATGACAGCCTTCTGGG - Intronic
931286823 2:60839432-60839454 CTGTCACAAGACAACAATTTAGG - Intergenic
938144160 2:128820178-128820200 CTGTGACTTGCCTTCAGTCTGGG - Intergenic
943013027 2:182474987-182475009 GTGTGGCTTGACATCATTCTGGG + Intronic
943019476 2:182555073-182555095 CTGTTACCTGACATCACTCCTGG + Intergenic
943325570 2:186493588-186493610 CTGTAACATGACTACAAACTGGG + Intronic
944583073 2:201149868-201149890 CTGTGCCATGATCTCAATCTGGG - Intronic
945552474 2:211237232-211237254 CTGGGAAATGACATGAATCTGGG + Intergenic
948426720 2:237892698-237892720 GTGTGAGATGACAGGAATCTGGG + Intronic
1169129326 20:3156645-3156667 CTGTGAAATCACATCATTCAGGG - Intronic
1172438124 20:34944811-34944833 CTGTCACATGACATCAGGCGTGG + Intronic
1178974933 21:37213386-37213408 CTGAGATATGAAATCAACCTGGG - Intergenic
950636755 3:14321013-14321035 CTGTGAGATCATGTCAATCTTGG - Intergenic
954454555 3:50590715-50590737 CTGTCACAGCAAATCAATCTGGG + Intergenic
955519698 3:59763096-59763118 CTGTGGGTTGACATCACTCTAGG - Intronic
956303008 3:67792834-67792856 ATGTGAGATGTTATCAATCTTGG - Intergenic
958573046 3:95912050-95912072 CTCTGACCTGAGATCAATGTGGG - Intergenic
964886921 3:161494076-161494098 CAAAGACATGAAATCAATCTAGG - Intergenic
965160228 3:165123842-165123864 AAGAGACATGACATCAACCTAGG + Intergenic
965424596 3:168506376-168506398 CTGAGAGGTGAAATCAATCTGGG - Intergenic
970352134 4:15212680-15212702 GTGAGACATGAAATCAATTTAGG + Intergenic
970720395 4:18981371-18981393 CTGTGATATGACTTCATTCCTGG + Intergenic
972218948 4:36931154-36931176 CTGTTACATAACATAAATGTGGG - Intergenic
973992141 4:56419990-56420012 CTGTGACATGTTCTCCATCTTGG - Intronic
975002301 4:69239637-69239659 CTGTGAAATGACAACGCTCTCGG - Intergenic
978306134 4:107330500-107330522 CTGTGACCTTACATAAAACTAGG + Intergenic
987439442 5:17938475-17938497 CAAAGACATGAAATCAATCTTGG + Intergenic
994473473 5:100238808-100238830 CTGTGAGATGCCATGAAACTGGG + Intergenic
994864087 5:105242509-105242531 CTGAGATATGACATTTATCTTGG + Intergenic
997172560 5:131738548-131738570 CAGTGGCATGACTGCAATCTTGG + Intronic
997218673 5:132137518-132137540 CAGTGGCATGATCTCAATCTCGG - Intergenic
997742829 5:136272535-136272557 CTGTGGCATGAGATGACTCTTGG - Intronic
999704522 5:154260119-154260141 CTATGACATGACAGCCATTTAGG - Intronic
1008222129 6:48867733-48867755 CAGTGACATGATCTCGATCTTGG - Intergenic
1010244405 6:73650010-73650032 CTTTGTCATCACATCCATCTCGG - Intronic
1011100261 6:83712216-83712238 ATGTGACATTACATCATTATTGG - Intergenic
1013372307 6:109481897-109481919 CTGTGACATTACTTTAATCGTGG - Exonic
1013763660 6:113549306-113549328 ATGTGTCATGACATTGATCTGGG + Intergenic
1013879652 6:114880810-114880832 CAGTAACATGATATAAATCTTGG - Intergenic
1016481999 6:144492431-144492453 CAAAGACATGTCATCAATCTAGG - Intronic
1016778922 6:147936881-147936903 ATGTGACACGTCATCAGTCTTGG + Intergenic
1019882332 7:3873917-3873939 CTCAGACATGACATGTATCTTGG - Intronic
1025066018 7:55856733-55856755 CTGAGACATGGAATCAACCTAGG - Intronic
1030098148 7:105919912-105919934 CTGTGACATGACATCAATCTTGG + Intronic
1032752405 7:134854660-134854682 CTGTGCTATGACATTAATCCGGG - Intronic
1034780945 7:153882024-153882046 CTATCACATGTCATCAAGCTTGG + Intergenic
1037966952 8:23142327-23142349 CAGTGACATGGAATCAACCTAGG + Intronic
1039084182 8:33763477-33763499 CTTTCACATGACTTCAAACTTGG - Intergenic
1039167920 8:34707111-34707133 CAAAGACATGAGATCAATCTAGG - Intergenic
1041848808 8:62362958-62362980 CTGTAACATTACCTTAATCTCGG - Intronic
1042938845 8:74087518-74087540 CTGAGAGATGGCATCAGTCTTGG + Intergenic
1046856486 8:119038172-119038194 CTTTGATATGAGATCAACCTGGG + Intronic
1049378490 8:142300806-142300828 CTGTCACTGGGCATCAATCTGGG + Intronic
1050733104 9:8732324-8732346 CTGTGATCTGACATTAAACTGGG + Intronic
1058938411 9:109790722-109790744 GTGTGACTTGACATACATCTTGG + Intronic
1059038316 9:110784510-110784532 CTATGACCTGACATAAATCATGG - Intronic
1059213225 9:112534143-112534165 CTGTGTCATGACATAGAGCTTGG + Intronic
1061441210 9:130605091-130605113 CAGTGTCATGAAATCAATATAGG - Intronic
1186111319 X:6259400-6259422 CAAAGACATGAAATCAATCTAGG - Intergenic
1186289477 X:8080863-8080885 CTGTGACATGACTTCAAGGGGGG - Intergenic
1194805645 X:98324260-98324282 CAAAGACATGAAATCAATCTAGG + Intergenic
1199596220 X:149508181-149508203 CTGTGTCCTGTCATCATTCTGGG - Intronic