ID: 1030101892

View in Genome Browser
Species Human (GRCh38)
Location 7:105954108-105954130
Sequence AACTTCTTTGAGGAGTATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030101887_1030101892 19 Left 1030101887 7:105954066-105954088 CCCACATTCTCACATGTCAATCG 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1030101892 7:105954108-105954130 AACTTCTTTGAGGAGTATTTTGG No data
1030101888_1030101892 18 Left 1030101888 7:105954067-105954089 CCACATTCTCACATGTCAATCGT 0: 1
1: 0
2: 1
3: 14
4: 115
Right 1030101892 7:105954108-105954130 AACTTCTTTGAGGAGTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030101892 Original CRISPR AACTTCTTTGAGGAGTATTT TGG Intronic
No off target data available for this crispr